GeneSeqer.   Version of February 10, 2003.
Date run: Thu Feb 20 10:58:27 2003

(Bayesian) Splice site model (species):	Arabidopsis thaliana
Fast search parameters:  MinMatchLen 12, MinQuality 30.

________________________________________________________________________________
Sequence    1:   21326110, from 7500 to 22500, both strands analyzed.

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MCest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MTest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 6

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MTest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 4 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MPest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/BVSVest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GHcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/BVSVcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ZMest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ZMest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LHcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ASest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 9

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest3;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest4;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 7

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest5;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ATest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 5

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ATest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 5

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MScdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MSest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GAest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 11

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LJcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LEcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/OSest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 2 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/OSest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 1 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SCcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LPest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LEest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 4 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LEest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/OScdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MPcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SBest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 39

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 5
... matches indexed, elapsed seconds = 5 HitsTableSize = 13

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 4 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest3;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest4;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/STcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ATcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 13

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SCest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SPest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 11

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ZMcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTPTest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MCcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTPTcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest2;	matching gDNA +strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 5

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest3;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 4 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest4;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LHest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SBcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GHest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MTcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LPcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/STest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 12

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GAcdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LJest1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/AScdna1;	matching gDNA +strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MCest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MTest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MTest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MPest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/BVSVest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GHcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/BVSVcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ZMest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 2 HitsTableSize = 11

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ZMest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 28

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LHcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 2 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ASest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 4 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 5

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest3;	matching gDNA -strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 22

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest4;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAest5;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ATest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ATest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MScdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MSest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GAest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 8

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LJcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LEcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/OSest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 9

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/OSest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 4

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SCcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LPest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LEest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 4
... matches indexed, elapsed seconds = 4 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LEest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/OScdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MPcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SBest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 16

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 4
... matches indexed, elapsed seconds = 4 HitsTableSize = 9

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest3;	matching gDNA -strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/HVest4;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/STcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ATcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 2 HitsTableSize = 10

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SCest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SPest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 3

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/ZMcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTPTest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MCcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/PTPTcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 2 HitsTableSize = 6

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest2;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 2 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest3;	matching gDNA -strand ...
... found all matches, elapsed seconds = 2
... matches indexed, elapsed seconds = 3 HitsTableSize = 2

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GMest4;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LHest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/SBcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GHest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/TAcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/MTcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LPcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/STest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 3
... matches indexed, elapsed seconds = 3 HitsTableSize = 5

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/GAcdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/LJest1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 1
... matches indexed, elapsed seconds = 1 HitsTableSize = 1

EST library file:	/PlantGDB/DATA/GeneSeqer/Index/AScdna1;	matching gDNA -strand ...
... found all matches, elapsed seconds = 0
... matches indexed, elapsed seconds = 0 HitsTableSize = 0





********************************************************************************
EST sequence    7 +strand (File: 13557989+)

     1  CCAACCACAC TCGCAGCCAG CCTGCCCGCT CGCCCGCCCG CCATTCTTGC CGATTCGAGT
    61  CGACGTCACG CCTCCGGCGC CCCCTTCGGT TGTCACCTCG GGGGTCGCGG ATTGGTGGAG
   121  GGGAGGATTT GAGCGGCGCG GCCATGGATA CAACATCTAG GGCCGCCATA GTATCCCGTC
   181  GCTCCACCAG ACGGAGATCA ACTGGGATAA CCTCGACAAG ACCAAGCTCT ACGTGGTGGG
   241  CGCAGGCATG TTCAGCGGGG TCACCGCGGC GCTGTACCCT GTCTCGGTGG TCAAGACCCG
   301  GATGCAGGTT GCCTCTGGGG ACGCCATGGG GAGGAACGCA CTGGCTACCT TCAAGAACAT
   361  CCTTAAGGTG GACGGCGTGC CAGGGCTGTA CCGGGGGTTT CCTACTGTTA TCATTGGGGC
   421  TGTACCAACT AGGATCATCT TCCTCACGGC GCTTGAGACA ACCAAAGCAG CCTCTCTCAA
   481  GCTTGTTGAG CCCTTCAAGC TGTCAGAGCC GGTGCAGGCT GCCTTTGCCA ATGGCCTTGC
   541  CGGTCTGTCG GCATCTACAT GTTCGCAGGC TA

Predicted gene structure (within gDNA segment 7500 to 9005):

 Exon  1   7879   8058 ( 180 n);  cDNA     29    210 ( 182 n); score: 0.928
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.90), Pa: 0.581 (s: 0.98)
 Exon  2   8339   8700 ( 362 n);  cDNA    211    572 ( 362 n); score: 0.956

MATCH	21326110+	13557989+	0.946	542	0.948	C
PGS_21326110+_13557989+	(7879  8058,8339  8700)

Alignment (genomic DNA sequence = upper lines):

CCCGCCCGCC CGCCATTCTT GCCGAATCGA GTCCACGCCA CGCCTCCTGC GCCCCCTTCG     7938
| |||||||| |||||||||| ||||| |||| ||| ||| || ||||||| || |||||||||| 
CTCGCCCGCC CGCCATTCTT GCCGATTCGA GTCGACGTCA CGCCTCCGGC GCCCCCTTCG       88


GTTCTCACCT CGGGAGTCGC GGATTGGTGG AGGGGAGGAT TTGAGCGGCG CGGCCATGGA     7998
||| |||||| |||| ||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GTTGTCACCT CGGGGGTCGC GGATTGGTGG AGGGGAGGAT TTGAGCGGCG CGGCCATGGA      148


TACAACCTCT AGGGCCGCCA -AG-ATCCCG TCGCTCCACC AGACGGAGAT CAACTGGGAC     8056
|||||| ||| ||||||||||  || |||||| |||||||||| |||||||||| |||||||||  
TACAACATCT AGGGCCGCCA TAGTATCCCG TCGCTCCACC AGACGGAGAT CAACTGGGAT      208


AAGTAAGCAA CCCACCGGTC TTGTAATCCT TAGGTTCCCA TTTCGTGCCG ATTTCCGCCT     8116
||                                                                
AA........ .......... .......... .......... .......... ..........      210


TTCTCGCGGT CCTAGTCTTC TAGAAATTTA GCTCCGATCG TTGAACTGTG TCCCCCGCCC     8176
                                                                  
.......... .......... .......... .......... .......... ..........      210


TATTCCGGAT TGGCTTTACC GCCTTAGGAT TAGGAACTGT TGTTTGAGGA TTTGACATGG     8236
                                                                  
.......... .......... .......... .......... .......... ..........      210


CTGTTCATGC TCCTGGACGA AGCGCAATTT GGGGATTCGT AGCTTATTCC GTTGTTTCCG     8296
                                                                  
.......... .......... .......... .......... .......... ..........      210


ATTCTTTTAC TGTTCTCAAA TCGTGGCGCT GAAATGTTGC AGCCTCGACA AGACCAAGCT     8356
                                              |||||||| |||||||||| 
.......... .......... .......... .......... ..CCTCGACA AGACCAAGCT      228


CTACGTGGTG GGCGCAGGCA TGTTCAGCGG CGTCACCGTG GCGCTGTATC CTGTCTCGGT     8416
|||||||||| |||||||||| ||||||||||  ||||||| | |||||||| | |||||||||| 
CTACGTGGTG GGCGCAGGCA TGTTCAGCGG GGTCACCGCG GCGCTGTACC CTGTCTCGGT      288


GGTCAAGACC CGGATGCAGG TTGCCTCTGG GGACGCCATG AGGAGGAACG CGCTGGCTAC     8476
|||||||||| |||||||||| |||||||||| ||||||||||  ||||||||| | |||||||| 
GGTCAAGACC CGGATGCAGG TTGCCTCTGG GGACGCCATG GGGAGGAACG CACTGGCTAC      348


CTTCAAGAAC ATCCTCAAGA TGGACGGCGT GCCAGGGCTG TACCGGGGGT TTGCTACCGT     8536
|||||||||| ||||| |||  |||||||||| |||||||||| |||||||||| || |||| || 
CTTCAAGAAC ATCCTTAAGG TGGACGGCGT GCCAGGGCTG TACCGGGGGT TTCCTACTGT      408


TATCATTGGG GCTGTACCAA CTAGGATCAT CTTCCTCACA GCGCTTGAGA CAACCAAAGC     8596
|||||||||| |||||||||| |||||||||| |||||||||  |||||||||| |||||||||| 
TATCATTGGG GCTGTACCAA CTAGGATCAT CTTCCTCACG GCGCTTGAGA CAACCAAAGC      468


AGCCTCGCTT AAGCTTGTTG AGCCCTTCAA GCTGTCAGAG CCGGTGCGGG CTGCCTTTGC     8656
|||||| ||  |||||||||| |||||||||| |||||||||| ||||||| || |||||||||| 
AGCCTCTCTC AAGCTTGTTG AGCCCTTCAA GCTGTCAGAG CCGGTGCAGG CTGCCTTTGC      528


CAATGGCCTT GCTGGTCTGT CAGCGTCTAC ATGTTCGCAG GCTA     8700
|||||||||| || ||||||| | || ||||| |||||||||| ||||
CAATGGCCTT GCCGGTCTGT CGGCATCTAC ATGTTCGCAG GCTA      572





********************************************************************************
EST sequence    5 +strand (File: 6626513+)

     1  GCACGAGGTT GTTGTGGACA AAAAGAGCAC AAAAGTGGGT AGGGCAAGCC AACCACACTC
    61  GCAGCCAGCC TGCCTGCTCG CCCGCCCGCC ATTCTTGCCG ATTCGAGTCG ACGTCACGCC
   121  TCCGGCGCCC CCTTCGGTTG TCACCTCGGG GGTCGCGGAT TGGTGGAGTG GAGGATTTGA
   181  GCGGCGCGGC CATGGATACA ACCTCTAGGG CCGCCAAGAT CCCGTCGCTC CACCAGACGG
   241  AGATCAACTG GGATAACCTC GACAAGACCA AGCTCTACGT GGTGGGCGCA GGCATGTTCA
   301  GCGGGGTCAC CGTGGCGCTG TACCCTGTAT CGGTGGTCAA GACCCGGATG CAGGTTGCCT
   361  CTGGGGATGC CATGGGGAGG AACGCGCTGG CTACCTTCAA GAACATCCTT AAGGTGGACG
   421  GCGTGCCAGG GCTGTACCGG GGGTTTCCTA CTGTTATAAT TGGGGCTGTA CCAACTAGGA
   481  TTATCTTCCT CACGGNGCTT GAGACAACCA AAGCAGCCTC TCTCAAGCTT

Predicted gene structure (within gDNA segment 7500 to 8957):

 Exon  1   7879   8058 ( 180 n);  cDNA     77    256 ( 180 n); score: 0.950
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.98), Pa: 0.581 (s: 0.98)
 Exon  2   8339   8612 ( 274 n);  cDNA    257    530 ( 274 n); score: 0.945

MATCH	21326110+	6626513+	0.947	454	0.857	C
PGS_21326110+_6626513+	(7879  8058,8339  8612)

Alignment (genomic DNA sequence = upper lines):

CCCGCCCGCC CGCCATTCTT GCCGAATCGA GTCCACGCCA CGCCTCCTGC GCCCCCTTCG     7938
| |||||||| |||||||||| ||||| |||| ||| ||| || ||||||| || |||||||||| 
CTCGCCCGCC CGCCATTCTT GCCGATTCGA GTCGACGTCA CGCCTCCGGC GCCCCCTTCG      136


GTTCTCACCT CGGGAGTCGC GGATTGGTGG AGGGGAGGAT TTGAGCGGCG CGGCCATGGA     7998
||| |||||| |||| ||||| |||||||||| || ||||||| |||||||||| |||||||||| 
GTTGTCACCT CGGGGGTCGC GGATTGGTGG AGTGGAGGAT TTGAGCGGCG CGGCCATGGA      196


TACAACCTCT AGGGCCGCCA AGATCCCGTC GCTCCACCAG ACGGAGATCA ACTGGGACAA     8058
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| ||||||| || 
TACAACCTCT AGGGCCGCCA AGATCCCGTC GCTCCACCAG ACGGAGATCA ACTGGGATAA      256


GTAAGCAACC CACCGGTCTT GTAATCCTTA GGTTCCCATT TCGTGCCGAT TTCCGCCTTT     8118
                                                                  
.......... .......... .......... .......... .......... ..........      256


CTCGCGGTCC TAGTCTTCTA GAAATTTAGC TCCGATCGTT GAACTGTGTC CCCCGCCCTA     8178
                                                                  
.......... .......... .......... .......... .......... ..........      256


TTCCGGATTG GCTTTACCGC CTTAGGATTA GGAACTGTTG TTTGAGGATT TGACATGGCT     8238
                                                                  
.......... .......... .......... .......... .......... ..........      256


GTTCATGCTC CTGGACGAAG CGCAATTTGG GGATTCGTAG CTTATTCCGT TGTTTCCGAT     8298
                                                                  
.......... .......... .......... .......... .......... ..........      256


TCTTTTACTG TTCTCAAATC GTGGCGCTGA AATGTTGCAG CCTCGACAAG ACCAAGCTCT     8358
                                            |||||||||| |||||||||| 
.......... .......... .......... .......... CCTCGACAAG ACCAAGCTCT      276


ACGTGGTGGG CGCAGGCATG TTCAGCGGCG TCACCGTGGC GCTGTATCCT GTCTCGGTGG     8418
|||||||||| |||||||||| |||||||| | |||||||||| |||||| ||| || ||||||| 
ACGTGGTGGG CGCAGGCATG TTCAGCGGGG TCACCGTGGC GCTGTACCCT GTATCGGTGG      336


TCAAGACCCG GATGCAGGTT GCCTCTGGGG ACGCCATGAG GAGGAACGCG CTGGCTACCT     8478
|||||||||| |||||||||| |||||||||| | |||||| | |||||||||| |||||||||| 
TCAAGACCCG GATGCAGGTT GCCTCTGGGG ATGCCATGGG GAGGAACGCG CTGGCTACCT      396


TCAAGAACAT CCTCAAGATG GACGGCGTGC CAGGGCTGTA CCGGGGGTTT GCTACCGTTA     8538
|||||||||| ||| ||| || |||||||||| |||||||||| ||||||||||  |||| |||| 
TCAAGAACAT CCTTAAGGTG GACGGCGTGC CAGGGCTGTA CCGGGGGTTT CCTACTGTTA      456


TCATTGGGGC TGTACCAACT AGGATCATCT TCCTCACAGC GCTTGAGACA ACCAAAGCAG     8598
| |||||||| |||||||||| ||||| |||| ||||||| |  |||||||||| |||||||||| 
TAATTGGGGC TGTACCAACT AGGATTATCT TCCTCACGGN GCTTGAGACA ACCAAAGCAG      516


CCTCGCTTAA GCTT     8612
|||| || || ||||
CCTCTCTCAA GCTT      530





********************************************************************************
EST sequence   64 +strand (File: 14528354+)

     1  ATTCGGCACG AGGGCCAGAG GAGGCGAGGA ACACATGGTC TCTTTCCTCC CCGCTGAAGA
    61  GTAGCTGCCA AGACCACCAC GGAAGCGGAG GCGCACCACC CAGGCGGGCC ATTCTCGCCG
   121  AGCCCCTCCC CCTCCCCCGG CCGCCGCGCC CTCGCCTCCG GGGATCGCGG GATTGGGCGG
   181  CCATGGACAC CTCTACTAGG GCGGCCAAGA TCCCCTCCCT CCCCCAACAG ACGGAGATCA
   241  ACTGGGACAA CCTCGACATG ACCAAGCTCT ATGTGGTTGG GGCCGGCATG TTCAGCTGCG
   301  TGACCGTGGC GCTCTACCCG GTCTCTGTGA TCAAGACCCG GATGCAGGTT GCCTCCGGGG
   361  AGGCCATGAG GAGGAACGCC CTGGCCACCT TTAAGAACAT CCTCAAGGTG GATGGGGTGC
   421  CTGGGCTCTA CCGAGGGTTT GGGACCGTCA TCACTGGGGC TATCCCGGCT AGGATTATCT
   481  TCCTCACGGC GCTCGAGAAG ACAAAGGCGA CTTCGCTCAA GCTTGTCGAG CCTCTTCAGC
   541  TGTCAGAGTC GATGGAGGCT GCCCTTGCTA ATGGCCTTGG TGGTTTGACG GCGTCTCTGT
   601  GTTCGCAGGC CGTGTTTGTG CCCATTGATG TGGTTAGTCA GAAATTGATG GTTCAAGGAT
   661  ATTCTGGTCA TGTTAGATAT AAGGGTGGAA TCGATGT

Predicted gene structure (within gDNA segment 7500 to 9334):

 Exon  1   7984   8058 (  75 n);  cDNA    173    250 (  78 n); score: 0.760
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.79), Pa: 0.581 (s: 0.88)
 Exon  2   8339   8720 ( 382 n);  cDNA    251    632 ( 382 n); score: 0.832
  Intron  2   8721   8848 ( 128 n); Pd: 0.857 (s: 0.78), Pa: 0.962 (s: 0.88)
 Exon  3   8849   8913 (  65 n);  cDNA    633    697 (  65 n); score: 0.862

MATCH	21326110+	14528354+	0.826	522	0.749	C
PGS_21326110+_14528354+	(7984  8058,8339  8720,8849  8913)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGTCGCT-- -CCACCAGAC     8040
  | |||||| ||||| ||   |  |||||||  ||||||||| || || ||    ||| ||||| 
TTGGGCGGCC ATGGACACCT CTACTAGGGC GGCCAAGATC CCCTCCCTCC CCCAACAGAC      232


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
|||||||||| ||||||||                                               
GGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      250


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      250


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      250


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      250


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      252


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|||||| ||| |||||||||  ||||| || | | |||||||| |||| ||||  |||||||||| 
TCGACATGAC CAAGCTCTAT GTGGTTGGGG CCGGCATGTT CAGCTGCGTG ACCGTGGCGC      312


TGTATCCTGT CTCGGTGGTC AAGACCCGGA TGCAGGTTGC CTCTGGGGAC GCCATGAGGA     8460
| || || || ||| ||| || |||||||||| |||||||||| ||| |||||  |||||||||| 
TCTACCCGGT CTCTGTGATC AAGACCCGGA TGCAGGTTGC CTCCGGGGAG GCCATGAGGA      372


GGAACGCGCT GGCTACCTTC AAGAACATCC TCAAGATGGA CGGCGTGCCA GGGCTGTACC     8520
||||||| || ||| |||||  |||||||||| ||||| ||||  || |||||  ||||| |||| 
GGAACGCCCT GGCCACCTTT AAGAACATCC TCAAGGTGGA TGGGGTGCCT GGGCTCTACC      432


GGGGGTTTGC TACCGTTATC ATTGGGGCTG TACCAACTAG GATCATCTTC CTCACAGCGC     8580
| |||||||   ||||| ||| | |||||||  | ||  |||| ||| |||||| ||||| |||| 
GAGGGTTTGG GACCGTCATC ACTGGGGCTA TCCCGGCTAG GATTATCTTC CTCACGGCGC      492


TTGAGACAAC CAAAGCAGCC TCGCTTAAGC TTGTTGAGCC -CTTCAAGCT GTCAGAGCCG     8639
| ||||  ||  || ||  |  ||||| |||| |||| |||||  |||| |||| ||||||| || 
TCGAGAAGAC AAAGGCGACT TCGCTCAAGC TTGTCGAGCC TCTTC-AGCT GTCAGAGTCG      551


GTGCGGGCTG CCTTTGCCAA TGGCCTTGCT GGTCTGTCAG CGTCTACATG TTCGCAGGCT     8699
 ||  ||||| || |||| || |||||||| | ||| || | | |||||   || |||||||||  
ATGGAGGCTG CCCTTGCTAA TGGCCTTGGT GGTTTGACGG CGTCTCTGTG TTCGCAGGCC      611


ATTTTTGTTC CAATTGATGT GGTATGCCTC TCATGTGCCT TCTATGTGAT GTTGTATAGA     8759
 | ||||| | | |||||||| |                                           
GTGTTTGTGC CCATTGATGT G......... .......... .......... ..........      632


GAAAAAATAT CTTACAATAT GTTGATGTTA AATGCTAATT ACAATACTAG ACTACTGTTT     8819
                                                                  
.......... .......... .......... .......... .......... ..........      632


TCATTCTGTT GTGCATTGGA ATGTTTCAGA TTAGCCAGAA ATTGATGGTT CAAGGATATT     8879
                                 |||| ||||| |||||||||| |||||||||| 
.......... .......... .........G TTAGTCAGAA ATTGATGGTT CAAGGATATT      663


CTGGTAATGC CAGATACAAA GGTGGATTAG ATGT     8913
||||| |||   ||||| ||  |||||| | | ||||
CTGGTCATGT TAGATATAAG GGTGGAATCG ATGT      697





********************************************************************************
EST sequence   18 +strand (File: 25548034+)

     1  GCACGAGGCA GCCGGACCAT TCTCGCCGAG CCCTCGCCCT CCCCCGGCCG CGGCGGCGGC
    61  GCCCCTCCTC CGCGCCCTCG CCTCCGGGGA TCGCGGGATT GGGCGGCGAT GGACACCTCT
   121  ACTAGGGCGG CCAAGATCCC CTCCCTCCCC CAACAGACGG AGATCAACTG GGACAACCTC
   181  GACATGACCA AGCTCTATGT GGTGGGGGCC GGCATGTTCA GCTGCGTGAC CGTGGCGCTC
   241  TACCCGGTGT CCGTGATCAA GACCCGGATG CAGGTTGCCT CCGGGGAGGC CTTGAGGAGG
   301  AACGCCCTGG CCACCTTCAA GAACATCCTC AAGGTGGATG GGGTGCCTGG GCTCTACCGA
   361  GGGTTTGGGA CCGTCATCAC CGGGGCTATC CCGGCTAGGA TTATCTTCCT CACGGCGCTC
   421  GAGAAGACAA AGGCGACTTC GCTCAAGCTT GTTGAGCCAC TTCAGCTGTC AGAGTCGATG
   481  GAGGCTGCCC TTGCTAATGG CCTCGGTGGT TTGACGGCGT CTCTGTGCTC GCAGGCTGTC
   541  TTTGTGCCCA TTGATGTGGT TAGCCAGNNN TTGATGGTTC AAGGATATTC TGGTCATGTC
   601  AGATA

Predicted gene structure (within gDNA segment 7500 to 9244):

 Exon  1   7984   8058 (  75 n);  cDNA    100    176 (  77 n); score: 0.760
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.79), Pa: 0.581 (s: 0.90)
 Exon  2   8339   8720 ( 382 n);  cDNA    177    558 ( 382 n); score: 0.830
  Intron  2   8721   8848 ( 128 n); Pd: 0.857 (s: 0.78), Pa: 0.962 (s: 0.87)
 Exon  3   8849   8895 (  47 n);  cDNA    559    605 (  47 n); score: 0.872

MATCH	21326110+	25548034+	0.818	504	0.833	C
PGS_21326110+_25548034+	(7984  8058,8339  8720,8849  8895)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGTCGCT-- -CCACCAGAC     8040
 || |||||  ||||| ||   |  |||||||  ||||||||| || || ||    ||| ||||| 
TGG-GCGGCG ATGGACACCT CTACTAGGGC GGCCAAGATC CCCTCCCTCC CCCAACAGAC      158


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
|||||||||| ||||||||                                               
GGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      176


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      176


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      176


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      176


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      178


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|||||| ||| |||||||||  |||||||| | | |||||||| |||| ||||  |||||||||| 
TCGACATGAC CAAGCTCTAT GTGGTGGGGG CCGGCATGTT CAGCTGCGTG ACCGTGGCGC      238


TGTATCCTGT CTCGGTGGTC AAGACCCGGA TGCAGGTTGC CTCTGGGGAC GCCATGAGGA     8460
| || || ||  || ||| || |||||||||| |||||||||| ||| |||||  ||| |||||| 
TCTACCCGGT GTCCGTGATC AAGACCCGGA TGCAGGTTGC CTCCGGGGAG GCCTTGAGGA      298


GGAACGCGCT GGCTACCTTC AAGAACATCC TCAAGATGGA CGGCGTGCCA GGGCTGTACC     8520
||||||| || ||| |||||| |||||||||| ||||| ||||  || |||||  ||||| |||| 
GGAACGCCCT GGCCACCTTC AAGAACATCC TCAAGGTGGA TGGGGTGCCT GGGCTCTACC      358


GGGGGTTTGC TACCGTTATC ATTGGGGCTG TACCAACTAG GATCATCTTC CTCACAGCGC     8580
| |||||||   ||||| ||| |  ||||||  | ||  |||| ||| |||||| ||||| |||| 
GAGGGTTTGG GACCGTCATC ACCGGGGCTA TCCCGGCTAG GATTATCTTC CTCACGGCGC      418


TTGAGACAAC CAAAGCAGCC TCGCTTAAGC TTGTTGAGCC -CTTCAAGCT GTCAGAGCCG     8639
| ||||  ||  || ||  |  ||||| |||| ||||||||||  |||| |||| ||||||| || 
TCGAGAAGAC AAAGGCGACT TCGCTCAAGC TTGTTGAGCC ACTTC-AGCT GTCAGAGTCG      477


GTGCGGGCTG CCTTTGCCAA TGGCCTTGCT GGTCTGTCAG CGTCTACATG TTCGCAGGCT     8699
 ||  ||||| || |||| || |||||| | | ||| || | | |||||   ||  ||||||||| 
ATGGAGGCTG CCCTTGCTAA TGGCCTCGGT GGTTTGACGG CGTCTCTGTG CTCGCAGGCT      537


ATTTTTGTTC CAATTGATGT GGTATGCCTC TCATGTGCCT TCTATGTGAT GTTGTATAGA     8759
 | ||||| | | |||||||| |                                           
GTCTTTGTGC CCATTGATGT G......... .......... .......... ..........      558


GAAAAAATAT CTTACAATAT GTTGATGTTA AATGCTAATT ACAATACTAG ACTACTGTTT     8819
                                                                  
.......... .......... .......... .......... .......... ..........      558


TCATTCTGTT GTGCATTGGA ATGTTTCAGA TTAGCCAGAA ATTGATGGTT CAAGGATATT     8879
                                 ||||||||    ||||||||| |||||||||| 
.......... .......... .........G TTAGCCAGNN NTTGATGGTT CAAGGATATT      589


CTGGTAATGC CAGATA     8895
||||| |||  ||||||
CTGGTCATGT CAGATA      605





********************************************************************************
EST sequence    9 +strand (File: 11549557+)

     1  CATTCTCGCC GTACCCTCGC CCTCCCCCGG CCGCGGCGGC GGCGCCCCTC CTCCGCGCCC
    61  TCGCCTCCGG GGATCGCGGG ATTGGGCGGC GATGGACACC TCTACTAGGG CGGCCAAGAT
   121  CCCCTCCCTC CCCCAACAGA CGGAGATCAA CTGGGACAAC CTCTACATGA CCAAGCTCTA
   181  TGTGGTGGGG GCCGGCATGT TCAGCTGCGT GACCGTGGCG CTCTACCCGG TGTCCGTGAT
   241  CAAGACCCGG ATGCAGGTTG CCTCCGGGGA GGCCTTGAGG AGGAACGCCC TGGCCACCTT
   301  CAAGAACATC CTCAAGGTGG ATGGGGTGCC TGGGCTCTAC CGAGGGTTTG GGACCGTCAT
   361  CACCGGGGCT ATGCCGGCTA GGATTATCTT CCTCACGGCG CTCGAGAAGA CAAAGGCGAC
   421  TTCGCTCAAG CTTGTTGAGC CACTTCAGCT GTCA

Predicted gene structure (within gDNA segment 7500 to 8990):

 Exon  1   7984   8058 (  75 n);  cDNA     83    159 (  77 n); score: 0.760
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.79), Pa: 0.581 (s: 0.88)
 Exon  2   8339   8633 ( 295 n);  cDNA    160    454 ( 295 n); score: 0.837

MATCH	21326110+	11549557+	0.822	370	0.815	C
PGS_21326110+_11549557+	(7984  8058,8339  8633)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGTCGCT-- -CCACCAGAC     8040
 || |||||  ||||| ||   |  |||||||  ||||||||| || || ||    ||| ||||| 
TGG-GCGGCG ATGGACACCT CTACTAGGGC GGCCAAGATC CCCTCCCTCC CCCAACAGAC      141


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
|||||||||| ||||||||                                               
GGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      159


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      159


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      159


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      159


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      161


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|| ||| ||| |||||||||  |||||||| | | |||||||| |||| ||||  |||||||||| 
TCTACATGAC CAAGCTCTAT GTGGTGGGGG CCGGCATGTT CAGCTGCGTG ACCGTGGCGC      221


TGTATCCTGT CTCGGTGGTC AAGACCCGGA TGCAGGTTGC CTCTGGGGAC GCCATGAGGA     8460
| || || ||  || ||| || |||||||||| |||||||||| ||| |||||  ||| |||||| 
TCTACCCGGT GTCCGTGATC AAGACCCGGA TGCAGGTTGC CTCCGGGGAG GCCTTGAGGA      281


GGAACGCGCT GGCTACCTTC AAGAACATCC TCAAGATGGA CGGCGTGCCA GGGCTGTACC     8520
||||||| || ||| |||||| |||||||||| ||||| ||||  || |||||  ||||| |||| 
GGAACGCCCT GGCCACCTTC AAGAACATCC TCAAGGTGGA TGGGGTGCCT GGGCTCTACC      341


GGGGGTTTGC TACCGTTATC ATTGGGGCTG TACCAACTAG GATCATCTTC CTCACAGCGC     8580
| |||||||   ||||| ||| |  ||||||  | ||  |||| ||| |||||| ||||| |||| 
GAGGGTTTGG GACCGTCATC ACCGGGGCTA TGCCGGCTAG GATTATCTTC CTCACGGCGC      401


TTGAGACAAC CAAAGCAGCC TCGCTTAAGC TTGTTGAGCC CTTCAAGCTG TCA     8633
| ||||  ||  || ||  |  ||||| |||| ||||||||||   |  ||||| |||
TCGAGAAGAC AAAGGCGACT TCGCTCAAGC TTGTTGAGCC ACTTCAGCTG TCA      454





********************************************************************************
EST sequence   11 +strand (File: 11116044+)

     1  GGCCACGGAA GCGGAAGCGC AGGCCAGCGC ACCCCCAGCC GGACCATTCT CGCCGAGCCC
    61  TCGCCCTCCC CCGGCCGCGG CGGCGGCGCC CCTCCTCCGC GCCCTCGCCT CCGGGGATCG
   121  CGGGATTGGG CGGCGATGGA CACCTCTACT AGGGCGGCCA AGATCCCCTC CCTCCCCCAA
   181  CAGACGGAGA TCAACTGGGA CAACCTCGAC ATGACCAAGC TCTATGTGGT GGGGGCCGGC
   241  ATGTTCAGCT GCGTGACCGT GGCGCTCTAC CCGGTGTCCG TGATCAAGAC CCGGATGCAG
   301  GTTGCCTCCG GGGAGGCCTT GAGGAGGAAC GCCCTGGCCA CCTTCAAGAA CATCCTCAAG
   361  GTGGATGGGG TGCCTGGGCT CTACCGAGGG TTTGGGACCG TCATCACCGG GGCTATCCCG
   421  GCTAGGATTA TCTTCCTCAC GGCGCTCGAG AAGACAAAGG CGACTTCGCT CAAGC

Predicted gene structure (within gDNA segment 7500 to 9375):

 Exon  1   7984   8058 (  75 n);  cDNA    127    203 (  77 n); score: 0.760
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.79), Pa: 0.581 (s: 0.90)
 Exon  2   8339   8610 ( 272 n);  cDNA    204    475 ( 272 n); score: 0.842

MATCH	21326110+	11116044+	0.824	347	0.731	C
PGS_21326110+_11116044+	(7984  8058,8339  8610)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGTCGCT-- -CCACCAGAC     8040
 || |||||  ||||| ||   |  |||||||  ||||||||| || || ||    ||| ||||| 
TGG-GCGGCG ATGGACACCT CTACTAGGGC GGCCAAGATC CCCTCCCTCC CCCAACAGAC      185


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
|||||||||| ||||||||                                               
GGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      203


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      203


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      203


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      203


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      205


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|||||| ||| |||||||||  |||||||| | | |||||||| |||| ||||  |||||||||| 
TCGACATGAC CAAGCTCTAT GTGGTGGGGG CCGGCATGTT CAGCTGCGTG ACCGTGGCGC      265


TGTATCCTGT CTCGGTGGTC AAGACCCGGA TGCAGGTTGC CTCTGGGGAC GCCATGAGGA     8460
| || || ||  || ||| || |||||||||| |||||||||| ||| |||||  ||| |||||| 
TCTACCCGGT GTCCGTGATC AAGACCCGGA TGCAGGTTGC CTCCGGGGAG GCCTTGAGGA      325


GGAACGCGCT GGCTACCTTC AAGAACATCC TCAAGATGGA CGGCGTGCCA GGGCTGTACC     8520
||||||| || ||| |||||| |||||||||| ||||| ||||  || |||||  ||||| |||| 
GGAACGCCCT GGCCACCTTC AAGAACATCC TCAAGGTGGA TGGGGTGCCT GGGCTCTACC      385


GGGGGTTTGC TACCGTTATC ATTGGGGCTG TACCAACTAG GATCATCTTC CTCACAGCGC     8580
| |||||||   ||||| ||| |  ||||||  | ||  |||| ||| |||||| ||||| |||| 
GAGGGTTTGG GACCGTCATC ACCGGGGCTA TCCCGGCTAG GATTATCTTC CTCACGGCGC      445


TTGAGACAAC CAAAGCAGCC TCGCTTAAGC     8610
| ||||  ||  || ||  |  ||||| |||| 
TCGAGAAGAC AAAGGCGACT TCGCTCAAGC      475





********************************************************************************
EST sequence   75 +strand (File: 21975880+)

     1  CACATGCTCT CTTTCCTCCC CGCTGGAGAG TAGCTGCCAA GACCACCACG GAAGCGGAGG
    61  CGCACCACCC AGGCGGGCCA TTCTCGCCGA GCCCCTCCCC CTCCCCCGGG CCGNCGCGCC
   121  CTCGCCTCCG GGGATCGCGG GATTGGGCGG CCATGGACAC CTCTACTAGG GCGGCCAAGA
   181  TCCCCTCCCT CCCCCAACAG ACGGAGATCA ACTGGGACAA CCTCGACATG ACCAAGCTCT
   241  ATGTGGTTGG GGCCGGCATG TTCAGCTGCG TGACCGTGGC GCTCTACCCG GTCTCTGTGA
   301  TCAAGACCCG GATGCAGGTT GCCTCCGGGG AGGCCATGAG GAGGAACGCC CTGGCCACCT
   361  TTAAAAACAT CCTCAAAGTG GATGGGGTGC CTGGGCTCTA CCGAGGGTTT GGGACCGTTA
   421  TCACTGGGGC TATCCCGGCT AGGATTA

Predicted gene structure (within gDNA segment 7500 to 9262):

 Exon  1   7984   8058 (  75 n);  cDNA    144    220 (  77 n); score: 0.773
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.79), Pa: 0.581 (s: 0.88)
 Exon  2   8339   8565 ( 227 n);  cDNA    221    447 ( 227 n); score: 0.855

MATCH	21326110+	21975880+	0.834	302	0.676	C
PGS_21326110+_21975880+	(7984  8058,8339  8565)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGTCGCT-- -CCACCAGAC     8040
 || |||||| ||||| ||   |  |||||||  ||||||||| || || ||    ||| ||||| 
TGG-GCGGCC ATGGACACCT CTACTAGGGC GGCCAAGATC CCCTCCCTCC CCCAACAGAC      202


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
|||||||||| ||||||||                                               
GGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      220


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      220


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      220


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      220


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      222


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|||||| ||| |||||||||  ||||| || | | |||||||| |||| ||||  |||||||||| 
TCGACATGAC CAAGCTCTAT GTGGTTGGGG CCGGCATGTT CAGCTGCGTG ACCGTGGCGC      282


TGTATCCTGT CTCGGTGGTC AAGACCCGGA TGCAGGTTGC CTCTGGGGAC GCCATGAGGA     8460
| || || || ||| ||| || |||||||||| |||||||||| ||| |||||  |||||||||| 
TCTACCCGGT CTCTGTGATC AAGACCCGGA TGCAGGTTGC CTCCGGGGAG GCCATGAGGA      342


GGAACGCGCT GGCTACCTTC AAGAACATCC TCAAGATGGA CGGCGTGCCA GGGCTGTACC     8520
||||||| || ||| |||||  || ||||||| ||||  ||||  || |||||  ||||| |||| 
GGAACGCCCT GGCCACCTTT AAAAACATCC TCAAAGTGGA TGGGGTGCCT GGGCTCTACC      402


GGGGGTTTGC TACCGTTATC ATTGGGGCTG TACCAACTAG GATCA     8565
| |||||||   ||||||||| | |||||||  | ||  |||| ||| |
GAGGGTTTGG GACCGTTATC ACTGGGGCTA TCCCGGCTAG GATTA      447





********************************************************************************
EST sequence   77 +strand (File: 21973454+)

     1  GGAACACATG CTCTCTTTCC TCCCCGCTGG AGAGTAGCTG CCAAGACCAC CACGGAAGCG
    61  GAGGCGCACC ACCCAGGCGG GCCATTCTCG CCGAGCCCCT CCCCCTCCCC CGGCCGCCGC
   121  GCCCTCGCCT CCGGGGATCG CGGGATTGGG CGGCCATGGA CACCTCTACT AGGGCGGCCA
   181  AGATCCCCTC CCTCCCCCAA CAGACGGAGA TCAACTGGGA CAACCTCGAC ATGACCAAGC
   241  TCTATGTGGT TGGGGCCGGC ATGTTCAGCT GCGTGACCGT GGCGCTCTAC CCGGTCTCTG
   301  TGATCAAGAC CCGGATGCAG GTTGCCTCCG GGGAGGCCAT GAGGAGGAAC GCCCTGGCCA
   361  CCTTTAAGAA CATCCTCAAA GTGGATGGGG TGCCTGGGCT CTACCGAGGG TTTGGGACCG
   421  TCATCACTGG GGCTATCCC

Predicted gene structure (within gDNA segment 7500 to 9099):

 Exon  1   7984   8058 (  75 n);  cDNA    147    223 (  77 n); score: 0.773
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.79), Pa: 0.581 (s: 0.88)
 Exon  2   8339   8554 ( 216 n);  cDNA    224    439 ( 216 n); score: 0.861

MATCH	21326110+	21973454+	0.838	291	0.663	C
PGS_21326110+_21973454+	(7984  8058,8339  8554)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGTCGCT-- -CCACCAGAC     8040
 || |||||| ||||| ||   |  |||||||  ||||||||| || || ||    ||| ||||| 
TGG-GCGGCC ATGGACACCT CTACTAGGGC GGCCAAGATC CCCTCCCTCC CCCAACAGAC      205


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
|||||||||| ||||||||                                               
GGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      223


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      223


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      223


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      223


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      225


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|||||| ||| |||||||||  ||||| || | | |||||||| |||| ||||  |||||||||| 
TCGACATGAC CAAGCTCTAT GTGGTTGGGG CCGGCATGTT CAGCTGCGTG ACCGTGGCGC      285


TGTATCCTGT CTCGGTGGTC AAGACCCGGA TGCAGGTTGC CTCTGGGGAC GCCATGAGGA     8460
| || || || ||| ||| || |||||||||| |||||||||| ||| |||||  |||||||||| 
TCTACCCGGT CTCTGTGATC AAGACCCGGA TGCAGGTTGC CTCCGGGGAG GCCATGAGGA      345


GGAACGCGCT GGCTACCTTC AAGAACATCC TCAAGATGGA CGGCGTGCCA GGGCTGTACC     8520
||||||| || ||| |||||  |||||||||| ||||  ||||  || |||||  ||||| |||| 
GGAACGCCCT GGCCACCTTT AAGAACATCC TCAAAGTGGA TGGGGTGCCT GGGCTCTACC      405


GGGGGTTTGC TACCGTTATC ATTGGGGCTG TACC     8554
| |||||||   ||||| ||| | |||||||  | ||
GAGGGTTTGG GACCGTCATC ACTGGGGCTA TCCC      439





********************************************************************************
EST sequence   63 +strand (File: 16314143+)

     1  CAAGACCACC ACGGAAGCGG AGGCGCACCA CCCAGGCGGG CCATTCTCGC CGAGGGCCTC
    61  CCCCTCCCCC TCCCCCGGCC GCCGCGCCCT CGCCTCCGGG GATCGCGGGA TTGGGCGGCC
   121  ATGGACACCT CTACTAGGGC GGCCAACATC CCCTCCCTGC CCCAACAGAC CGAGATCAAC
   181  TGGGACAACC TCGACATGAC CAAGCTCTAT GTGGTTGGGG CCGGCATGTT CAGCTGCGTG
   241  ACCGAGGCGC TCTACCCGGG CTCTTGGAAC AAAGACCCGG GTGCAGGTTG CCTCGGGGGA
   301  GGCCCTAAGA AGGAACCCCA TGGCCACGAT TTAGAACAAT CCCAAACGTG CATGGGGGCC
   361  GAGAGATTTA ACACGGGGTT GGGAGCCCGG CTTGACTGGG GCATTCCCGG CCGGGAAGAT
   421  ATTGGGGGAA GAGGGCTTTT GAGACTGGGG CGAATTTGGT GGATCCTGTT CAACCCTTTT
   481  AAAAAATAGT GGGGCGTAGG AGGGCGGCAC TTGAGAAAAA ACCCTTGGGA GTTTGCCGGG
   541  CGTCGTCGAT TTCGAAAGAG AGGCATCGGG CACCGGGCAC CG

Predicted gene structure (within gDNA segment 7500 to 10188):

 Exon  1   7984   8058 (  75 n);  cDNA    112    188 (  77 n); score: 0.747
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.74), Pa: 0.581 (s: 0.88)
 Exon  2   8339   8534 ( 196 n);  cDNA    189    386 ( 198 n); score: 0.719

MATCH	21326110+	16314143+	0.727	271	0.466	C
PGS_21326110+_16314143+	(7984  8058,8339  8534)

Alignment (genomic DNA sequence = upper lines):

CGGCGCGGCC ATGGATACAA CCTCTAGGGC CGCCAAGATC CCGT--C-GC TCCACCAGAC     8040
 || |||||| ||||| ||   |  |||||||  ||||| ||| || |  | ||  ||| ||||| 
TGG-GCGGCC ATGGACACCT CTACTAGGGC GGCCAACATC CCCTCCCTGC CCCAACAGAC      170


GGAGATCAAC TGGGACAAGT AAGCAACCCA CCGGTCTTGT AATCCTTAGG TTCCCATTTC     8100
 ||||||||| ||||||||                                               
CGAGATCAAC TGGGACAA.. .......... .......... .......... ..........      188


GTGCCGATTT CCGCCTTTCT CGCGGTCCTA GTCTTCTAGA AATTTAGCTC CGATCGTTGA     8160
                                                                  
.......... .......... .......... .......... .......... ..........      188


ACTGTGTCCC CCGCCCTATT CCGGATTGGC TTTACCGCCT TAGGATTAGG AACTGTTGTT     8220
                                                                  
.......... .......... .......... .......... .......... ..........      188


TGAGGATTTG ACATGGCTGT TCATGCTCCT GGACGAAGCG CAATTTGGGG ATTCGTAGCT     8280
                                                                  
.......... .......... .......... .......... .......... ..........      188


TATTCCGTTG TTTCCGATTC TTTTACTGTT CTCAAATCGT GGCGCTGAAA TGTTGCAGCC     8340
                                                               || 
.......... .......... .......... .......... .......... ........CC      190


TCGACAAGAC CAAGCTCTAC GTGGTGGGCG CAGGCATGTT CAGCGGCGTC ACCGTGGCGC     8400
|||||| ||| |||||||||  ||||| || | | |||||||| |||| ||||  |||| ||||| 
TCGACATGAC CAAGCTCTAT GTGGTTGGGG CCGGCATGTT CAGCTGCGTG ACCGAGGCGC      250


TGTATCCTGT CTCGGTGGTC -AAGACCCGG ATGCAGGTTG CCTCTGGGGA CGCCATGAGG     8459
| || || |  |||   |  |  |||||||||  ||||||||| |||| |||||  ||| | ||  
TCTACCCGGG CTCTTGGAAC AAAGACCCGG GTGCAGGTTG CCTCGGGGGA GGCCCTAAGA      310


AGGAACGCGC TGGCTACCTT CAAGAAC-AT CCTCAAGATG GACGGCGTGC CAGGGCTGTA     8518
|||||| |   |||| ||  |   ||||| || ||  ||  ||  | || |  |  || | | || 
AGGAACCCCA TGGCCACGAT TTAGAACAAT CCCAAACGTG CATGGGGGCC GAGAGATTTA      370


CCGGGGGTTT GCTACC     8534
 |  ||| || |  | |
ACACGGGGTT GGGAGC      386





********************************************************************************
EST sequence   66 +strand (File: 13082841+)

     1  CGGAAGCGGA GGCACACCAC CCATGCGGGC CATTCTCGTC GAGCCCATAC CCCTCCTCCT
    61  CCCCCGGACG CCGCGCCCTC ACCTCCGGGG ATCTCGGGAT TGAGCGGCCA TGGACACCTC
   121  TACTAGGGCG GCCAAGATCC TCTCCCTTCC CCAACAGACG GAGATCAACT GGGACAACCT
   181  CGACATGACC AAGCTCTATG TGGTTGGGGC CGGCATGTTC AGCTGCATGA CCGTGGCACT
   241  CTACCCGGTC TCTGTGATCA ACACCCGGAT GCATGTTGTC TCGGGGGAGG CCATGAGGAG
   301  GAACGCCCTC GCCACCTGTT AAGAACATCC TCAAAGTGGA TGGTGTGCCT GTGCTCTACC
   361  GAAGGTTTGG GACCGTCATA ACTGAGGCTA TCCCGGCTAG GATTAATATT CCTTACGGAG
   421  CTCGATAAGA CAAAGGCGAC TTCCGTTCAA ACTTTGTCGA GCCTTTTCAC CTGTCAAAAT
   481  CATTGGAGGC TGCCCTTGCT AATGGCG

Predicted gene structure (within gDNA segment 7500 to 9664):

 Exon  1   7988   8058 (  71 n);  cDNA    104    177 (  74 n); score: 0.775
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s: 0.77), Pa: 0.581 (s: 0.86)
 Exon  2   8339   8664 ( 326 n);  cDNA    178    507 ( 330 n); score: 0.748

MATCH	21326110+	13082841+	0.753	397	0.783	C
PGS_21326110+_13082841+	(7988  8058,8339  8664)

Alignment (genomic DNA sequence = upper lines):

GCGGCCATGG ATACAACCTC TAGGGCCGCC AAGATCCCGT CGC-T--CCA CCAGACGGAG     8044
|||||||||| | ||  |  | |||||| ||| |||||||  | | | |  |||  ||||||||| 
GCGGCCATGG ACACCTCTAC TAGGGCGGCC AAGATCCTCT CCCTTCCCCA ACAGACGGAG      163


ATCAACTGGG ACAAGTAAGC AACCCACCGG TCTTGTAATC CTTAGGTTCC CATTTCGTGC     8104
|||||||||| ||||                                                   
ATCAACTGGG ACAA...... .......... .......... .......... ..........      177


CGATTTCCGC CTTTCTCGCG GTCCTAGTCT TCTAGAAATT TAGCTCCGAT CGTTGAACTG     8164
                                                                  
.......... .......... .......... .......... .......... ..........      177


TGTCCCCCGC CCTATTCCGG ATTGGCTTTA CCGCCTTAGG ATTAGGAACT GTTGTTTGAG     8224
                                                                  
.......... .......... .......... .......... .......... ..........      177


GATTTGACAT GGCTGTTCAT GCTCCTGGAC GAAGCGCAAT TTGGGGATTC GTAGCTTATT     8284
                                                                  
.......... .......... .......... .......... .......... ..........      177


CCGTTGTTTC CGATTCTTTT ACTGTTCTCA AATCGTGGCG CTGAAATGTT GCAGCCTCGA     8344
                                                           |||||| 
.......... .......... .......... .......... .......... ....CCTCGA      183


CAAGACCAAG CTCTACGTGG TGGGCGCAGG CATGTTCAGC GGCGTCACCG TGGCGCTGTA     8404
|| ||||||| ||||| |||| | || || || ||||||||||  || | |||| |||| || || 
CATGACCAAG CTCTATGTGG TTGGGGCCGG CATGTTCAGC TGCATGACCG TGGCACTCTA      243


TCCTGTCTCG GTGGTCAAGA CCCGGATGCA GGTTGCCTCT GGGGACGCCA TGAGGAGGAA     8464
 || |||||  ||| |||| | ||||||||||  |||| |||  ||||| |||| |||||||||| 
CCCGGTCTCT GTGATCAACA CCCGGATGCA TGTTGTCTCG GGGGAGGCCA TGAGGAGGAA      303


CGCGCTGGCT ACCT-TCAAG AACATCCTCA AGATGGACGG CGTGCCAGGG CTGTACCGGG     8523
||| || ||  |||| | ||| |||||||||| |  |||| ||  ||||| | | || |||||   
CGCCCTCGCC ACCTGTTAAG AACATCCTCA AAGTGGATGG TGTGCCTGTG CTCTACCGAA      363


GGTTTGCTAC CGTTATCATT GGGGCTGTAC CAACTAGGA- TCATCTTCCT CACAGCGCTT     8582
||||||  || ||| || | | | |||| | | |  ||||||  | || |||||  || | |||  
GGTTTGGGAC CGTCATAACT GAGGCTATCC CGGCTAGGAT TAATATTCCT TACGGAGCTC      423


GAGACAACCA AAGCAGCCT- CGCTTAAGC- TTGTTGAGCC CTTCAAGCTG TCAGAGCCGG     8640
|| |  || | | ||  | |  || | || |  |||| |||||  ||  | ||| ||| |  |   
GATAAGACAA AGGCGACTTC CGTTCAAACT TTGTCGAGCC TTTTCACCTG TCAAAATCAT      483


TGCGGGCTGC CTTTGCCAAT GGCC     8664
||  |||||| | |||| ||| ||| 
TGGAGGCTGC CCTTGCTAAT GGCG      507





********************************************************************************
EST sequence   29 +strand (File: 13778583+)

     1  GATTATATTG ACCATTTGGT CGGTGCTTTT CCTCCAGAAA CTTCTCCGAT TACTCTCCAT
    61  TTGCAAAATT TAACGACTTG CTTATAAGCC GAGTTAGGGT TTTGAACAGT TGTAATTTTT
   121  TTTAATGGAG GTTGCTGGAT CTACAAGGAA GCCATTTCAA CAAACCGAGA TTAACTGGGA
   181  CAAGCTTGAT AAGACTAGGT TCTATGTCGT AGGAGCTGGG ATATTTACAG GGCTTACTGT
   241  TGCACTATAC CCCATTTCTG TCATCAAGAC TAGAATGCAG GTGGCAACCA ATAATGCTGC
   301  AAAAGAGAGT GCATTTTCTG TTGTCAGGGG CCTAGTGCGA AATGATGGTA TTCCCGGTTT
   361  ATATAGAGGA TTTGGAACTG TCATTACAGG GAGCGGTTCC TGCCAGAATT ATATTTCTCA
   421  CAGCACTAGA GACCACTAAG GTGACTGCAT TTAAGATGGT GGAACCATTC AAGCTATCAG
   481  AACCTGTACA GGCAGCTATA GCAAATGGTG TTGCTGGCAT GCTGGCGTCT CTTTGTTCAC
   541  AATCCGTCTT TGTTCCAATT GACATAGTTA GTCAAAGGTT AATGGTGCAA GGATACTCAG
   601  GACATGCAAG CTACAATGGA GGGCTTGGAT GTTGCTCGCA AAGTTCTGAA GTCAGAAGGT
   661  ATACGTGGAC TATATAGAGG ATTCAGTCTG TCTGTTCTAC ATACTCCCCA TCCAGTGCTG
   721  TATGGTGGGC AAGTTATGGT TCGAGCCAGC GCTTCTATGG AGCAAGCTCT TGGATAATGG
   781  AC

Predicted gene structure (within gDNA segment 7500 to 9529):

 Exon  1   7500   7509 (  10 n);  cDNA    154    163 (  10 n); score: 0.900
  Intron  1   7510   8038 ( 529 n); Pd: 0.000 (s:    0), Pa: 0.000 (s:    0)
 Exon  2   8039   8058 (  20 n);  cDNA    164    183 (  20 n); score: 0.900
  Intron  2   8059   8338 ( 280 n); Pd: 0.338 (s:    0), Pa: 0.581 (s: 0.64)
 Exon  3   8339   8720 ( 382 n);  cDNA    184    566 ( 383 n); score: 0.615
  Intron  3   8721   8848 ( 128 n); Pd: 0.857 (s: 0.66), Pa: 0.962 (s: 0.74)
 Exon  4   8849   9045 ( 197 n);  cDNA    567    762 ( 196 n); score: 0.751

MATCH	21326110+	13778583+	0.661	609	0.779	C
PGS_21326110+_13778583+	(7500  7509,8039  8058,8339  8720,8849  9045)

Alignment (genomic DNA sequence = upper lines):

ATTTTAACAA AAATGATAAC CTGCAATGTT ATTTATGAGT TCGCAGATAA ATCTGCTTGC     7559
|||| |||||                                                        
ATTTCAACAA .......... .......... .......... .......... ..........      163


ATTGCTACGC TGAACTGCGC AAGGAAGGAA AGAGTTCAAC GACCACGTGG TCAAATGGGC     7619
                                                                  
.......... .......... .......... .......... .......... ..........      163


CATTTGCCGT AAAGCAAAGC AAACGGGCTT GGCAACCGAG CCCAACTGTT AGAGCGCGTA     7679
                                                                  
.......... .......... .......... .......... .......... ..........      163


CTACTCTCTC ATTCTGCCTT TGGGCCCAAG AAAGAGGCGT CCCCATCCCT GACGGCTGAC     7739
                                                                  
.......... .......... .......... .......... .......... ..........      163


GCCGTCGACG CGGCGACGCC CTCCAACAAA ACGGAAGAGG CGAGGAGCAC ATGCCCTGTC     7799
                                                                  
.......... .......... .......... .......... .......... ..........      163


CGCCATTCTC GCTGAGTTGT TGTGGACAAA AACAGCACGA AAGTGGGGAG GGAAAACGGG     7859
                                                                  
.......... .......... .......... .......... .......... ..........      163


GGGAAGCCAA CCACAGCAGC CCGCCCGCCC GCCATTCTTG CCGAATCGAG TCCACGCCAC     7919
                                                                  
.......... .......... .......... .......... .......... ..........      163


GCCTCCTGCG CCCCCTTCGG TTCTCACCTC GGGAGTCGCG GATTGGTGGA GGGGAGGATT     7979
                                                                  
.......... .......... .......... .......... .......... ..........      163


TGAGCGGCGC GGCCATGGAT ACAACCTCTA GGGCCGCCAA GATCCCGTCG CTCCACCAGA     8039
                                                                | 
.......... .......... .......... .......... .......... .........A      164


CGGAGATCAA CTGGGACAAG TAAGCAACCC ACCGGTCTTG TAATCCTTAG GTTCCCATTT     8099
| ||||| || |||||||||                                              
CCGAGATTAA CTGGGACAA. .......... .......... .......... ..........      183


CGTGCCGATT TCCGCCTTTC TCGCGGTCCT AGTCTTCTAG AAATTTAGCT CCGATCGTTG     8159
                                                                  
.......... .......... .......... .......... .......... ..........      183


AACTGTGTCC CCCGCCCTAT TCCGGATTGG CTTTACCGCC TTAGGATTAG GAACTGTTGT     8219
                                                                  
.......... .......... .......... .......... .......... ..........      183


TTGAGGATTT GACATGGCTG TTCATGCTCC TGGACGAAGC GCAATTTGGG GATTCGTAGC     8279
                                                                  
.......... .......... .......... .......... .......... ..........      183


TTATTCCGTT GTTTCCGATT CTTTTACTGT TCTCAAATCG TGGCGCTGAA ATGTTGCAGC     8339
                                                                  
.......... .......... .......... .......... .......... .........G      184


CTCGACAAGA CCAAGCTCTA CGTGGTGGGC GCAGGCATGT TCAGCGGCGT CACCGTGGCG     8399
|| || |||| | | | ||||  || || ||  || || || | | |  ||  |  || || ||  
CTTGATAAGA CTAGGTTCTA TGTCGTAGGA GCTGGGATAT TTACAGGGCT TACTGTTGCA      244


CTGTATCCTG TCTCGGTGGT CAAGACCCGG ATGCAGGTTG CCTCTGGGGA CGCCATGAGG     8459
|| || ||   | || ||  | ||||||  |  |||||||| | |  |     |  ||    |   
CTATACCCCA TTTCTGTCAT CAAGACTAGA ATGCAGGTGG CAACCAATAA TGCTGCAAAA      304


AGGAACGCGC TGGCTACCTT CAAGAACATC CT-CAAGATG GACGGCGTGC CAGGGCTGTA     8518
  ||  ||   |  ||    | || |  | |   | | | ||  || ||  | | | ||  | || 
GAGAGTGCAT TTTCTGTTGT CAGGGGCCTA GTGCGAAAT- GATGGTATTC CCGGTTTATA      363


CCGGGGGTTT GCTACCGTTA TCATTGGG-G CTGTACCAAC TAGGATCATC TTCCTCACAG     8577
  | || ||| |  || || | | |  ||| | | || ||  |  || || ||  || ||||||| 
TAGAGGATTT GGAACTGTCA TTACAGGGAG CGGTTCCTGC CAGAATTATA TTTCTCACAG      423


CGCTTGAGAC AACCAAAGCA GCCTCGCTTA AGCTTGTTGA GCCCTTCAAG CTGTCAGAGC     8637
| || |||||  || || |    |  |  ||| || | || ||  || |||||| || ||||| | 
CACTAGAGAC CACTAAGGTG ACTGCATTTA AGATGGTGGA ACCATTCAAG CTATCAGAAC      483


CGGTGCGGGC TGCCTTTGCC AATGGCCTTG CTGGTCTGTC AGCGTCTACA TGTTCGCAGG     8697
| || | |||  ||  | ||  |||||  ||| ||||  ||    ||||||    ||||| ||   
CTGTACAGGC AGCTATAGCA AATGGTGTTG CTGGCATGCT GGCGTCTCTT TGTTCACAAT      543


CTATTTTTGT TCCAATTGAT GTGGTATGCC TCTCATGTGC CTTCTATGTG ATGTTGTATA     8757
|  | ||||| |||||||||   |                                          
CCGTCTTTGT TCCAATTGAC ATA....... .......... .......... ..........      566


GAGAAAAAAT ATCTTACAAT ATGTTGATGT TAAATGCTAA TTACAATACT AGACTACTGT     8817
                                                                  
.......... .......... .......... .......... .......... ..........      566


TTTCATTCTG TTGTGCATTG GAATGTTTCA GATTAGCCAG AAATTGATGG TTCAAGGATA     8877
                                   |||| ||  |  || |||| | |||||||| 
.......... .......... .......... .GTTAGTCAA AGGTTAATGG TGCAAGGATA      595


TTCTGGTAAT GCCAGATACA AAGG-TGGAT TAGATGTTGC TCGAAAGGTC ATAAAGGCTG     8936
 || ||  || || || |||| | ||  || | | |||||||| ||| || ||   | ||| | | 
CTCAGGACAT GCAAGCTACA ATGGAGGGCT TGGATGTTGC TCGCAAAGTT CTGAAGTCAG      655


ATGGCATTAG GGGGCTGTAC AGAGGATTTG GACTGTCTGT TATGACCTAT GCTCCATCCA     8996
| || ||  |  || || ||  ||||||||   | |||||||| | | || ||   | ||||||| 
AAGGTATACG TGGACTATAT AGAGGATTCA GTCTGTCTGT TCT-ACATAC TCCCCATCCA      714


GTGCTGTGTG GTGGGCAAGT TATGGTTCCA GCCAGCGCAT AATTTGGAG     9045
||||||| || |||||||||| |||||||| | |||||||| |   | |||||
GTGCTGTATG GTGGGCAAGT TATGGTTCGA GCCAGCGC-T TCTATGGAG      762





********************************************************************************
EST sequence    4 +strand (File: 11908994+)

     1  CAAGGGTTTA ATAGTAATAG TAATAGTAAT TCTTCATCTT CTTCTTCTTC TTGAACACGC
    61  AAATTCAATT CATAAACTCT TCAATTTCCT GCAAAATCTC AACACACGCT TCTTCAATGG
   121  CTGCTCCCGA AATCAACTGG GACAGGTTAG ATAAAATAAA ATACTATGTA GTGGGAGCTG
   181  GACTCTTTTC GGGTGTTACT GTGGCACTCT ACCCTGTCTC TGTTGTGAAG ACTAGGATGC
   241  AGGTTGCTTC AAACCATACT GCAGAGAGAA GTGCATTGTC TGTTGTGAAA GGATTACTCA
   301  AGACAGATGG CATTCGTGGT TTGTATAAAG GGTTTGGCAT TGCCGTCACC GGAGCAATTC
   361  CTGCCAGAAT CATATTTCTC ACTGCCTTGG AGACCACAAA GGCGGCTTCC TTCAAGATGC
   421  TTGAACCATT TAAACTATCT GAAACTACAC AGGCTGCCAT AGCAAATGGC ATTGGTGGCA
   481  TGACATCGTC GATCTGTGCA CAAGCTGTGT TTGTTCCAAT TGACGTGATT AGCCAAAAGT
   541  TGATGGTGCA AGGGTACTCA GGCCATGCCC AGTATAGTGG GGGCTTGGAT GTTGCTCCGT
   601  AAGTTGATAA AGGGGCTGAG GGAATTCCGG GGGTTAT

Predicted gene structure (within gDNA segment 7500 to 9591):

 Exon  1   8045   8058 (  14 n);  cDNA    132    145 (  14 n); score: 0.929
  Intron  1   8059   8338 ( 280 n); Pd: 0.338 (s:    0), Pa: 0.581 (s: 0.56)
 Exon  2   8339   8720 ( 382 n);  cDNA    146    527 ( 382 n); score: 0.631
  Intron  2   8721   8848 ( 128 n); Pd: 0.857 (s: 0.74), Pa: 0.962 (s: 0.74)
 Exon  3   8849   8952 ( 104 n);  cDNA    528    634 ( 107 n); score: 0.702

MATCH	21326110+	11908994+	0.646	500	0.785	C
PGS_21326110+_11908994+	(8045  8058,8339  8720,8849  8952)

Alignment (genomic DNA sequence = upper lines):

ATCAACTGGG ACAAGTAAGC AACCCACCGG TCTTGTAATC CTTAGGTTCC CATTTCGTGC     8104
|||||||||| |||                                                    
ATCAACTGGG ACAG...... .......... .......... .......... ..........      145


CGATTTCCGC CTTTCTCGCG GTCCTAGTCT TCTAGAAATT TAGCTCCGAT CGTTGAACTG     8164
                                                                  
.......... .......... .......... .......... .......... ..........      145


TGTCCCCCGC CCTATTCCGG ATTGGCTTTA CCGCCTTAGG ATTAGGAACT GTTGTTTGAG     8224
                                                                  
.......... .......... .......... .......... .......... ..........      145


GATTTGACAT GGCTGTTCAT GCTCCTGGAC GAAGCGCAAT TTGGGGATTC GTAGCTTATT     8284
                                                                  
.......... .......... .......... .......... .......... ..........      145


CCGTTGTTTC CGATTCTTTT ACTGTTCTCA AATCGTGGCG CTGAAATGTT GCAGCCTCGA     8344
                                                             | || 
.......... .......... .......... .......... .......... ....GTTAGA      151


CAAGACCAAG CTCTACGTGG TGGGCGCAGG CATGTTCAGC GGCGTCACCG TGGCGCTGTA     8404
 || |  ||    ||| || | |||| || ||   | ||     || || || | |||| || || 
TAAAATAAAA TACTATGTAG TGGGAGCTGG ACTCTTTTCG GGTGTTACTG TGGCACTCTA      211


TCCTGTCTCG GTGGTCAAGA CCCGGATGCA GGTTGCCTCT GGGGACGCCA TGAGGAGGAA     8464
 ||||||||  || || |||| |  ||||||| |||||| ||      |  |       ||| |  
CCCTGTCTCT GTTGTGAAGA CTAGGATGCA GGTTGCTTCA AACCATACTG CAGAGAGAAG      271


CGCGCTGGCT ACCTTCAAGA ACATCCTCAA GATGGACGGC GTGCCAGGGC TGTACCGGGG     8524
 ||  || ||     | ||      | ||||| ||  || |||  | |  ||   ||||    || 
TGCATTGTCT GTTGTGAAAG GATTACTCAA GACAGATGGC ATTCGTGGTT TGTATAAAGG      331


GTTTGCTACC GTTATCATTG GGGCTGTACC AACTAGGATC ATCTTCCTCA CAGCGCTTGA     8584
|||||  |   |   |||  | | ||  | ||   | || ||| || || |||| | ||  | || 
GTTTGGCATT GCCGTCACCG GAGCAATTCC TGCCAGAATC ATATTTCTCA CTGCCTTGGA      391


GACAACCAAA GCAGCCTCGC TTAAGCTTGT TGAGCCCTTC AAGCTGTCAG AGCCGGTGCG     8644
||| || ||  || || ||   | ||| |  | ||| || ||  || || || | |  |    |  
GACCACAAAG GCGGCTTCCT TCAAGATGCT TGAACCATTT AAACTATCTG AAACTACACA      451


GGCTGCCTTT GCCAATGGCC TTGCTGGTCT GTCAGCGTCT ACATGTTCGC AGGCTATTTT     8704
||||||| |  || ||||||  ||| |||  | | || ||||  |  ||| | | | ||| | || 
GGCTGCCATA GCAAATGGCA TTGGTGGCAT GACATCGTCG ATCTGTGCAC AAGCTGTGTT      511


TGTTCCAATT GATGTGGTAT GCCTCTCATG TGCCTTCTAT GTGATGTTGT ATAGAGAAAA     8764
|||||||||| || |||                                                 
TGTTCCAATT GACGTG.... .......... .......... .......... ..........      527


AATATCTTAC AATATGTTGA TGTTAAATGC TAATTACAAT ACTAGACTAC TGTTTTCATT     8824
                                                                  
.......... .......... .......... .......... .......... ..........      527


CTGTTGTGCA TTGGAATGTT TCAGATTAGC CAGAAATTGA TGGTTCAAGG ATATTCTGGT     8884
                          |||||| || || |||| |||| |||||  || || ||  
.......... .......... ....ATTAGC CAAAAGTTGA TGGTGCAAGG GTACTCAGGC      563


AATGCCAGAT ACAAAGGTGG ATTAGATGTT GCT-CGAAAG GTCATAAA-- GGCTGATGGC     8941
 |||||   | | |  || ||  || |||||| ||| || |||  | |||||   |||||| ||  
CATGCCCAGT ATAGTGGGGG CTTGGATGTT GCTCCGTAAG TTGATAAAGG GGCTGAGGGA      623


ATTAGGGGGC T     8952
|||  ||||  |
ATTCCGGGGG T      634





********************************************************************************
EST sequence   71 +strand (File: 16312083+)

     1  GAGGAACGCC CTGGCCACCT TTAAAAACAT CCTCAAGGTG GATGGGGTGC CTGGGCTCTA
    61  CCGATGGTTA GGGACCGCCA TCACTGGGGC TATCCCGGCT AGGATTATCT TACTCACGGC
   121  GCTCGAGAAG ACAAAGGCGA CTTCACTCAA GCTTGTCGAG CCTATACAGC TGTCACAGTC
   181  GATGGAGGCT GCCCTTGCTA ATGGCCTTGC TGGCTCGACG GCGTCTCTGT GTTCACAGGC
   241  CGTGTTGGTG CCCATTGATG TGGCTAGTCA GAAATTGATG GTTCAAGGAT ATTCTGGTCA
   301  TGTTAGATAT AAGGGTGGAA TCGATGTTGC TCAAAAGATT ATGAAAGCTG ATGGGCCACG
   361  GGGATTGTAC ACAGGATTAG GCCTATCTGC TATGACGTAT GCACCATCTA GCGCTGTGTG
   421  GTGGGCAAGC TATGGATTCA GCN

Predicted gene structure (within gDNA segment 8059 to 9390):

 Exon  1   8459   8720 ( 262 n);  cDNA      1    262 ( 262 n); score: 0.767
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.70), Pa: 0.962 (s: 0.86)
 Exon  2   8849   9029 ( 181 n);  cDNA    263    443 ( 181 n); score: 0.807

MATCH	21326110+	16312083+	0.783	443	1.000	C
PGS_21326110+_16312083+	(8459  8720,8849  9029)

Alignment (genomic DNA sequence = upper lines):

GAGGAACGCG CTGGCTACCT TCAAGAACAT CCTCAAGATG GACGGCGTGC CAGGGCTGTA     8518
|||||||||  ||||| |||| | || ||||| ||||||| || || || |||| | ||||| || 
GAGGAACGCC CTGGCCACCT TTAAAAACAT CCTCAAGGTG GATGGGGTGC CTGGGCTCTA       60


CCGGGGGTTT GCTACCGTTA TCATTGGGGC TGTACCAACT AGGATCATCT TCCTCACAGC     8578
|||  ||||  |  ||||  | ||| |||||| | | ||  || ||||| |||| | ||||| || 
CCGATGGTTA GGGACCGCCA TCACTGGGGC TATCCCGGCT AGGATTATCT TACTCACGGC      120


GCTTGAGACA ACCAAAGCAG CCTCGCTTAA GCTTGTTGAG CCCTTCAAGC TGTCAGAGCC     8638
||| ||||   || || ||   | || || || |||||| ||| ||  |  ||| ||||| || | 
GCTCGAGAAG ACAAAGGCGA CTTCACTCAA GCTTGTCGAG CCTATACAGC TGTCACAGTC      180


GGTGCGGGCT GCCTTTGCCA ATGGCCTTGC TGGTCTGTCA GCGTCTACAT GTTCGCAGGC     8698
| ||  |||| ||| |||| | |||||||||| |||   | |  ||||||   | |||| ||||| 
GATGGAGGCT GCCCTTGCTA ATGGCCTTGC TGGCTCGACG GCGTCTCTGT GTTCACAGGC      240


TATTTTTGTT CCAATTGATG TGGTATGCCT CTCATGTGCC TTCTATGTGA TGTTGTATAG     8758
  | || ||  || ||||||| ||                                          
CGTGTTGGTG CCCATTGATG TG........ .......... .......... ..........      262


AGAAAAAATA TCTTACAATA TGTTGATGTT AAATGCTAAT TACAATACTA GACTACTGTT     8818
                                                                  
.......... .......... .......... .......... .......... ..........      262


TTCATTCTGT TGTGCATTGG AATGTTTCAG ATTAGCCAGA AATTGATGGT TCAAGGATAT     8878
                                   ||| |||| |||||||||| |||||||||| 
.......... .......... .......... GCTAGTCAGA AATTGATGGT TCAAGGATAT      292


TCTGGTAATG CCAGATACAA AGGTGGATTA GATGTTGCTC GAAAGGTCAT AAAGGCTGAT     8938
|||||| |||   ||||| ||  |||||| |  ||||||||||  |||| | ||  || |||||| 
TCTGGTCATG TTAGATATAA GGGTGGAATC GATGTTGCTC AAAAGATTAT GAAAGCTGAT      352


GGCATTAGGG GGCTGTACAG AGGATTTGGA CTGTCTGTTA TGACCTATGC TCCATCCAGT     8998
||     ||| |  ||||||  |||||| ||  || |||| || |||| |||||  ||||| ||  
GGGCCACGGG GATTGTACAC AGGATTAGGC CTATCTGCTA TGACGTATGC ACCATCTAGC      412


GCTGTGTGGT GGGCAAGTTA TGGTTCCAGC C     9029
|||||||||| ||||||| || ||| | ||||  
GCTGTGTGGT GGGCAAGCTA TGGATTCAGC N      443





********************************************************************************
EST sequence   21 +strand (File: 11207020+)

     1  GGAATCTTTA CTGGAGTTAC AGTAGCATTA TACCCAGTCT CTGTTGTAAA AACTAGGCTT
    61  CAGGTTGCTT CGAAGGACAC TGCAGAGAGA AGTGCTTTTT CTGTTATTAG AGGCATACTG
   121  AAAACAGATG GAATCCCTGG TCTCTATCGA GGGTTTGGAA CAGTCATCAC TGGTGCCATT
   181  CCTGCCAGGG TGATATTTCT CACTGCTCTG GAAACTACAA AAGTAGCTGC TTTCAGCATG
   241  GTTGAACCAT TTAAATTCTC TGAACCTACG CAAGCTGCTA TAGCAAATGG AATTGCTGGA
   301  ATGACTGCAT CTCTGTTTGC TCAAGCTGTT TTTGTTCCAA TTGATGTGAT TAGTCAAAAG
   361  TTGATGGTCC AAGGATACTC AGGCCATGCA AAGTACAACG GAGGTCTAGA TGTTGCTCGT
   421  AAGGTTTTAA AGTCTGATGG AATCCGAGGA TTATACAGAG GATTTGGTTT GGCAGTCATG
   481  ACTTACTCTG CATGCAGGGC TGAGTGGGGG GCTAGATATG GATCTAGCCA ACGTGGTATC
   541  TGGAGGTTCT TGGGCCAGGC ACAGACCCTA AAGAAGGGGG TCCTAGGCTT CGACATAGGG
   601  GCTGGCCAGG CTGGTGGAGA ATAATGGGGG GGCTCGAGGG GCTGCTGGCA CTGCGTGGGG
   661  CCCTTTGAGA CTGGCTGCGG GAGGTGGGCC TTATGAAGGA CCTTTACCAG CATATGAGAA
   721  AGCTGCGTTG CTTACAATGT ACGTAAGGTT TTCCATTGGG ATGGTTCATT ATCTTATATG
   781  ATAATCTTAA GGACCCTCAG GCGGATGATT TAATCCTGGA TCCTTGTACC AGGTCTTACT
   841  GTGCGGCCGT CGTTCCTCGA CTATTAGTAC ACTGTTGTAC C

Predicted gene structure (within gDNA segment 7500 to 11342):

 Exon  1   8487   8720 ( 234 n);  cDNA    115    348 ( 234 n); score: 0.671
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.74), Pa: 0.962 (s: 0.78)
 Exon  2   8849   9045 ( 197 n);  cDNA    349    545 ( 197 n); score: 0.751
  Intron  2   9046   9697 ( 652 n); Pd: 0.980 (s: 0.74), Pa: 0.977 (s: 0.55)
 Exon  3   9698   9773 (  76 n);  cDNA    546    621 (  76 n); score: 0.526
  Intron  3   9774  10200 ( 427 n); Pd: 0.000 (s: 0.58), Pa: 0.957 (s:    0)
 Exon  4  10201  10207 (   7 n);  cDNA    622    628 (   7 n); score: 0.714
  Intron  4  10208  11329 (1122 n); Pd: 0.753 (s:    0), Pa: 0.992 (s:    0)
 Exon  5  11330  11342 (  13 n);  cDNA    629    641 (  13 n); score: 0.538

MATCH	21326110+	11207020+	0.680	527	0.598	C
PGS_21326110+_11207020+	(8487  8720,8849  9045,9698  9773,10201  10207,11330  11342)

Alignment (genomic DNA sequence = upper lines):

ATCCTCAAGA TGGACGGCGT GCCAGGGCTG TACCGGGGGT TTGCTACCGT TATCATTGGG     8546
|| || || |   || ||  |  || || ||  || || |||| |||  || ||  |||| |||  
ATACTGAAAA CAGATGGAAT CCCTGGTCTC TATCGAGGGT TTGGAACAGT CATCACTGGT      174


GCTGTACCAA CTAGGATCAT CTTCCTCACA GCGCTTGAGA CAACCAAAGC AGCCTCGCTT     8606
||  | ||   | ||| | ||  || |||||  || || || | | || ||||  || ||   || 
GCCATTCCTG CCAGGGTGAT ATTTCTCACT GCTCTGGAAA CTACAAAAGT AG-CTGCTTT      233


AAGC-TTGTT GAGCCCTTCA AGCTGTCAGA GCCGGTGCGG GCTGCCTTTG CCAATGGCCT     8665
 ||| | ||| || || || | |  | || ||  ||   ||   |||||  | | | |||||  | 
CAGCATGGTT GAACCATTTA AATTCTCTGA ACCTACGCAA GCTGCTATAG CAAATGGAAT      293


TGCTGGTCTG TCAGCGTCTA CATGTTCGCA GGCTATTTTT GTTCCAATTG ATGTGGTATG     8725
||||||  ||  | || |||    | | | ||  ||| ||||| |||||||||| |||||      
TGCTGGAATG ACTGCATCTC TGTTTGCTCA AGCTGTTTTT GTTCCAATTG ATGTG.....      348


CCTCTCATGT GCCTTCTATG TGATGTTGTA TAGAGAAAAA ATATCTTACA ATATGTTGAT     8785
                                                                  
.......... .......... .......... .......... .......... ..........      348


GTTAAATGCT AATTACAATA CTAGACTACT GTTTTCATTC TGTTGTGCAT TGGAATGTTT     8845
                                                                  
.......... .......... .......... .......... .......... ..........      348


CAGATTAGCC AGAAATTGAT GGTTCAAGGA TATTCTGGTA ATGCCAGATA CAAAGGTGGA     8905
   ||||| | | || ||||| ||| |||||| || || ||   |||| |  || ||| || ||  
...ATTAGTC AAAAGTTGAT GGTCCAAGGA TACTCAGGCC ATGCAAAGTA CAACGGAGGT      405


TTAGATGTTG CTCGAAAGGT CATAAAGGCT GATGGCATTA GGGGGCTGTA CAGAGGATTT     8965
 ||||||||| |||| |||||   ||||| || ||||| ||   | ||  | || |||||||||| 
CTAGATGTTG CTCGTAAGGT TTTAAAGTCT GATGGAATCC GAGGATTATA CAGAGGATTT      465


GGACTGTCTG TTATGACCTA TGCTCCATCC AGTGCTGTGT GGTGGGCAAG TTATGGTTCC     9025
||  || | | | ||||| ||   || ||| | || |||| || || |||| ||  ||||| ||  
GGTTTGGCAG TCATGACTTA CTCTGCATGC AGGGCTGAGT GGGGGGCTAG ATATGGATCT      525


AGCCAGCGCA TAATTTGGAG GTTAGCTTAT CTGATTGGTT CATCGTTATG TTCCTCTCAG     9085
||||| ||     || |||||                                             
AGCCAACGTG GTATCTGGAG .......... .......... .......... ..........      545


CCCTGTGTAC TATGTAATAT TTACGAGAAA AAGACCAGTA ATACATTTCT ACTTAATAGT     9145
                                                                  
.......... .......... .......... .......... .......... ..........      545


TATTTGAATT GGTACTTTCC ATCTGTCCAA AACCTTTTCA AACTTCCCCT CTTGATGCTC     9205
                                                                  
.......... .......... .......... .......... .......... ..........      545


AAACTGCAGC TATAATTGCA ATTTTGTTTT CTGATGCTTG TTCTTCCATG TCAATATGTA     9265
                                                                  
.......... .......... .......... .......... .......... ..........      545


CATATCTTTT TTAGAAAACA AGAATGCATC TCAATGCATG TGCTGTATTG TTTTGATTAG     9325
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATTTATCATA GCGATCAATC ACATTTTCTT TACAGATAAA AATAGTCGGA AGGATAAGTT     9385
                                                                  
.......... .......... .......... .......... .......... ..........      545


GGATAACTGA CCAAAGTGGA AATATGATCT TACATATTTT TATCTCTGGC AGCTTAGAGA     9445
                                                                  
.......... .......... .......... .......... .......... ..........      545


ACTTAATTAC CAACCTGAAA CAATGTGATG AAGTAACTAC ACAAAACCAC ATATAGTTTC     9505
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATGCACTCTG CAAAACTAAA TTGAAACTCT TAGTGTGCTC TTAATGCTGT TAAGAGGGTG     9565
                                                                  
.......... .......... .......... .......... .......... ..........      545


TATGCAAGTT TACTGGAATC AGTACCTTTT GTTAGTTTAT TTCTTTGTGG TTGATGGTTG     9625
                                                                  
.......... .......... .......... .......... .......... ..........      545


AAAGATTATA TTTCTTGTCT TGATAACTTA GCCAAAATAG TTAACTATTG TGCTTTTTAC     9685
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATATTGGAAC AGTGCTCTT- GGCCATTTGC A-TGAC-AAA GAAGAGGCTC CTAGCCAATT     9742
              | ||||  |||||    | |    | ||| |||| || || |||| |  |  
.......... ..-GTTCTTG GGCCAGGCAC AGACCCTAAA GAAGGGGGTC CTAGGC-TTC      591


GAAACTAGTT GGTGTTCAAG CATCAGGGGG GGTTTTTGCC GGTGCCGTGA CCTCTTTTGT     9802
|| | |||   | ||  || | |    || |                                   
GACA-TAGGG GCTGGCCAGG CTGGTGGAGA A......... .......... ..........      621


TACGACTCCC ATAGATACAA TAAAGACCAG GCTGCAGGTA CTGTGTGACA TTCTGTTTGC     9862
                                                                  
.......... .......... .......... .......... .......... ..........      621


TGATTACTCT TGTAATTTGA TTTGTGTGGG TATATTTTGT GAGGCTTACC CTTGTGACTT     9922
                                                                  
.......... .......... .......... .......... .......... ..........      621


AATGATTCTT GTCTTTACAT TTATGCTGCT CATTTGCAAT AATTTGATTC CTTATCAATG     9982
                                                                  
.......... .......... .......... .......... .......... ..........      621


CAATGCCACT AAGTTTAGGG GAATGGATAT TTTGTTTTGG AAGTATATTT GATGTCAGAC    10042
                                                                  
.......... .......... .......... .......... .......... ..........      621


TTGAAGACCT AAATGTTCTT TTATACTGAT ATTTCCTCCA ATGGCGGGCT ATTGAGGTGC    10102
                                                                  
.......... .......... .......... .......... .......... ..........      621


TGGACTGGAA TGCTGTCTAT ATTAAACAAT ATATACTTCT ATGTTTACAG CTGTTTGTTT    10162
                                                                  
.......... .......... .......... .......... .......... ..........      621


TCTGCTGACA TACCATGACC AATTTGTCAT GGTTTCAGTT ATGAGGTCAG AAAAAAAGAA    10222
                                         |  ||| |                 
.......... .......... .......... ........TA ATGGG..... ..........      628


ACTTCCATTG GGAAAACTTG ATATCTATTA CTTCATTATT TATAGTGAGT AACAAAAGTT    10282
                                                                  
.......... .......... .......... .......... .......... ..........      628


AGCACTTTCA AACTGACTAA AGTATGCCAG GGACGTATCA TGCATTTTAC AACATGCTCC    10342
                                                                  
.......... .......... .......... .......... .......... ..........      628


ACATATCTCC AAATATCACA TATTACGCTT GTAGTGGTAA ACTGATAATA CATCTACCAA    10402
                                                                  
.......... .......... .......... .......... .......... ..........      628


CACTGAAAGT TCTCACAAGT CAGAACCCTA TATTTGACAG TTGTGGTCTC CCTCCTTCCC    10462
                                                                  
.......... .......... .......... .......... .......... ..........      628


TCTGCATTTG TTGCTACAGA TGATTACACT GAGTTTTGTT TCTTGTCATT TAGGTTATGG    10522
                                                                  
.......... .......... .......... .......... .......... ..........      628


ATAATGAAAA TAAGCCAAAA GCCAGGGAAG TTGTCAAAAG ATTGATTGCT GAAGATGGAT    10582
                                                                  
.......... .......... .......... .......... .......... ..........      628


GGAAAGGTTT GTACAGAGGG TTGGGTCCAA GATTTTTCAG CTCATCAGCT TGGGGAACCT    10642
                                                                  
.......... .......... .......... .......... .......... ..........      628


CAATGATAGT ATGCTACGAG TACCTGAGTA TGTTTCGTCT TCCCTTGTCA AATGTACACA    10702
                                                                  
.......... .......... .......... .......... .......... ..........      628


TGCATATGTA GTGTTATATA TCACTGCATC CCATGCAGGT TAATTTTAAG TACCCAGATA    10762
                                                                  
.......... .......... .......... .......... .......... ..........      628


CTTCTTCTCA TTTAGAATTT AGTTAAAATG ACATCATTCA GGTCAGTTGG CATCTCCAGT    10822
                                                                  
.......... .......... .......... .......... .......... ..........      628


ACACTGCTTT TGTAAGTTGT ATCATAAATC CCATTTGCAA TGAAATTTTT GACTCAAGTT    10882
                                                                  
.......... .......... .......... .......... .......... ..........      628


GCAGCCTGTA ACTTTTCTAT ATTTTTCGAA TAAAGCTATC ACCGTACATG AAACCTGCTT    10942
                                                                  
.......... .......... .......... .......... .......... ..........      628


CTGTTAATGC CAAGGAGCGC ACATTATTTC CTGTAGACCG GCTTGGATGT TGAACAATTG    11002
                                                                  
.......... .......... .......... .......... .......... ..........      628


GCACATGCAA GTAGCAAAGA GCAGCCTTGT GCTTGCAACA ATCTGGTCCA CCTGTGGATA    11062
                                                                  
.......... .......... .......... .......... .......... ..........      628


TGTTCGCTGT GAAAGAAACC AATTAGTCCT TGTATGAAAC ATGGTATTAG CGCTTCATGA    11122
                                                                  
.......... .......... .......... .......... .......... ..........      628


ATAAAACCAC TGATTCTGAT TTCTTATTTT CAATGAATGG ATGGGCATTA CCAAAGTTAT    11182
                                                                  
.......... .......... .......... .......... .......... ..........      628


CATGATTAAA GATCTATTTC ATATAAGTTT ATTTTTATAC ATTAGAGTTT ATTTAGAGAA    11242
                                                                  
.......... .......... .......... .......... .......... ..........      628


CAAGGTATAT TTAGTTTTGG TAATTTTGTG AACTGCACTC AGACGACTTT GGTATTCTTA    11302
                                                                  
.......... .......... .......... .......... .......... ..........      628


CTGTAATTTT GTTTTGTTTT CCTACAGAGC GCTTGTGTGC    11342
                              |  ||| | | |  
.......... .......... .......GGG GCTCGAGGGG      641





********************************************************************************
EST sequence   20 +strand (File: 11206955+)

     1  GGAATCTTTA CTGGAGTTAC AGTAGCATTA TACCCAGTCT CTGTTGTAAA AACTAGGCTT
    61  CAGGTTGCTT CGAAGGACAC TGCAGAGAGA AGTGCTTTTT CTGTTATTAG AGGCATACTG
   121  AAAACAGATG GAATCCCTGG TCTCTATCGA GGGTTTGGAA CAGTCATCAC TGGTGCCATT
   181  CCTGCCAGGG TGATATTTCT CACTGCTCTG GAAACTACAA AAGTAGCTGC TTTCAGCATG
   241  GTTGAACCAT TTAAATTCTC TGAACCTACG CAAGCTGCTA TAGCAAATGG AATTGCTGGA
   301  ATGACTGCAT CTCTGTTTGC TCAAGCTGTT TTTGTTCCAA TTGATGTGAT TAGTCAAAAG
   361  TTGATGGTCC AAGGATACTC AGGCCATGCA AAGTACAACG GAGGTCTAGA TGTTGCTCGT
   421  AAGGTTTTAA AGTCTGATGG AATCCGAGGA TTATACAGAG GATTTGGTTT GTCAGTCATG
   481  ACTTACTCTC CATCCAGTGC TGTATGGTGG GCTAGTTATG GTTCTAGCCA ACGTGTTATC
   541  TGGAGGTTCT TGGGCCAGGG CACAGACCTA AAGGAAGTAG CTCCTAGTCT ATCGACAATA
   601  GTGGCAGTGC AAGCTGCTGG AGGAATCATC GCAGGTGCTA CAGCTTCCTG CATCACAACT
   661  CCATTGGACA CTATTAAGAC TCGCTTACAG GTGATGGGGC ATGAGAAGCG ACCTTCTACA
   721  AGCAAGTCAG GAAAAACTGA ATTGCATATG ATGGTTGGAA AGGGTTCTAC AGAGGGTTGG
   781  GTACAAGATT CTTCAGTTGT GAACATGGGG AACCTCAAGG ATTTTACCTT AATGATACTG
   841  AGAACGGGAA TGCGTAGAAA AAGAC

Predicted gene structure (within gDNA segment 7500 to 11185):

 Exon  1   8487   8720 ( 234 n);  cDNA    115    348 ( 234 n); score: 0.671
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.74), Pa: 0.962 (s: 0.78)
 Exon  2   8849   9045 ( 197 n);  cDNA    349    545 ( 197 n); score: 0.792
  Intron  2   9046   9697 ( 652 n); Pd: 0.980 (s: 0.84), Pa: 0.977 (s: 0.54)
 Exon  3   9698   9839 ( 142 n);  cDNA    546    690 ( 145 n); score: 0.577
  Intron  3   9840  10515 ( 676 n); Pd: 0.994 (s: 0.58), Pa: 1.000 (s: 0.52)
 Exon  4  10516  10650 ( 135 n);  cDNA    691    823 ( 133 n); score: 0.696

MATCH	21326110+	11206955+	0.691	708	0.818	C
PGS_21326110+_11206955+	(8487  8720,8849  9045,9698  9839,10516  10650)

Alignment (genomic DNA sequence = upper lines):

ATCCTCAAGA TGGACGGCGT GCCAGGGCTG TACCGGGGGT TTGCTACCGT TATCATTGGG     8546
|| || || |   || ||  |  || || ||  || || |||| |||  || ||  |||| |||  
ATACTGAAAA CAGATGGAAT CCCTGGTCTC TATCGAGGGT TTGGAACAGT CATCACTGGT      174


GCTGTACCAA CTAGGATCAT CTTCCTCACA GCGCTTGAGA CAACCAAAGC AGCCTCGCTT     8606
||  | ||   | ||| | ||  || |||||  || || || | | || ||||  || ||   || 
GCCATTCCTG CCAGGGTGAT ATTTCTCACT GCTCTGGAAA CTACAAAAGT AG-CTGCTTT      233


AAGC-TTGTT GAGCCCTTCA AGCTGTCAGA GCCGGTGCGG GCTGCCTTTG CCAATGGCCT     8665
 ||| | ||| || || || | |  | || ||  ||   ||   |||||  | | | |||||  | 
CAGCATGGTT GAACCATTTA AATTCTCTGA ACCTACGCAA GCTGCTATAG CAAATGGAAT      293


TGCTGGTCTG TCAGCGTCTA CATGTTCGCA GGCTATTTTT GTTCCAATTG ATGTGGTATG     8725
||||||  ||  | || |||    | | | ||  ||| ||||| |||||||||| |||||      
TGCTGGAATG ACTGCATCTC TGTTTGCTCA AGCTGTTTTT GTTCCAATTG ATGTG.....      348


CCTCTCATGT GCCTTCTATG TGATGTTGTA TAGAGAAAAA ATATCTTACA ATATGTTGAT     8785
                                                                  
.......... .......... .......... .......... .......... ..........      348


GTTAAATGCT AATTACAATA CTAGACTACT GTTTTCATTC TGTTGTGCAT TGGAATGTTT     8845
                                                                  
.......... .......... .......... .......... .......... ..........      348


CAGATTAGCC AGAAATTGAT GGTTCAAGGA TATTCTGGTA ATGCCAGATA CAAAGGTGGA     8905
   ||||| | | || ||||| ||| |||||| || || ||   |||| |  || ||| || ||  
...ATTAGTC AAAAGTTGAT GGTCCAAGGA TACTCAGGCC ATGCAAAGTA CAACGGAGGT      405


TTAGATGTTG CTCGAAAGGT CATAAAGGCT GATGGCATTA GGGGGCTGTA CAGAGGATTT     8965
 ||||||||| |||| |||||   ||||| || ||||| ||   | ||  | || |||||||||| 
CTAGATGTTG CTCGTAAGGT TTTAAAGTCT GATGGAATCC GAGGATTATA CAGAGGATTT      465


GGACTGTCTG TTATGACCTA TGCTCCATCC AGTGCTGTGT GGTGGGCAAG TTATGGTTCC     9025
||  |||| | | ||||| ||   |||||||| |||||||| | ||||||| || |||||||||  
GGTTTGTCAG TCATGACTTA CTCTCCATCC AGTGCTGTAT GGTGGGCTAG TTATGGTTCT      525


AGCCAGCGCA TAATTTGGAG GTTAGCTTAT CTGATTGGTT CATCGTTATG TTCCTCTCAG     9085
||||| ||   | || |||||                                             
AGCCAACGTG TTATCTGGAG .......... .......... .......... ..........      545


CCCTGTGTAC TATGTAATAT TTACGAGAAA AAGACCAGTA ATACATTTCT ACTTAATAGT     9145
                                                                  
.......... .......... .......... .......... .......... ..........      545


TATTTGAATT GGTACTTTCC ATCTGTCCAA AACCTTTTCA AACTTCCCCT CTTGATGCTC     9205
                                                                  
.......... .......... .......... .......... .......... ..........      545


AAACTGCAGC TATAATTGCA ATTTTGTTTT CTGATGCTTG TTCTTCCATG TCAATATGTA     9265
                                                                  
.......... .......... .......... .......... .......... ..........      545


CATATCTTTT TTAGAAAACA AGAATGCATC TCAATGCATG TGCTGTATTG TTTTGATTAG     9325
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATTTATCATA GCGATCAATC ACATTTTCTT TACAGATAAA AATAGTCGGA AGGATAAGTT     9385
                                                                  
.......... .......... .......... .......... .......... ..........      545


GGATAACTGA CCAAAGTGGA AATATGATCT TACATATTTT TATCTCTGGC AGCTTAGAGA     9445
                                                                  
.......... .......... .......... .......... .......... ..........      545


ACTTAATTAC CAACCTGAAA CAATGTGATG AAGTAACTAC ACAAAACCAC ATATAGTTTC     9505
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATGCACTCTG CAAAACTAAA TTGAAACTCT TAGTGTGCTC TTAATGCTGT TAAGAGGGTG     9565
                                                                  
.......... .......... .......... .......... .......... ..........      545


TATGCAAGTT TACTGGAATC AGTACCTTTT GTTAGTTTAT TTCTTTGTGG TTGATGGTTG     9625
                                                                  
.......... .......... .......... .......... .......... ..........      545


AAAGATTATA TTTCTTGTCT TGATAACTTA GCCAAAATAG TTAACTATTG TGCTTTTTAC     9685
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATATTGGAAC AGTGCTCTTG GCCATTTGCA -TGA-C-AAA -GAAGAGGCT CCTAGCCAAT     9741
              | ||||| | |    |||   || | |||  ||||  ||| ||||| | || 
.......... ..-GTTCTTG GGCCAGGGCA CAGACCTAAA GGAAGTAGCT CCTAGTCTAT      592


TGAAACTAGT TGGTGTTCAA GCATCAGGGG GGGTTTTTGC CGGTGCCGTG ACCTCTTTTG     9801
 || | ||||  |  || ||| ||  | || | |  |  | ||  |||||      | || |    
CGACAATAGT GGCAGTGCAA GCTGCTGGAG GAATCATCGC AGGTGCTACA GCTTCCTGCA      652


TTACGACTCC CATAGATACA ATAAAGACCA GGCTGCAGGT ACTGTGTGAC ATTCTGTTTG     9861
| || |||||   | || ||  || |||||   |  | |||                         
TCACAACTCC ATTGGACACT ATTAAGACTC GCTTACAG.. .......... ..........      690


CTGATTACTC TTGTAATTTG ATTTGTGTGG GTATATTTTG TGAGGCTTAC CCTTGTGACT     9921
                                                                  
.......... .......... .......... .......... .......... ..........      690


TAATGATTCT TGTCTTTACA TTTATGCTGC TCATTTGCAA TAATTTGATT CCTTATCAAT     9981
                                                                  
.......... .......... .......... .......... .......... ..........      690


GCAATGCCAC TAAGTTTAGG GGAATGGATA TTTTGTTTTG GAAGTATATT TGATGTCAGA    10041
                                                                  
.......... .......... .......... .......... .......... ..........      690


CTTGAAGACC TAAATGTTCT TTTATACTGA TATTTCCTCC AATGGCGGGC TATTGAGGTG    10101
                                                                  
.......... .......... .......... .......... .......... ..........      690


CTGGACTGGA ATGCTGTCTA TATTAAACAA TATATACTTC TATGTTTACA GCTGTTTGTT    10161
                                                                  
.......... .......... .......... .......... .......... ..........      690


TTCTGCTGAC ATACCATGAC CAATTTGTCA TGGTTTCAGT TATGAGGTCA GAAAAAAAGA    10221
                                                                  
.......... .......... .......... .......... .......... ..........      690


AACTTCCATT GGGAAAACTT GATATCTATT ACTTCATTAT TTATAGTGAG TAACAAAAGT    10281
                                                                  
.......... .......... .......... .......... .......... ..........      690


TAGCACTTTC AAACTGACTA AAGTATGCCA GGGACGTATC ATGCATTTTA CAACATGCTC    10341
                                                                  
.......... .......... .......... .......... .......... ..........      690


CACATATCTC CAAATATCAC ATATTACGCT TGTAGTGGTA AACTGATAAT ACATCTACCA    10401
                                                                  
.......... .......... .......... .......... .......... ..........      690


ACACTGAAAG TTCTCACAAG TCAGAACCCT ATATTTGACA GTTGTGGTCT CCCTCCTTCC    10461
                                                                  
.......... .......... .......... .......... .......... ..........      690


CTCTGCATTT GTTGCTACAG ATGATTACAC TGAGTTTTGT TTCTTGTCAT TTAGGTTATG    10521
                                                           || ||| 
.......... .......... .......... .......... .......... ....GTGATG      696


GATAATGAAA ATAAGCCAAA AGCCAGGGAA GTTGTCAAAA GATTGATTGC TGAAGATGGA    10581
|   |||| | |   | |       || | || ||    ||||   |  |||||   | |||||  
GGGCATGAGA A-GCGACCTT CTACAAGCAA GTCAGGAAAA ACTGAATTGC ATATGATGGT      755


TGGAAAGGTT TGTACAGAGG GTTGGGTCCA AGATTTTTCA GCTCATCAGC TTGGGGAACC    10641
|||||||| | | |||||||| ||||||| || ||||| |||| | |  | | |  ||||||||| 
TGGAAAGGGT TCTACAGAGG GTTGGGTACA AGATTCTTCA G-TTGTGAAC ATGGGGAACC      814


TCAATGATA    10650
|||| ||| 
TCAAGGATT      823





********************************************************************************
EST sequence   19 +strand (File: 18100417+)

     1  GGAATCTTTA CTGGAGTTAC AGTAGCATTA TACCCAGTCT CTGTTGTAAA AACTAGGCTT
    61  CAGGTTGCTT CGAAGGACAC TGCAGAGAGA AGTGCTTTTT CTGTTATTAG AGGCATACTG
   121  AAAACAGATG GAATCCCTGG TCTCTATCGA GGGTTTGGAA CAGTCATCAC TGGTGCCATT
   181  CCTGCCAGGG TGATATTTCT CACTGCTCTG GAAACTACAA AAGTAGCTGC TTTCAGCATG
   241  GTTGAACCAT TTAAATTCTC TGAACCTACG CAAGCTGCTA TAGCAAATGG AATTGCTGGA
   301  ATGACTGCAT CTCTGTTTGC TCAAGCTGTT TTTGTTCCAA TTGATGTGAT TAGTCAAAAG
   361  TTGATGGTCC AAGGATACTC AGGCCATGCA AAGTACAACG GAGGTCTAGA TGTTGCTCGT
   421  AAGGTTTTAA AGTCTGATGG AATCCGAGGA TTATACAGAG GATTTGGTTT GTCAGTCATG
   481  ACTTACTCTC CATCCAGTGC TGTATGGTGG GCTAGTTATG GTTCTAGCCA ACGTGTTATC
   541  TGGAGGTTCT TGGGCCAGGG CACAGACCTA AAGGAAGTAG CTCCTAGTCT ATCGACAATA
   601  GTGGCAGTGC AAGCTGCTGG AGGAATCATC GCAGGA

Predicted gene structure (within gDNA segment 7500 to 9973):

 Exon  1   8487   8720 ( 234 n);  cDNA    115    348 ( 234 n); score: 0.671
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.74), Pa: 0.962 (s: 0.78)
 Exon  2   8849   9045 ( 197 n);  cDNA    349    545 ( 197 n); score: 0.792
  Intron  2   9046   9697 ( 652 n); Pd: 0.980 (s: 0.84), Pa: 0.977 (s:    0)
 Exon  3   9698   9708 (  11 n);  cDNA    546    555 (  10 n); score: 0.727

MATCH	21326110+	18100417+	0.726	442	0.695	C
PGS_21326110+_18100417+	(8487  8720,8849  9045,9698  9708)

Alignment (genomic DNA sequence = upper lines):

ATCCTCAAGA TGGACGGCGT GCCAGGGCTG TACCGGGGGT TTGCTACCGT TATCATTGGG     8546
|| || || |   || ||  |  || || ||  || || |||| |||  || ||  |||| |||  
ATACTGAAAA CAGATGGAAT CCCTGGTCTC TATCGAGGGT TTGGAACAGT CATCACTGGT      174


GCTGTACCAA CTAGGATCAT CTTCCTCACA GCGCTTGAGA CAACCAAAGC AGCCTCGCTT     8606
||  | ||   | ||| | ||  || |||||  || || || | | || ||||  || ||   || 
GCCATTCCTG CCAGGGTGAT ATTTCTCACT GCTCTGGAAA CTACAAAAGT AG-CTGCTTT      233


AAGC-TTGTT GAGCCCTTCA AGCTGTCAGA GCCGGTGCGG GCTGCCTTTG CCAATGGCCT     8665
 ||| | ||| || || || | |  | || ||  ||   ||   |||||  | | | |||||  | 
CAGCATGGTT GAACCATTTA AATTCTCTGA ACCTACGCAA GCTGCTATAG CAAATGGAAT      293


TGCTGGTCTG TCAGCGTCTA CATGTTCGCA GGCTATTTTT GTTCCAATTG ATGTGGTATG     8725
||||||  ||  | || |||    | | | ||  ||| ||||| |||||||||| |||||      
TGCTGGAATG ACTGCATCTC TGTTTGCTCA AGCTGTTTTT GTTCCAATTG ATGTG.....      348


CCTCTCATGT GCCTTCTATG TGATGTTGTA TAGAGAAAAA ATATCTTACA ATATGTTGAT     8785
                                                                  
.......... .......... .......... .......... .......... ..........      348


GTTAAATGCT AATTACAATA CTAGACTACT GTTTTCATTC TGTTGTGCAT TGGAATGTTT     8845
                                                                  
.......... .......... .......... .......... .......... ..........      348


CAGATTAGCC AGAAATTGAT GGTTCAAGGA TATTCTGGTA ATGCCAGATA CAAAGGTGGA     8905
   ||||| | | || ||||| ||| |||||| || || ||   |||| |  || ||| || ||  
...ATTAGTC AAAAGTTGAT GGTCCAAGGA TACTCAGGCC ATGCAAAGTA CAACGGAGGT      405


TTAGATGTTG CTCGAAAGGT CATAAAGGCT GATGGCATTA GGGGGCTGTA CAGAGGATTT     8965
 ||||||||| |||| |||||   ||||| || ||||| ||   | ||  | || |||||||||| 
CTAGATGTTG CTCGTAAGGT TTTAAAGTCT GATGGAATCC GAGGATTATA CAGAGGATTT      465


GGACTGTCTG TTATGACCTA TGCTCCATCC AGTGCTGTGT GGTGGGCAAG TTATGGTTCC     9025
||  |||| | | ||||| ||   |||||||| |||||||| | ||||||| || |||||||||  
GGTTTGTCAG TCATGACTTA CTCTCCATCC AGTGCTGTAT GGTGGGCTAG TTATGGTTCT      525


AGCCAGCGCA TAATTTGGAG GTTAGCTTAT CTGATTGGTT CATCGTTATG TTCCTCTCAG     9085
||||| ||   | || |||||                                             
AGCCAACGTG TTATCTGGAG .......... .......... .......... ..........      545


CCCTGTGTAC TATGTAATAT TTACGAGAAA AAGACCAGTA ATACATTTCT ACTTAATAGT     9145
                                                                  
.......... .......... .......... .......... .......... ..........      545


TATTTGAATT GGTACTTTCC ATCTGTCCAA AACCTTTTCA AACTTCCCCT CTTGATGCTC     9205
                                                                  
.......... .......... .......... .......... .......... ..........      545


AAACTGCAGC TATAATTGCA ATTTTGTTTT CTGATGCTTG TTCTTCCATG TCAATATGTA     9265
                                                                  
.......... .......... .......... .......... .......... ..........      545


CATATCTTTT TTAGAAAACA AGAATGCATC TCAATGCATG TGCTGTATTG TTTTGATTAG     9325
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATTTATCATA GCGATCAATC ACATTTTCTT TACAGATAAA AATAGTCGGA AGGATAAGTT     9385
                                                                  
.......... .......... .......... .......... .......... ..........      545


GGATAACTGA CCAAAGTGGA AATATGATCT TACATATTTT TATCTCTGGC AGCTTAGAGA     9445
                                                                  
.......... .......... .......... .......... .......... ..........      545


ACTTAATTAC CAACCTGAAA CAATGTGATG AAGTAACTAC ACAAAACCAC ATATAGTTTC     9505
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATGCACTCTG CAAAACTAAA TTGAAACTCT TAGTGTGCTC TTAATGCTGT TAAGAGGGTG     9565
                                                                  
.......... .......... .......... .......... .......... ..........      545


TATGCAAGTT TACTGGAATC AGTACCTTTT GTTAGTTTAT TTCTTTGTGG TTGATGGTTG     9625
                                                                  
.......... .......... .......... .......... .......... ..........      545


AAAGATTATA TTTCTTGTCT TGATAACTTA GCCAAAATAG TTAACTATTG TGCTTTTTAC     9685
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATATTGGAAC AGTGCTCTTG GCC     9708
              | ||||| | |
.......... ..-GTTCTTG GGC      555





********************************************************************************
EST sequence   24 +strand (File: 27547342+)

     1  GGGGTTTGGG ACAGTTATCA CAGGGGCCAT CCCTGCTAGG ATTATCTTTC TTACAGCGCT
    61  TGAGACAACA AAGGCGGCCT CGCTTAAGCT TGTTGAACCA TTTAAGCTGT CGGAGCCGGT
   121  ACAAGCAGCC TTTGCCAATG GCCTTGGCGG TTTGTCGGCA TCTCTATGTT CGCAGGCTGT
   181  GTTTGTGCCC ATTGATGTGG TTAGCCAGAA ATTGATGGTT CAAGGATATT CTGGTCATGT
   241  TAGATATAAG GGTGGACTTG ATGTTGCCCA ACAGATTATA AAGGCTGATG GAATTCGGGG
   301  GCTGTACAGA GGATTTGGCC TGTCTGTTAT GACGTACTCA CCATCTAGTG CTGTGTGGTG
   361  GGCAAGCTAT GGGTCCAGCC AGCGCATAAT TTGGAGTGCT TTTGATCATT GGAATGATAA
   421  AGAAAGTTCT CCTAGTCAGT TGACAATAGT TGGTGTCCAA GCCACAGGGG GGATTATTGC
   481  TGGTGCAGTG ACATCCTGTG TTACAACTCC CATAGATACT ATCAAAACCA GACTGCAGGT
   541  TAATCAAAAC AAACCAAAAG CCATGGAAGT AGTTAGAAGA TTGATTGCTG AAGATGGATG
   601  GAAAGGTTTC TACAGAGGNT TAGGTCCAAG ATTTTTCAGC TCATCAGCTT GGGGTACCTC
   661  AATGATAGTA TGCTATGAAT ACCTAAAGCG CTTGTGTGCT AAAGNTGAAG AGGTCTGAGT
   721  CAGCTTAAAC ATATCACTCT GATGCTCGCA GTGGNGGAGN ATTTTGTAGC AAAAATCCAA
   781  TAATGCTGTA TGNCAACAAC TGGGANCCAT GAGGAGGAAG CTCTCTTTCT TGCTGACTTG
   841  ATACTANATA TCTTTAAAAT TTAGGGCTCT TGAGCT

Predicted gene structure (within gDNA segment 8014 to 12176):

 Exon  1   8522   8720 ( 199 n);  cDNA      1    199 ( 199 n); score: 0.824
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.82), Pa: 0.962 (s: 0.90)
 Exon  2   8849   9045 ( 197 n);  cDNA    200    396 ( 197 n); score: 0.883
  Intron  2   9046   9697 ( 652 n); Pd: 0.980 (s: 0.96), Pa: 0.977 (s: 0.72)
 Exon  3   9698   9839 ( 142 n);  cDNA    397    538 ( 142 n); score: 0.796
  Intron  3   9840  10515 ( 676 n); Pd: 0.994 (s: 0.84), Pa: 1.000 (s: 0.74)
 Exon  4  10516  10669 ( 154 n);  cDNA    539    686 ( 148 n); score: 0.870
  Intron  4  10670  11329 ( 660 n); Pd: 0.961 (s: 0.92), Pa: 0.992 (s: 0.82)
 Exon  5  11330  11448 ( 119 n);  cDNA    687    797 ( 111 n); score: 0.681

MATCH	21326110+	27547342+	0.821	811	0.926	C
PGS_21326110+_27547342+	(8522  8720,8849  9045,9698  9839,10516  10669,11330  11448)

Alignment (genomic DNA sequence = upper lines):

GGGGTTTGCT ACCGTTATCA TTGGGGCTGT ACCAACTAGG ATCATCTTCC TCACAGCGCT     8581
||||||||   || |||||||   |||||  |  ||  ||||| || ||||| | | |||||||| 
GGGGTTTGGG ACAGTTATCA CAGGGGCCAT CCCTGCTAGG ATTATCTTTC TTACAGCGCT       60


TGAGACAACC AAAGCAGCCT CGCTTAAGCT TGTTGAGCCC TTCAAGCTGT CAGAGCCGGT     8641
|||||||||  || || |||| |||||||||| |||||| ||  || ||||||| | |||||||| 
TGAGACAACA AAGGCGGCCT CGCTTAAGCT TGTTGAACCA TTTAAGCTGT CGGAGCCGGT      120


GCGGGCTGCC TTTGCCAATG GCCTTGCTGG TCTGTCAGCG TCTACATGTT CGCAGGCTAT     8701
 |  || ||| |||||||||| ||||||  || | |||| ||  |||  ||||| |||||||| | 
ACAAGCAGCC TTTGCCAATG GCCTTGGCGG TTTGTCGGCA TCTCTATGTT CGCAGGCTGT      180


TTTTGTTCCA ATTGATGTGG TATGCCTCTC ATGTGCCTTC TATGTGATGT TGTATAGAGA     8761
 ||||| ||  |||||||||                                              
GTTTGTGCCC ATTGATGTG. .......... .......... .......... ..........      199


AAAAATATCT TACAATATGT TGATGTTAAA TGCTAATTAC AATACTAGAC TACTGTTTTC     8821
                                                                  
.......... .......... .......... .......... .......... ..........      199


ATTCTGTTGT GCATTGGAAT GTTTCAGATT AGCCAGAAAT TGATGGTTCA AGGATATTCT     8881
                              || |||||||||| |||||||||| |||||||||| 
.......... .......... .......GTT AGCCAGAAAT TGATGGTTCA AGGATATTCT      232


GGTAATGCCA GATACAAAGG TGGATTAGAT GTTGCTCGAA AGGTCATAAA GGCTGATGGC     8941
||| |||  | |||| || || |||| | ||| ||||| | |  || | ||||| |||||||||  
GGTCATGTTA GATATAAGGG TGGACTTGAT GTTGCCCAAC AGATTATAAA GGCTGATGGA      292


ATTAGGGGGC TGTACAGAGG ATTTGGACTG TCTGTTATGA CCTATGCTCC ATCCAGTGCT     9001
||| |||||| |||||||||| |||||| ||| |||||||||| | ||  | || ||| |||||| 
ATTCGGGGGC TGTACAGAGG ATTTGGCCTG TCTGTTATGA CGTACTCACC ATCTAGTGCT      352


GTGTGGTGGG CAAGTTATGG TTCCAGCCAG CGCATAATTT GGAGGTTAGC TTATCTGATT     9061
|||||||||| |||| |||||  ||||||||| |||||||||| ||||                  
GTGTGGTGGG CAAGCTATGG GTCCAGCCAG CGCATAATTT GGAG...... ..........      396


GGTTCATCGT TATGTTCCTC TCAGCCCTGT GTACTATGTA ATATTTACGA GAAAAAGACC     9121
                                                                  
.......... .......... .......... .......... .......... ..........      396


AGTAATACAT TTCTACTTAA TAGTTATTTG AATTGGTACT TTCCATCTGT CCAAAACCTT     9181
                                                                  
.......... .......... .......... .......... .......... ..........      396


TTCAAACTTC CCCTCTTGAT GCTCAAACTG CAGCTATAAT TGCAATTTTG TTTTCTGATG     9241
                                                                  
.......... .......... .......... .......... .......... ..........      396


CTTGTTCTTC CATGTCAATA TGTACATATC TTTTTTAGAA AACAAGAATG CATCTCAATG     9301
                                                                  
.......... .......... .......... .......... .......... ..........      396


CATGTGCTGT ATTGTTTTGA TTAGATTTAT CATAGCGATC AATCACATTT TCTTTACAGA     9361
                                                                  
.......... .......... .......... .......... .......... ..........      396


TAAAAATAGT CGGAAGGATA AGTTGGATAA CTGACCAAAG TGGAAATATG ATCTTACATA     9421
                                                                  
.......... .......... .......... .......... .......... ..........      396


TTTTTATCTC TGGCAGCTTA GAGAACTTAA TTACCAACCT GAAACAATGT GATGAAGTAA     9481
                                                                  
.......... .......... .......... .......... .......... ..........      396


CTACACAAAA CCACATATAG TTTCATGCAC TCTGCAAAAC TAAATTGAAA CTCTTAGTGT     9541
                                                                  
.......... .......... .......... .......... .......... ..........      396


GCTCTTAATG CTGTTAAGAG GGTGTATGCA AGTTTACTGG AATCAGTACC TTTTGTTAGT     9601
                                                                  
.......... .......... .......... .......... .......... ..........      396


TTATTTCTTT GTGGTTGATG GTTGAAAGAT TATATTTCTT GTCTTGATAA CTTAGCCAAA     9661
                                                                  
.......... .......... .......... .......... .......... ..........      396


ATAGTTAACT ATTGTGCTTT TTACATATTG GAACAGTGCT CTTGGCCATT TGCATGACAA     9721
                                       ||||  |||  ||||  | |||| || 
.......... .......... .......... ......TGCT TTTGATCATT GGAATGATAA      420


AGAAGAGGCT CCTAGCCAAT TGAAACTAGT TGGTGTTCAA GCATCAGGGG GGGTTTTTGC     9781
||||    || ||||| || | ||| | |||| |||||| ||| ||  |||||| || || |||| 
AGAAAGTTCT CCTAGTCAGT TGACAATAGT TGGTGTCCAA GCCACAGGGG GGATTATTGC      480


CGGTGCCGTG ACCTCTTTTG TTACGACTCC CATAGATACA ATAAAGACCA GGCTGCAGGT     9841
 ||||| ||| || || | || |||| ||||| |||||||||  || || |||| | ||||||   
TGGTGCAGTG ACATCCTGTG TTACAACTCC CATAGATACT ATCAAAACCA GACTGCAG..      538


ACTGTGTGAC ATTCTGTTTG CTGATTACTC TTGTAATTTG ATTTGTGTGG GTATATTTTG     9901
                                                                  
.......... .......... .......... .......... .......... ..........      538


TGAGGCTTAC CCTTGTGACT TAATGATTCT TGTCTTTACA TTTATGCTGC TCATTTGCAA     9961
                                                                  
.......... .......... .......... .......... .......... ..........      538


TAATTTGATT CCTTATCAAT GCAATGCCAC TAAGTTTAGG GGAATGGATA TTTTGTTTTG    10021
                                                                  
.......... .......... .......... .......... .......... ..........      538


GAAGTATATT TGATGTCAGA CTTGAAGACC TAAATGTTCT TTTATACTGA TATTTCCTCC    10081
                                                                  
.......... .......... .......... .......... .......... ..........      538


AATGGCGGGC TATTGAGGTG CTGGACTGGA ATGCTGTCTA TATTAAACAA TATATACTTC    10141
                                                                  
.......... .......... .......... .......... .......... ..........      538


TATGTTTACA GCTGTTTGTT TTCTGCTGAC ATACCATGAC CAATTTGTCA TGGTTTCAGT    10201
                                                                  
.......... .......... .......... .......... .......... ..........      538


TATGAGGTCA GAAAAAAAGA AACTTCCATT GGGAAAACTT GATATCTATT ACTTCATTAT    10261
                                                                  
.......... .......... .......... .......... .......... ..........      538


TTATAGTGAG TAACAAAAGT TAGCACTTTC AAACTGACTA AAGTATGCCA GGGACGTATC    10321
                                                                  
.......... .......... .......... .......... .......... ..........      538


ATGCATTTTA CAACATGCTC CACATATCTC CAAATATCAC ATATTACGCT TGTAGTGGTA    10381
                                                                  
.......... .......... .......... .......... .......... ..........      538


AACTGATAAT ACATCTACCA ACACTGAAAG TTCTCACAAG TCAGAACCCT ATATTTGACA    10441
                                                                  
.......... .......... .......... .......... .......... ..........      538


GTTGTGGTCT CCCTCCTTCC CTCTGCATTT GTTGCTACAG ATGATTACAC TGAGTTTTGT    10501
                                                                  
.......... .......... .......... .......... .......... ..........      538


TTCTTGTCAT TTAGGTTATG GATAATGAAA ATAAGCCAAA AGCCAGGGAA GTTGTCAAAA    10561
               |   |    |||| ||| | || ||||| ||||| |||| || || | || 
.......... ....G---T- --TAATCAAA ACAAACCAAA AGCCATGGAA GTAGTTAGAA      578


GATTGATTGC TGAAGATGGA TGGAAAGGTT TGTACAGAGG GTTGGGTCCA AGATTTTTCA    10621
|||||||||| |||||||||| |||||||||| | ||||||||  || |||||| |||||||||| 
GATTGATTGC TGAAGATGGA TGGAAAGGTT TCTACAGAGG NTTAGGTCCA AGATTTTTCA      638


GCTCATCAGC TTGGGGAACC TCAATGATAG TATGCTACGA GTACCTGAGT ATGTTTCGTC    10681
|||||||||| |||||| ||| |||||||||| ||||||| ||  ||||| |              
GCTCATCAGC TTGGGGTACC TCAATGATAG TATGCTATGA ATACCTAA.. ..........      686


TTCCCTTGTC AAATGTACAC ATGCATATGT AGTGTTATAT ATCACTGCAT CCCATGCAGG    10741
                                                                  
.......... .......... .......... .......... .......... ..........      686


TTAATTTTAA GTACCCAGAT ACTTCTTCTC ATTTAGAATT TAGTTAAAAT GACATCATTC    10801
                                                                  
.......... .......... .......... .......... .......... ..........      686


AGGTCAGTTG GCATCTCCAG TACACTGCTT TTGTAAGTTG TATCATAAAT CCCATTTGCA    10861
                                                                  
.......... .......... .......... .......... .......... ..........      686


ATGAAATTTT TGACTCAAGT TGCAGCCTGT AACTTTTCTA TATTTTTCGA ATAAAGCTAT    10921
                                                                  
.......... .......... .......... .......... .......... ..........      686


CACCGTACAT GAAACCTGCT TCTGTTAATG CCAAGGAGCG CACATTATTT CCTGTAGACC    10981
                                                                  
.......... .......... .......... .......... .......... ..........      686


GGCTTGGATG TTGAACAATT GGCACATGCA AGTAGCAAAG AGCAGCCTTG TGCTTGCAAC    11041
                                                                  
.......... .......... .......... .......... .......... ..........      686


AATCTGGTCC ACCTGTGGAT ATGTTCGCTG TGAAAGAAAC CAATTAGTCC TTGTATGAAA    11101
                                                                  
.......... .......... .......... .......... .......... ..........      686


CATGGTATTA GCGCTTCATG AATAAAACCA CTGATTCTGA TTTCTTATTT TCAATGAATG    11161
                                                                  
.......... .......... .......... .......... .......... ..........      686


GATGGGCATT ACCAAAGTTA TCATGATTAA AGATCTATTT CATATAAGTT TATTTTTATA    11221
                                                                  
.......... .......... .......... .......... .......... ..........      686


CATTAGAGTT TATTTAGAGA ACAAGGTATA TTTAGTTTTG GTAATTTTGT GAACTGCACT    11281
                                                                  
.......... .......... .......... .......... .......... ..........      686


CAGACGACTT TGGTATTCTT ACTGTAATTT TGTTTTGTTT TCCTACAGAG CGCTTGTGTG    11341
                                                    || |||||||||| 
.......... .......... .......... .......... ........AG CGCTTGTGTG      698


CTAAAGTTGA AGAGGTCTGA TTTCTGAGCT GCCTTAAACT CAGAACGCAA TTCCTACAAT    11401
|||||| ||| ||||||||||   ||  |    | |||||||   |  || |    | ||   |  
CTAAAGNTGA AGAGGTCTGA -GTC--A--- G-CTTAAACA TATCACTCTG ATGCTCGCAG      751


TCTGGAAGTT TTGTATTAGC AGAAGTGTAA TAATGCTGTA CACCAAC    11448
|   | ||   || |  |||| | || |  || ||||||||||    ||||
TGGNGGAGNA TT-TTGTAGC AAAAATCCAA TAATGCTGTA TGNCAAC      797





********************************************************************************
EST sequence   97 +strand (File: 17074557+)

     1  GCTGCATTTA AGATGGTTGA ACCGTTCAAA CTATCAGAAC CTGTACAGGC AGCTATAGCA
    61  AATGGTGTTG CTGGCATGCT GGCGTCTCTT TGTTCACAAT CTGTCTTTGT TCCAATTGAC
   121  ATAGTTAGTC AAAGGTTAAT GGTGCAAGGA TACTCAGGAC ATGCAAGCTA CAATGGAGGC
   181  TTGGATGTTG CTCGCAAAGT TCTGAAGTCA GAAGGTATTC GTGGACTATA TAGAGGATTC
   241  AGTCTATCTG TTCTAACATA CTCCCCATCC AGTGCTGTAT GGTGGGCAAG TTATGGTTCG
   301  AGCCAGCGCT TCATTTGGAG CAAGCTCTTG GATAATGGAA CTGAGCATGG TGGGCCTGCT
   361  CCCAGCCAGG GGAAAATAGT GTCAGTTCAA GCTGCTGGTG GGATCATTGC TGGTGCTACT
   421  GCATCTTGCA TAACAACTCC ATTGGACACC ATTAAAACTC GGTTGCAGGT GATGGGACAC
   481  GACAAGAGAC CTACTGCACG GCAAGTAGTT AAGCAGCTAA TTGCCGAGGA TGGTTGGACA
   541  GGATTTTACA GGGGATTAGG TCCAAGATTT GTCAGCATGT CAGCGTGGGG AACCTCCATG
   601  ATACTTGCCT ATGAATATCT CAAGCGCTTG TGTTCAGTAA ACGAATAGAT TGATGAAAGC
   661  TAGCTGCCAG ACGACTCTTG CAGTAGGGTT TTTATACTAC TGACATACAG TATTGAGAGC
   721  TGGAGATACA AGAACGCGGC TGA

Predicted gene structure (within gDNA segment 7878 to 11787):

 Exon  1   8598   8720 ( 123 n);  cDNA      1    123 ( 123 n); score: 0.699
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.68), Pa: 0.962 (s: 0.74)
 Exon  2   8849   9045 ( 197 n);  cDNA    124    320 ( 197 n); score: 0.772
  Intron  2   9046   9437 ( 392 n); Pd: 0.980 (s: 0.92), Pa: 0.936 (s: 0.45)
 Exon  3   9438   9477 (  40 n);  cDNA    321    357 (  37 n); score: 0.450
  Intron  3   9478   9728 ( 251 n); Pd: 0.869 (s: 0.45), Pa: 0.000 (s: 0.68)
 Exon  4   9729   9839 ( 111 n);  cDNA    358    468 ( 111 n); score: 0.658
  Intron  4   9840  10515 ( 676 n); Pd: 0.994 (s: 0.62), Pa: 1.000 (s: 0.56)
 Exon  5  10516  10669 ( 154 n);  cDNA    469    622 ( 154 n); score: 0.701
  Intron  5  10670  11329 ( 660 n); Pd: 0.961 (s: 0.74), Pa: 0.992 (s:    0)
 Exon  6  11330  11355 (  26 n);  cDNA    623    648 (  26 n); score: 0.692

MATCH	21326110+	17074557+	0.716	651	0.876	C
PGS_21326110+_17074557+	(8598  8720,8849  9045,9438  9477,9729  9839,10516  10669,11330  11355)

Alignment (genomic DNA sequence = upper lines):

GCCTCGCTTA AGCTTGTTGA GCCCTTCAAG CTGTCAGAGC CGGTGCGGGC TGCCTTTGCC     8657
||  |  ||| || | |||||  || |||||  || ||||| | | || | |||  ||  | ||  
GCTGCATTTA AGATGGTTGA ACCGTTCAAA CTATCAGAAC CTGTACAGGC AGCTATAGCA       60


AATGGCCTTG CTGGTCTGTC AGCGTCTACA TGTTCGCAGG CTATTTTTGT TCCAATTGAT     8717
|||||  ||| ||||  ||    ||||||    ||||| ||   || | ||||| |||||||||  
AATGGTGTTG CTGGCATGCT GGCGTCTCTT TGTTCACAAT CTGTCTTTGT TCCAATTGAC      120


GTGGTATGCC TCTCATGTGC CTTCTATGTG ATGTTGTATA GAGAAAAAAT ATCTTACAAT     8777
 |                                                                
ATA....... .......... .......... .......... .......... ..........      123


ATGTTGATGT TAAATGCTAA TTACAATACT AGACTACTGT TTTCATTCTG TTGTGCATTG     8837
                                                                  
.......... .......... .......... .......... .......... ..........      123


GAATGTTTCA GATTAGCCAG AAATTGATGG TTCAAGGATA TTCTGGTAAT GCCAGATACA     8897
             |||| ||  |  || |||| | ||||||||  || ||  || || || |||| 
.......... .GTTAGTCAA AGGTTAATGG TGCAAGGATA CTCAGGACAT GCAAGCTACA      172


AAGGTGGATT AGATGTTGCT CGAAAGGTCA TAAAGGCTGA TGGCATTAGG GGGCTGTACA     8957
| || || ||  ||||||||| || || ||   | ||| | ||  || ||| |  || || || | 
ATGGAGGCTT GGATGTTGCT CGCAAAGTTC TGAAGTCAGA AGGTATTCGT GGACTATATA      232


GAGGATTTGG ACTGTCTGTT ATGACCTATG CTCCATCCAG TGCTGTGTGG TGGGCAAGTT     9017
|||||||  |  || ||||||  | || ||   | |||||||| |||||| ||| |||||||||| 
GAGGATTCAG TCTATCTGTT CTAACATACT CCCCATCCAG TGCTGTATGG TGGGCAAGTT      292


ATGGTTCCAG CCAGCGCATA ATTTGGAGGT TAGCTTATCT GATTGGTTCA TCGTTATGTT     9077
||||||| || ||||||| |  ||||||||                                    
ATGGTTCGAG CCAGCGCTTC ATTTGGAG.. .......... .......... ..........      320


CCTCTCAGCC CTGTGTACTA TGTAATATTT ACGAGAAAAA GACCAGTAAT ACATTTCTAC     9137
                                                                  
.......... .......... .......... .......... .......... ..........      320


TTAATAGTTA TTTGAATTGG TACTTTCCAT CTGTCCAAAA CCTTTTCAAA CTTCCCCTCT     9197
                                                                  
.......... .......... .......... .......... .......... ..........      320


TGATGCTCAA ACTGCAGCTA TAATTGCAAT TTTGTTTTCT GATGCTTGTT CTTCCATGTC     9257
                                                                  
.......... .......... .......... .......... .......... ..........      320


AATATGTACA TATCTTTTTT AGAAAACAAG AATGCATCTC AATGCATGTG CTGTATTGTT     9317
                                                                  
.......... .......... .......... .......... .......... ..........      320


TTGATTAGAT TTATCATAGC GATCAATCAC ATTTTCTTTA CAGATAAAAA TAGTCGGAAG     9377
                                                                  
.......... .......... .......... .......... .......... ..........      320


GATAAGTTGG ATAACTGACC AAAGTGGAAA TATGATCTTA CATATTTTTA TCTCTGGCAG     9437
                                                                  
.......... .......... .......... .......... .......... ..........      320


CTTAGAGAAC TT-AATTACC AACCTGAAAC AATGTGATGA AGTAACTACA CAAAACCACA     9496
|  | ||  | ||  || |    | ||| | | |  |||                           
C--A-AGCTC TTGGATAATG GAACTG-AGC ATGGTGGGCC T......... ..........      357


TATAGTTTCA TGCACTCTGC AAAACTAAAT TGAAACTCTT AGTGTGCTCT TAATGCTGTT     9556
                                                                  
.......... .......... .......... .......... .......... ..........      357


AAGAGGGTGT ATGCAAGTTT ACTGGAATCA GTACCTTTTG TTAGTTTATT TCTTTGTGGT     9616
                                                                  
.......... .......... .......... .......... .......... ..........      357


TGATGGTTGA AAGATTATAT TTCTTGTCTT GATAACTTAG CCAAAATAGT TAACTATTGT     9676
                                                                  
.......... .......... .......... .......... .......... ..........      357


GCTTTTTACA TATTGGAACA GTGCTCTTGG CCATTTGCAT GACAAAGAAG AGGCTCCTAG     9736
                                                         ||||| || 
.......... .......... .......... .......... .......... ..GCTCCCAG      365


CCAATTGAAA CTAGTTGGTG TTCAAGCATC AGGGGGGGTT TTTGCCGGTG CCGTGACCTC     9796
|||   ||||  ||||    | |||||||  |  || ||| |   |||| |||| |     | || 
CCAGGGGAAA ATAGTGTCAG TTCAAGCTGC TGGTGGGATC ATTGCTGGTG CTACTGCATC      425


TTTTGTTACG ACTCCCATAG ATACAATAAA GACCAGGCTG CAGGTACTGT GTGACATTCT     9856
||   | ||  |||||  | | | || || ||  ||  || || |||                   
TTGCATAACA ACTCCATTGG ACACCATTAA AACTCGGTTG CAG....... ..........      468


GTTTGCTGAT TACTCTTGTA ATTTGATTTG TGTGGGTATA TTTTGTGAGG CTTACCCTTG     9916
                                                                  
.......... .......... .......... .......... .......... ..........      468


TGACTTAATG ATTCTTGTCT TTACATTTAT GCTGCTCATT TGCAATAATT TGATTCCTTA     9976
                                                                  
.......... .......... .......... .......... .......... ..........      468


TCAATGCAAT GCCACTAAGT TTAGGGGAAT GGATATTTTG TTTTGGAAGT ATATTTGATG    10036
                                                                  
.......... .......... .......... .......... .......... ..........      468


TCAGACTTGA AGACCTAAAT GTTCTTTTAT ACTGATATTT CCTCCAATGG CGGGCTATTG    10096
                                                                  
.......... .......... .......... .......... .......... ..........      468


AGGTGCTGGA CTGGAATGCT GTCTATATTA AACAATATAT ACTTCTATGT TTACAGCTGT    10156
                                                                  
.......... .......... .......... .......... .......... ..........      468


TTGTTTTCTG CTGACATACC ATGACCAATT TGTCATGGTT TCAGTTATGA GGTCAGAAAA    10216
                                                                  
.......... .......... .......... .......... .......... ..........      468


AAAGAAACTT CCATTGGGAA AACTTGATAT CTATTACTTC ATTATTTATA GTGAGTAACA    10276
                                                                  
.......... .......... .......... .......... .......... ..........      468


AAAGTTAGCA CTTTCAAACT GACTAAAGTA TGCCAGGGAC GTATCATGCA TTTTACAACA    10336
                                                                  
.......... .......... .......... .......... .......... ..........      468


TGCTCCACAT ATCTCCAAAT ATCACATATT ACGCTTGTAG TGGTAAACTG ATAATACATC    10396
                                                                  
.......... .......... .......... .......... .......... ..........      468


TACCAACACT GAAAGTTCTC ACAAGTCAGA ACCCTATATT TGACAGTTGT GGTCTCCCTC    10456
                                                                  
.......... .......... .......... .......... .......... ..........      468


CTTCCCTCTG CATTTGTTGC TACAGATGAT TACACTGAGT TTTGTTTCTT GTCATTTAGG    10516
                                                                | 
.......... .......... .......... .......... .......... .........G      469


TTATGGATAA TGAAAATAAG CCAAAAGCCA GGGAAGTTGT CAAAAGATTG ATTGCTGAAG    10576
| ||||   |  || || |   || |  ||   || |||| ||  ||     |  ||||| || | 
TGATGGGACA CGACAAGAGA CCTACTGCAC GGCAAGTAGT TAAGCAGCTA ATTGCCGAGG      529


ATGGATGGAA AGGTTTGTAC AGAGGGTTGG GTCCAAGATT TTTCAGCTCA TCAGCTTGGG    10636
|||| ||||  ||| || ||| || || || | |||||||||| | |||||    ||||| |||| 
ATGGTTGGAC AGGATTTTAC AGGGGATTAG GTCCAAGATT TGTCAGCATG TCAGCGTGGG      589


GAACCTCAAT GATAGTATGC TACGAGTACC TGAGTATGTT TCGTCTTCCC TTGTCAAATG    10696
||||||| || |||| |   | || || || | | |                              
GAACCTCCAT GATACTTGCC TATGAATATC TCA....... .......... ..........      622


TACACATGCA TATGTAGTGT TATATATCAC TGCATCCCAT GCAGGTTAAT TTTAAGTACC    10756
                                                                  
.......... .......... .......... .......... .......... ..........      622


CAGATACTTC TTCTCATTTA GAATTTAGTT AAAATGACAT CATTCAGGTC AGTTGGCATC    10816
                                                                  
.......... .......... .......... .......... .......... ..........      622


TCCAGTACAC TGCTTTTGTA AGTTGTATCA TAAATCCCAT TTGCAATGAA ATTTTTGACT    10876
                                                                  
.......... .......... .......... .......... .......... ..........      622


CAAGTTGCAG CCTGTAACTT TTCTATATTT TTCGAATAAA GCTATCACCG TACATGAAAC    10936
                                                                  
.......... .......... .......... .......... .......... ..........      622


CTGCTTCTGT TAATGCCAAG GAGCGCACAT TATTTCCTGT AGACCGGCTT GGATGTTGAA    10996
                                                                  
.......... .......... .......... .......... .......... ..........      622


CAATTGGCAC ATGCAAGTAG CAAAGAGCAG CCTTGTGCTT GCAACAATCT GGTCCACCTG    11056
                                                                  
.......... .......... .......... .......... .......... ..........      622


TGGATATGTT CGCTGTGAAA GAAACCAATT AGTCCTTGTA TGAAACATGG TATTAGCGCT    11116
                                                                  
.......... .......... .......... .......... .......... ..........      622


TCATGAATAA AACCACTGAT TCTGATTTCT TATTTTCAAT GAATGGATGG GCATTACCAA    11176
                                                                  
.......... .......... .......... .......... .......... ..........      622


AGTTATCATG ATTAAAGATC TATTTCATAT AAGTTTATTT TTATACATTA GAGTTTATTT    11236
                                                                  
.......... .......... .......... .......... .......... ..........      622


AGAGAACAAG GTATATTTAG TTTTGGTAAT TTTGTGAACT GCACTCAGAC GACTTTGGTA    11296
                                                                  
.......... .......... .......... .......... .......... ..........      622


TTCTTACTGT AATTTTGTTT TGTTTTCCTA CAGAGCGCTT GTGTGCTAAA GTTGAAGAG    11355
                                    ||||||| |||| |   |    ||| ||
.......... .......... .......... ...AGCGCTT GTGTTCAGTA AACGAATAG      648





********************************************************************************
EST sequence  139 -strand (File: 10093099-)

     1  CCTTGGTGGT TTGACGGCGT CTCTGTGCTC GCAGGCCGTG TTTGTGCCCA TTGATGTGGT
    61  TAGCCAGAAA TTGATGGTTC AAGGATATTC TGGTCATGTC AAATATAAGG GTGGAATAGA
   121  TGTTGTTCAA AAGATTATGA AGGCTGACGG GCCACGGGGA CTGTACAGAG GATTTGGCCT
   181  GTCTGTTATG ACGTATGCAC CGTCTAGCGC TGTTTGGTGG GCGAGCTATG GATTCAGCCA
   241  GCGTATAATT TGGAGTGCTC TTGGCCGTTT GAATGATAAA GAAGATACTC CTAGTCAGTT
   301  GAAAATAGTC GGTGTTCAAG CAACAGGGGG AATGATTGCT GGGGCAGTGA CCTCTTGTGT
   361  TTCAACTCCT CTAGATACAA TCAAAACCAG GCTGCAGGTT AATGTAAACA AGCCAAAAGC
   421  CAGTGAGGTA GTTAGAAGAT TGATCGCTGA AGATGGATGG AAAGGTTTTT ACAGAGGGTT
   481  AGGTCCAAGG TTTTTCAGCT CATCTGCCTG GGGTACATCA ATGATCGTAT GCTACGAATA
   541  CTTAAAGCGT GTATGTGCTA AAGTTGAAGA GGTCTGAGTC GCGGGACATC TCCTTATGTG
   601  GTTCCTGCAA AAACGCTGGA ATTTTTGTTA GCCGAAATGC AACAATACTA CAAGAAGACA
   661  TCAGTGACAC CCACCTGAAG CTCTGTTTCT CGCTGACTTG ATAGCTAGAC AGTGGTTCTT
   721  ACAAACTCTG GTGCCCCTGG AGGGTATATT TTTGTTTTGA GAATCTTTGA GGCTTGTATT
   781  ATCTGCCTCT AGTGACAGCG NTATGGATTA GGCAGAATGC TCATATAAAC C

Predicted gene structure (within gDNA segment 8250 to 12020):

 Exon  1   8663   8720 (  58 n);  cDNA      1     58 (  58 n); score: 0.776
  Intron  1   8721   8848 ( 128 n); Pd: 0.857 (s: 0.76), Pa: 0.962 (s: 0.90)
 Exon  2   8849   9045 ( 197 n);  cDNA     59    255 ( 197 n); score: 0.843
  Intron  2   9046   9697 ( 652 n); Pd: 0.980 (s: 0.86), Pa: 0.977 (s: 0.84)
 Exon  3   9698   9839 ( 142 n);  cDNA    256    397 ( 142 n); score: 0.831
  Intron  3   9840  10515 ( 676 n); Pd: 0.994 (s: 0.86), Pa: 1.000 (s: 0.74)
 Exon  4  10516  10669 ( 154 n);  cDNA    398    545 ( 148 n); score: 0.838
  Intron  4  10670  11329 ( 660 n); Pd: 0.961 (s: 0.84), Pa: 0.992 (s: 0.72)
 Exon  5  11330  11438 ( 109 n);  cDNA    546    649 ( 104 n); score: 0.670

MATCH	21326110+	10093099-	0.805	660	0.794	C
PGS_21326110+_10093099-	(8663  8720,8849  9045,9698  9839,10516  10669,11330  11438)

Alignment (genomic DNA sequence = upper lines):

CCTTGCTGGT CTGTCAGCGT CTACATGTTC GCAGGCTATT TTTGTTCCAA TTGATGTGGT     8722
||||| ||||  || | |||| ||   || || ||||||  |  ||||| || | ||||||||   
CCTTGGTGGT TTGACGGCGT CTCTGTGCTC GCAGGCCGTG TTTGTGCCCA TTGATGTG..       58


ATGCCTCTCA TGTGCCTTCT ATGTGATGTT GTATAGAGAA AAAATATCTT ACAATATGTT     8782
                                                                  
.......... .......... .......... .......... .......... ..........       58


GATGTTAAAT GCTAATTACA ATACTAGACT ACTGTTTTCA TTCTGTTGTG CATTGGAATG     8842
                                                                  
.......... .......... .......... .......... .......... ..........       58


TTTCAGATTA GCCAGAAATT GATGGTTCAA GGATATTCTG GTAATGCCAG ATACAAAGGT     8902
       ||| |||||||||| |||||||||| |||||||||| || ||| ||  ||| || ||| 
......GTTA GCCAGAAATT GATGGTTCAA GGATATTCTG GTCATGTCAA ATATAAGGGT      112


GGATTAGATG TTGCTCGAAA GGTCATAAAG GCTGATGGCA TTAGGGGGCT GTACAGAGGA     8962
||| |||||| ||| || ||| | | || ||| ||||| ||      |||| || |||||||||| 
GGAATAGATG TTGTTCAAAA GATTATGAAG GCTGACGGGC CACGGGGACT GTACAGAGGA      172


TTTGGACTGT CTGTTATGAC CTATGCTCCA TCCAGTGCTG TGTGGTGGGC AAGTTATGGT     9022
||||| |||| ||||||||||  ||||| ||  || || |||| | ||||||||  || |||||  
TTTGGCCTGT CTGTTATGAC GTATGCACCG TCTAGCGCTG TTTGGTGGGC GAGCTATGGA      232


TCCAGCCAGC GCATAATTTG GAGGTTAGCT TATCTGATTG GTTCATCGTT ATGTTCCTCT     9082
| |||||||| | |||||||| |||                                         
TTCAGCCAGC GTATAATTTG GAG....... .......... .......... ..........      255


CAGCCCTGTG TACTATGTAA TATTTACGAG AAAAAGACCA GTAATACATT TCTACTTAAT     9142
                                                                  
.......... .......... .......... .......... .......... ..........      255


AGTTATTTGA ATTGGTACTT TCCATCTGTC CAAAACCTTT TCAAACTTCC CCTCTTGATG     9202
                                                                  
.......... .......... .......... .......... .......... ..........      255


CTCAAACTGC AGCTATAATT GCAATTTTGT TTTCTGATGC TTGTTCTTCC ATGTCAATAT     9262
                                                                  
.......... .......... .......... .......... .......... ..........      255


GTACATATCT TTTTTAGAAA ACAAGAATGC ATCTCAATGC ATGTGCTGTA TTGTTTTGAT     9322
                                                                  
.......... .......... .......... .......... .......... ..........      255


TAGATTTATC ATAGCGATCA ATCACATTTT CTTTACAGAT AAAAATAGTC GGAAGGATAA     9382
                                                                  
.......... .......... .......... .......... .......... ..........      255


GTTGGATAAC TGACCAAAGT GGAAATATGA TCTTACATAT TTTTATCTCT GGCAGCTTAG     9442
                                                                  
.......... .......... .......... .......... .......... ..........      255


AGAACTTAAT TACCAACCTG AAACAATGTG ATGAAGTAAC TACACAAAAC CACATATAGT     9502
                                                                  
.......... .......... .......... .......... .......... ..........      255


TTCATGCACT CTGCAAAACT AAATTGAAAC TCTTAGTGTG CTCTTAATGC TGTTAAGAGG     9562
                                                                  
.......... .......... .......... .......... .......... ..........      255


GTGTATGCAA GTTTACTGGA ATCAGTACCT TTTGTTAGTT TATTTCTTTG TGGTTGATGG     9622
                                                                  
.......... .......... .......... .......... .......... ..........      255


TTGAAAGATT ATATTTCTTG TCTTGATAAC TTAGCCAAAA TAGTTAACTA TTGTGCTTTT     9682
                                                                  
.......... .......... .......... .......... .......... ..........      255


TACATATTGG AACAGTGCTC TTGGCCATTT GCATGACAAA GAAGAGGCTC CTAGCCAATT     9742
                ||||| |||||| ||| | |||| ||| |||||  ||| |||| || || 
.......... .....TGCTC TTGGCCGTTT GAATGATAAA GAAGATACTC CTAGTCAGTT      300


GAAACTAGTT GGTGTTCAAG CATCAGGGGG GGTTTTTGCC GGTGCCGTGA CCTCTTTTGT     9802
|||| ||||  |||||||||| || |||||||   |  ||||  || || |||| |||||| ||| 
GAAAATAGTC GGTGTTCAAG CAACAGGGGG AATGATTGCT GGGGCAGTGA CCTCTTGTGT      360


TACGACTCCC ATAGATACAA TAAAGACCAG GCTGCAGGTA CTGTGTGACA TTCTGTTTGC     9862
| | |||||   ||||||||| | || ||||| |||||||                          
TTCAACTCCT CTAGATACAA TCAAAACCAG GCTGCAG... .......... ..........      397


TGATTACTCT TGTAATTTGA TTTGTGTGGG TATATTTTGT GAGGCTTACC CTTGTGACTT     9922
                                                                  
.......... .......... .......... .......... .......... ..........      397


AATGATTCTT GTCTTTACAT TTATGCTGCT CATTTGCAAT AATTTGATTC CTTATCAATG     9982
                                                                  
.......... .......... .......... .......... .......... ..........      397


CAATGCCACT AAGTTTAGGG GAATGGATAT TTTGTTTTGG AAGTATATTT GATGTCAGAC    10042
                                                                  
.......... .......... .......... .......... .......... ..........      397


TTGAAGACCT AAATGTTCTT TTATACTGAT ATTTCCTCCA ATGGCGGGCT ATTGAGGTGC    10102
                                                                  
.......... .......... .......... .......... .......... ..........      397


TGGACTGGAA TGCTGTCTAT ATTAAACAAT ATATACTTCT ATGTTTACAG CTGTTTGTTT    10162
                                                                  
.......... .......... .......... .......... .......... ..........      397


TCTGCTGACA TACCATGACC AATTTGTCAT GGTTTCAGTT ATGAGGTCAG AAAAAAAGAA    10222
                                                                  
.......... .......... .......... .......... .......... ..........      397


ACTTCCATTG GGAAAACTTG ATATCTATTA CTTCATTATT TATAGTGAGT AACAAAAGTT    10282
                                                                  
.......... .......... .......... .......... .......... ..........      397


AGCACTTTCA AACTGACTAA AGTATGCCAG GGACGTATCA TGCATTTTAC AACATGCTCC    10342
                                                                  
.......... .......... .......... .......... .......... ..........      397


ACATATCTCC AAATATCACA TATTACGCTT GTAGTGGTAA ACTGATAATA CATCTACCAA    10402
                                                                  
.......... .......... .......... .......... .......... ..........      397


CACTGAAAGT TCTCACAAGT CAGAACCCTA TATTTGACAG TTGTGGTCTC CCTCCTTCCC    10462
                                                                  
.......... .......... .......... .......... .......... ..........      397


TCTGCATTTG TTGCTACAGA TGATTACACT GAGTTTTGTT TCTTGTCATT TAGGTTATGG    10522
                                                          |   |   
.......... .......... .......... .......... .......... ...G---T--      399


ATAATGAAAA TAAGCCAAAA GCCAGGGAAG TTGTCAAAAG ATTGATTGCT GAAGATGGAT    10582
 ||||| |||  ||||||||| ||||| || | | || | ||| |||||| ||| |||||||||| 
-TAATGTAAA CAAGCCAAAA GCCAGTGAGG TAGTTAGAAG ATTGATCGCT GAAGATGGAT      458


GGAAAGGTTT GTACAGAGGG TTGGGTCCAA GATTTTTCAG CTCATCAGCT TGGGGAACCT    10642
||||||||||  ||||||||| || ||||||| | |||||||| |||||| ||  ||||| || | 
GGAAAGGTTT TTACAGAGGG TTAGGTCCAA GGTTTTTCAG CTCATCTGCC TGGGGTACAT      518


CAATGATAGT ATGCTACGAG TACCTGAGTA TGTTTCGTCT TCCCTTGTCA AATGTACACA    10702
||||||| || |||||||||  ||| | |                                     
CAATGATCGT ATGCTACGAA TACTTAA... .......... .......... ..........      545


TGCATATGTA GTGTTATATA TCACTGCATC CCATGCAGGT TAATTTTAAG TACCCAGATA    10762
                                                                  
.......... .......... .......... .......... .......... ..........      545


CTTCTTCTCA TTTAGAATTT AGTTAAAATG ACATCATTCA GGTCAGTTGG CATCTCCAGT    10822
                                                                  
.......... .......... .......... .......... .......... ..........      545


ACACTGCTTT TGTAAGTTGT ATCATAAATC CCATTTGCAA TGAAATTTTT GACTCAAGTT    10882
                                                                  
.......... .......... .......... .......... .......... ..........      545


GCAGCCTGTA ACTTTTCTAT ATTTTTCGAA TAAAGCTATC ACCGTACATG AAACCTGCTT    10942
                                                                  
.......... .......... .......... .......... .......... ..........      545


CTGTTAATGC CAAGGAGCGC ACATTATTTC CTGTAGACCG GCTTGGATGT TGAACAATTG    11002
                                                                  
.......... .......... .......... .......... .......... ..........      545


GCACATGCAA GTAGCAAAGA GCAGCCTTGT GCTTGCAACA ATCTGGTCCA CCTGTGGATA    11062
                                                                  
.......... .......... .......... .......... .......... ..........      545


TGTTCGCTGT GAAAGAAACC AATTAGTCCT TGTATGAAAC ATGGTATTAG CGCTTCATGA    11122
                                                                  
.......... .......... .......... .......... .......... ..........      545


ATAAAACCAC TGATTCTGAT TTCTTATTTT CAATGAATGG ATGGGCATTA CCAAAGTTAT    11182
                                                                  
.......... .......... .......... .......... .......... ..........      545


CATGATTAAA GATCTATTTC ATATAAGTTT ATTTTTATAC ATTAGAGTTT ATTTAGAGAA    11242
                                                                  
.......... .......... .......... .......... .......... ..........      545


CAAGGTATAT TTAGTTTTGG TAATTTTGTG AACTGCACTC AGACGACTTT GGTATTCTTA    11302
                                                                  
.......... .......... .......... .......... .......... ..........      545


CTGTAATTTT GTTTTGTTTT CCTACAGAGC GCTTGTGTGC TAAAGTTGAA GAGGTCTGAT    11362
                             ||| |  | ||||| |||||||||| |||||||||  
.......... .......... .......AGC GTGTATGTGC TAAAGTTGAA GAGGTCTGA-      577


TTCTGAGCTG CCTTAAACTC AGAACGCAAT TCCTACAATT CTGGAAGTTT TGTATTAGCA    11422
 || | |  |  | |   ||  |    |     | | | ||   |||||| ||| | | |||||  
GTC-GCG-GG ACATCTCCTT ATGTGGTTCC TGCAAAAACG CTGGAA-TTT T-TGTTAGCC      633


GAAGTGTAAT AATGCT    11438
||| || ||  ||| ||
GAAATGCAAC AATACT      649





********************************************************************************
EST sequence   28 +strand (File: 18260535+)

     1  CTCAGGACAT GCAAGCTACA ATGGAGGCTT GGATGTTGCT CGCAAAGTTC TGAAGTCAGA
    61  AGGTATACGT GGACTATATA GAGGATTCAG TCTGTCTGTT CTAACATACT CCCCATCCAG
   121  TGCTGTATGG TGGGCAAGTT ATGGTTCGAG CCAGCGCTTC ATATGGAGCA AGCTCTTGGA
   181  TAATGGAACT GAGCATGGTG GGCCTGCTCC CAGCCAGGGG AAAATAGTGT CAGTTCAAGC
   241  TGCTGGTGGG ATCATCGCCG GTGCTACTGC ATCTTGCATA ACAACTCCAT TGGACACCAT
   301  TAAAACTAGG TTGCAGGTGA TGGGACACGA TAAGAGACCT AGTGCAGGGC AAGTAGTTAA
   361  GCAGCTAATT GCTGAGGATG GTTGGACAGG ATTTTACAGG GGATTAGGTC CAAGATTTGT
   421  CAGCATGTCA GCGTGGGGAA CCTCCATGAT ACTTGCCTAT GAATATCTCA AGCGCTTGTG
   481  TGCAGTAAAC GAATAGATTG ATGAAAGCTA GCTGCCAGAC GACTCTTGCG GTAGGATTTT
   541  TATACTACTG ACATACAGTA TTTGAGAGCT GGAGATAACA AGACCGCGGC TG

Predicted gene structure (within gDNA segment 8130 to 12192):

 Exon  1   8878   9045 ( 168 n);  cDNA      1    168 ( 168 n); score: 0.768
  Intron  1   9046   9437 ( 392 n); Pd: 0.980 (s: 0.90), Pa: 0.936 (s: 0.45)
 Exon  2   9438   9477 (  40 n);  cDNA    169    205 (  37 n); score: 0.450
  Intron  2   9478   9728 ( 251 n); Pd: 0.869 (s: 0.45), Pa: 0.000 (s: 0.68)
 Exon  3   9729   9839 ( 111 n);  cDNA    206    316 ( 111 n); score: 0.667
  Intron  3   9840  10515 ( 676 n); Pd: 0.994 (s: 0.64), Pa: 1.000 (s: 0.56)
 Exon  4  10516  10669 ( 154 n);  cDNA    317    470 ( 154 n); score: 0.708
  Intron  4  10670  11329 ( 660 n); Pd: 0.961 (s: 0.74), Pa: 0.992 (s:    0)
 Exon  5  11330  11355 (  26 n);  cDNA    471    496 (  26 n); score: 0.731

MATCH	21326110+	18260535+	0.721	499	0.843	C
PGS_21326110+_18260535+	(8878  9045,9438  9477,9729  9839,10516  10669,11330  11355)

Alignment (genomic DNA sequence = upper lines):

TTCTGGTAAT GCCAGATACA AAGGTGGATT AGATGTTGCT CGAAAGGTCA TAAAGGCTGA     8937
 || ||  || || || |||| | || || ||  ||||||||| || || ||   | ||| | || 
CTCAGGACAT GCAAGCTACA ATGGAGGCTT GGATGTTGCT CGCAAAGTTC TGAAGTCAGA       60


TGGCATTAGG GGGCTGTACA GAGGATTTGG ACTGTCTGTT ATGACCTATG CTCCATCCAG     8997
 || ||  |  || || || | |||||||  |  |||||||||  | || ||   | |||||||| 
AGGTATACGT GGACTATATA GAGGATTCAG TCTGTCTGTT CTAACATACT CCCCATCCAG      120


TGCTGTGTGG TGGGCAAGTT ATGGTTCCAG CCAGCGCATA ATTTGGAGGT TAGCTTATCT     9057
|||||| ||| |||||||||| ||||||| || ||||||| |  || |||||              
TGCTGTATGG TGGGCAAGTT ATGGTTCGAG CCAGCGCTTC ATATGGAG.. ..........      168


GATTGGTTCA TCGTTATGTT CCTCTCAGCC CTGTGTACTA TGTAATATTT ACGAGAAAAA     9117
                                                                  
.......... .......... .......... .......... .......... ..........      168


GACCAGTAAT ACATTTCTAC TTAATAGTTA TTTGAATTGG TACTTTCCAT CTGTCCAAAA     9177
                                                                  
.......... .......... .......... .......... .......... ..........      168


CCTTTTCAAA CTTCCCCTCT TGATGCTCAA ACTGCAGCTA TAATTGCAAT TTTGTTTTCT     9237
                                                                  
.......... .......... .......... .......... .......... ..........      168


GATGCTTGTT CTTCCATGTC AATATGTACA TATCTTTTTT AGAAAACAAG AATGCATCTC     9297
                                                                  
.......... .......... .......... .......... .......... ..........      168


AATGCATGTG CTGTATTGTT TTGATTAGAT TTATCATAGC GATCAATCAC ATTTTCTTTA     9357
                                                                  
.......... .......... .......... .......... .......... ..........      168


CAGATAAAAA TAGTCGGAAG GATAAGTTGG ATAACTGACC AAAGTGGAAA TATGATCTTA     9417
                                                                  
.......... .......... .......... .......... .......... ..........      168


CATATTTTTA TCTCTGGCAG CTTAGAGAAC TT-AATTACC AACCTGAAAC AATGTGATGA     9476
                      |  | ||  | ||  || |    | ||| | | |  |||     
.......... .......... C--A-AGCTC TTGGATAATG GAACTG-AGC ATGGTGGGCC      204


AGTAACTACA CAAAACCACA TATAGTTTCA TGCACTCTGC AAAACTAAAT TGAAACTCTT     9536
                                                                  
T......... .......... .......... .......... .......... ..........      205


AGTGTGCTCT TAATGCTGTT AAGAGGGTGT ATGCAAGTTT ACTGGAATCA GTACCTTTTG     9596
                                                                  
.......... .......... .......... .......... .......... ..........      205


TTAGTTTATT TCTTTGTGGT TGATGGTTGA AAGATTATAT TTCTTGTCTT GATAACTTAG     9656
                                                                  
.......... .......... .......... .......... .......... ..........      205


CCAAAATAGT TAACTATTGT GCTTTTTACA TATTGGAACA GTGCTCTTGG CCATTTGCAT     9716
                                                                  
.......... .......... .......... .......... .......... ..........      205


GACAAAGAAG AGGCTCCTAG CCAATTGAAA CTAGTTGGTG TTCAAGCATC AGGGGGGGTT     9776
             ||||| || |||   ||||  ||||    | |||||||  |  || ||| |  
.......... ..GCTCCCAG CCAGGGGAAA ATAGTGTCAG TTCAAGCTGC TGGTGGGATC      253


TTTGCCGGTG CCGTGACCTC TTTTGTTACG ACTCCCATAG ATACAATAAA GACCAGGCTG     9836
 | ||||||| |     | || ||   | ||  |||||  | | | || || ||  || ||| || 
ATCGCCGGTG CTACTGCATC TTGCATAACA ACTCCATTGG ACACCATTAA AACTAGGTTG      313


CAGGTACTGT GTGACATTCT GTTTGCTGAT TACTCTTGTA ATTTGATTTG TGTGGGTATA     9896
|||                                                               
CAG....... .......... .......... .......... .......... ..........      316


TTTTGTGAGG CTTACCCTTG TGACTTAATG ATTCTTGTCT TTACATTTAT GCTGCTCATT     9956
                                                                  
.......... .......... .......... .......... .......... ..........      316


TGCAATAATT TGATTCCTTA TCAATGCAAT GCCACTAAGT TTAGGGGAAT GGATATTTTG    10016
                                                                  
.......... .......... .......... .......... .......... ..........      316


TTTTGGAAGT ATATTTGATG TCAGACTTGA AGACCTAAAT GTTCTTTTAT ACTGATATTT    10076
                                                                  
.......... .......... .......... .......... .......... ..........      316


CCTCCAATGG CGGGCTATTG AGGTGCTGGA CTGGAATGCT GTCTATATTA AACAATATAT    10136
                                                                  
.......... .......... .......... .......... .......... ..........      316


ACTTCTATGT TTACAGCTGT TTGTTTTCTG CTGACATACC ATGACCAATT TGTCATGGTT    10196
                                                                  
.......... .......... .......... .......... .......... ..........      316


TCAGTTATGA GGTCAGAAAA AAAGAAACTT CCATTGGGAA AACTTGATAT CTATTACTTC    10256
                                                                  
.......... .......... .......... .......... .......... ..........      316


ATTATTTATA GTGAGTAACA AAAGTTAGCA CTTTCAAACT GACTAAAGTA TGCCAGGGAC    10316
                                                                  
.......... .......... .......... .......... .......... ..........      316


GTATCATGCA TTTTACAACA TGCTCCACAT ATCTCCAAAT ATCACATATT ACGCTTGTAG    10376
                                                                  
.......... .......... .......... .......... .......... ..........      316


TGGTAAACTG ATAATACATC TACCAACACT GAAAGTTCTC ACAAGTCAGA ACCCTATATT    10436
                                                                  
.......... .......... .......... .......... .......... ..........      316


TGACAGTTGT GGTCTCCCTC CTTCCCTCTG CATTTGTTGC TACAGATGAT TACACTGAGT    10496
                                                                  
.......... .......... .......... .......... .......... ..........      316


TTTGTTTCTT GTCATTTAGG TTATGGATAA TGAAAATAAG CCAAAAGCCA GGGAAGTTGT    10556
                    | | ||||   |  || || |   || |  ||   || |||| || 
.......... .........G TGATGGGACA CGATAAGAGA CCTAGTGCAG GGCAAGTAGT      357


CAAAAGATTG ATTGCTGAAG ATGGATGGAA AGGTTTGTAC AGAGGGTTGG GTCCAAGATT    10616
 ||     |  |||||||| | |||| ||||  ||| || ||| || || || | |||||||||| 
TAAGCAGCTA ATTGCTGAGG ATGGTTGGAC AGGATTTTAC AGGGGATTAG GTCCAAGATT      417


TTTCAGCTCA TCAGCTTGGG GAACCTCAAT GATAGTATGC TACGAGTACC TGAGTATGTT    10676
| |||||    ||||| |||| ||||||| || |||| |   | || || || | | |        
TGTCAGCATG TCAGCGTGGG GAACCTCCAT GATACTTGCC TATGAATATC TCA.......      470


TCGTCTTCCC TTGTCAAATG TACACATGCA TATGTAGTGT TATATATCAC TGCATCCCAT    10736
                                                                  
.......... .......... .......... .......... .......... ..........      470


GCAGGTTAAT TTTAAGTACC CAGATACTTC TTCTCATTTA GAATTTAGTT AAAATGACAT    10796
                                                                  
.......... .......... .......... .......... .......... ..........      470


CATTCAGGTC AGTTGGCATC TCCAGTACAC TGCTTTTGTA AGTTGTATCA TAAATCCCAT    10856
                                                                  
.......... .......... .......... .......... .......... ..........      470


TTGCAATGAA ATTTTTGACT CAAGTTGCAG CCTGTAACTT TTCTATATTT TTCGAATAAA    10916
                                                                  
.......... .......... .......... .......... .......... ..........      470


GCTATCACCG TACATGAAAC CTGCTTCTGT TAATGCCAAG GAGCGCACAT TATTTCCTGT    10976
                                                                  
.......... .......... .......... .......... .......... ..........      470


AGACCGGCTT GGATGTTGAA CAATTGGCAC ATGCAAGTAG CAAAGAGCAG CCTTGTGCTT    11036
                                                                  
.......... .......... .......... .......... .......... ..........      470


GCAACAATCT GGTCCACCTG TGGATATGTT CGCTGTGAAA GAAACCAATT AGTCCTTGTA    11096
                                                                  
.......... .......... .......... .......... .......... ..........      470


TGAAACATGG TATTAGCGCT TCATGAATAA AACCACTGAT TCTGATTTCT TATTTTCAAT    11156
                                                                  
.......... .......... .......... .......... .......... ..........      470


GAATGGATGG GCATTACCAA AGTTATCATG ATTAAAGATC TATTTCATAT AAGTTTATTT    11216
                                                                  
.......... .......... .......... .......... .......... ..........      470


TTATACATTA GAGTTTATTT AGAGAACAAG GTATATTTAG TTTTGGTAAT TTTGTGAACT    11276
                                                                  
.......... .......... .......... .......... .......... ..........      470


GCACTCAGAC GACTTTGGTA TTCTTACTGT AATTTTGTTT TGTTTTCCTA CAGAGCGCTT    11336
                                                          ||||||| 
.......... .......... .......... .......... .......... ...AGCGCTT      477


GTGTGCTAAA GTTGAAGAG    11355
||||||   |    ||| ||
GTGTGCAGTA AACGAATAG      496





********************************************************************************
EST sequence  136 -strand (File: 14528874-)

     1  CGTTTGAATG ATAAAGAAGA TACTCCTAGT CAGTTGAAAA TAGTCGGTGT TCAAGCAACA
    61  GGGGGAATGG TTGCTGGGGC AGTGACCTCT TGTGTTTCAA CTCCTCTAGA TACAATCAAA
   121  ACCAGGCTGC AGGTTAATAT CAACAAGCCA AAAGCCAGTG AAGTAGTTAG AAGATTGATC
   181  GCTGAAGATG GATGGAAAGG TTTCTACAGA GGGTTAGGCC CAAGGTTTTT CAGCTCATCT
   241  GCTTGGGGTA CATCAATGAT CGTATGCTAC GAATACCTAA AGCGTGTATG TGCTAAAGTT
   301  GAAGAGGCCT GAGTCGCCCG ACATCTCCTT ATGTGGTTCC TGCAAAAAAC GCTGGAAGTT
   361  TTGTTGGTAG CCTAAAAGCA ACAATACTAC AAGAAGGCAT CGGTGACACC CACTGAAGCT
   421  CTGTTTCTCG CTGACTTGAT AGCTAGACAG TGGTTCTTAC AAGCTTTGGT GCCCCTGGAG
   481  GGTATTTTTT TTGGCGGAAT ATTTGAGGCT CGTATTAGCT GCTGCCTCTA GTGACAGCTA
   541  TGGGTTAGGC AGAATGCTCA TATAAACCAA GAGATCAGAT GTATTCAATT TCTATTCTTT
   601  TGAACTCCAA GGCTTTGTTA TGGTGAGTCT GGTCGATTGG GGCCAGTTGT AATGACACGT
   661  GAGGGGCAAG CTTCGCATTT

Predicted gene structure (within gDNA segment 9223 to 12155):

 Exon  1   9708   9839 ( 132 n);  cDNA      1    132 ( 132 n); score: 0.818
  Intron  1   9840  10515 ( 676 n); Pd: 0.994 (s: 0.86), Pa: 1.000 (s: 0.76)
 Exon  2  10516  10669 ( 154 n);  cDNA    133    280 ( 148 n); score: 0.851
  Intron  2  10670  11329 ( 660 n); Pd: 0.961 (s: 0.88), Pa: 0.992 (s: 0.70)
 Exon  3  11330  11474 ( 145 n);  cDNA    281    421 ( 141 n); score: 0.559
  Intron  3  11475  11504 (  30 n); Pd: 0.443 (s: 0.46), Pa: 0.000 (s: 0.71) ??
 Exon  4  11505  11742 ( 238 n);  cDNA    422    659 ( 238 n); score: 0.626

MATCH	21326110+	14528874-	0.701	669	0.984	C
PGS_21326110+_14528874-	(9708  9839,10516  10669,11330  11474,11505  11742)

Alignment (genomic DNA sequence = upper lines):

CATTTGCATG ACAAAGAAGA GGCTCCTAGC CAATTGAAAC TAGTTGGTGT TCAAGCATCA     9767
| |||| ||| | ||||||||   |||||||  || ||||||  |||| ||||| ||||||| || 
CGTTTGAATG ATAAAGAAGA TACTCCTAGT CAGTTGAAAA TAGTCGGTGT TCAAGCAACA       60


GGGGGGGTTT TTGCCGGTGC CGTGACCTCT TTTGTTACGA CTCCCATAGA TACAATAAAG     9827
|||||  |   |||| || ||  ||||||||| | |||| | | ||||  |||| |||||| ||  
GGGGGAATGG TTGCTGGGGC AGTGACCTCT TGTGTTTCAA CTCCTCTAGA TACAATCAAA      120


ACCAGGCTGC AGGTACTGTG TGACATTCTG TTTGCTGATT ACTCTTGTAA TTTGATTTGT     9887
|||||||||| ||                                                     
ACCAGGCTGC AG........ .......... .......... .......... ..........      132


GTGGGTATAT TTTGTGAGGC TTACCCTTGT GACTTAATGA TTCTTGTCTT TACATTTATG     9947
                                                                  
.......... .......... .......... .......... .......... ..........      132


CTGCTCATTT GCAATAATTT GATTCCTTAT CAATGCAATG CCACTAAGTT TAGGGGAATG    10007
                                                                  
.......... .......... .......... .......... .......... ..........      132


GATATTTTGT TTTGGAAGTA TATTTGATGT CAGACTTGAA GACCTAAATG TTCTTTTATA    10067
                                                                  
.......... .......... .......... .......... .......... ..........      132


CTGATATTTC CTCCAATGGC GGGCTATTGA GGTGCTGGAC TGGAATGCTG TCTATATTAA    10127
                                                                  
.......... .......... .......... .......... .......... ..........      132


ACAATATATA CTTCTATGTT TACAGCTGTT TGTTTTCTGC TGACATACCA TGACCAATTT    10187
                                                                  
.......... .......... .......... .......... .......... ..........      132


GTCATGGTTT CAGTTATGAG GTCAGAAAAA AAGAAACTTC CATTGGGAAA ACTTGATATC    10247
                                                                  
.......... .......... .......... .......... .......... ..........      132


TATTACTTCA TTATTTATAG TGAGTAACAA AAGTTAGCAC TTTCAAACTG ACTAAAGTAT    10307
                                                                  
.......... .......... .......... .......... .......... ..........      132


GCCAGGGACG TATCATGCAT TTTACAACAT GCTCCACATA TCTCCAAATA TCACATATTA    10367
                                                                  
.......... .......... .......... .......... .......... ..........      132


CGCTTGTAGT GGTAAACTGA TAATACATCT ACCAACACTG AAAGTTCTCA CAAGTCAGAA    10427
                                                                  
.......... .......... .......... .......... .......... ..........      132


CCCTATATTT GACAGTTGTG GTCTCCCTCC TTCCCTCTGC ATTTGTTGCT ACAGATGATT    10487
                                                                  
.......... .......... .......... .......... .......... ..........      132


ACACTGAGTT TTGTTTCTTG TCATTTAGGT TATGGATAAT GAAAATAAGC CAAAAGCCAG    10547
                              || ||   || ||    || |||| |||||||||| 
.......... .......... ........GT TA---AT-AT --CAACAAGC CAAAAGCCAG      158


GGAAGTTGTC AAAAGATTGA TTGCTGAAGA TGGATGGAAA GGTTTGTACA GAGGGTTGGG    10607
 ||||| ||  | |||||||| | |||||||| |||||||||| ||||| |||| ||||||| || 
TGAAGTAGTT AGAAGATTGA TCGCTGAAGA TGGATGGAAA GGTTTCTACA GAGGGTTAGG      218


TCCAAGATTT TTCAGCTCAT CAGCTTGGGG AACCTCAATG ATAGTATGCT ACGAGTACCT    10667
 ||||| ||| |||||||||| | ||||||||  || |||||| || ||||||| |||| ||||| 
CCCAAGGTTT TTCAGCTCAT CTGCTTGGGG TACATCAATG ATCGTATGCT ACGAATACCT      278


GAGTATGTTT CGTCTTCCCT TGTCAAATGT ACACATGCAT ATGTAGTGTT ATATATCACT    10727
 |                                                                
AA........ .......... .......... .......... .......... ..........      280


GCATCCCATG CAGGTTAATT TTAAGTACCC AGATACTTCT TCTCATTTAG AATTTAGTTA    10787
                                                                  
.......... .......... .......... .......... .......... ..........      280


AAATGACATC ATTCAGGTCA GTTGGCATCT CCAGTACACT GCTTTTGTAA GTTGTATCAT    10847
                                                                  
.......... .......... .......... .......... .......... ..........      280


AAATCCCATT TGCAATGAAA TTTTTGACTC AAGTTGCAGC CTGTAACTTT TCTATATTTT    10907
                                                                  
.......... .......... .......... .......... .......... ..........      280


TCGAATAAAG CTATCACCGT ACATGAAACC TGCTTCTGTT AATGCCAAGG AGCGCACATT    10967
                                                                  
.......... .......... .......... .......... .......... ..........      280


ATTTCCTGTA GACCGGCTTG GATGTTGAAC AATTGGCACA TGCAAGTAGC AAAGAGCAGC    11027
                                                                  
.......... .......... .......... .......... .......... ..........      280


CTTGTGCTTG CAACAATCTG GTCCACCTGT GGATATGTTC GCTGTGAAAG AAACCAATTA    11087
                                                                  
.......... .......... .......... .......... .......... ..........      280


GTCCTTGTAT GAAACATGGT ATTAGCGCTT CATGAATAAA ACCACTGATT CTGATTTCTT    11147
                                                                  
.......... .......... .......... .......... .......... ..........      280


ATTTTCAATG AATGGATGGG CATTACCAAA GTTATCATGA TTAAAGATCT ATTTCATATA    11207
                                                                  
.......... .......... .......... .......... .......... ..........      280


AGTTTATTTT TATACATTAG AGTTTATTTA GAGAACAAGG TATATTTAGT TTTGGTAATT    11267
                                                                  
.......... .......... .......... .......... .......... ..........      280


TTGTGAACTG CACTCAGACG ACTTTGGTAT TCTTACTGTA ATTTTGTTTT GTTTTCCTAC    11327
                                                                  
.......... .......... .......... .......... .......... ..........      280


AGAGCGCTTG TGTGCTAAAG TTGAAGAGGT CTGATTTCTG AGCTGCCTTA AACTCA-GAA    11386
  ||||  |  |||||||||| |||||||||  ||||  || |   | | | |    || | |   
..AGCGTGTA TGTGCTAAAG TTGAAGAGGC CTGA-GTC-G -CCCGACATC TCCTTATGTG      335


CGCAATTCCT ACAATTCTGG AAGTTTTG-T ATTAGCAGAA GTGTAATAAT GCTGTACACC    11445
     | |   | ||  |||| |||||||| |   ||||  ||   | || |||  |  ||||   
GTTCCTGCAA AAAACGCTGG AAGTTTTGTT GGTAGCCTAA AAGCAACAAT AC--TACAAG      393


AACGGAAGCT TCAGTTCTTG CTGACATAGG TGAAAGTATT AAACATGGAT GTTTGATGGT    11505
|| || | |        |    ||||                                      | 
AA-GGCATCG GTGACACCCA CTGAAGCTC. .......... .......... .........T      422


GTTAAAGACG TCATTTGAT- GCTAGACAAT AGTCCTTACA AACTTTGGT- TCTCT-GAGC    11562
|||     |  | | |||||  |||||||| |  || |||||| | |||||||   | || |||  
GTTTCTCGC- TGACTTGATA GCTAGACAGT GGTTCTTACA AGCTTTGGTG CCCCTGGAGG      481


AGAGTATTCT CAAAAAAAT- GCAGGGGCCT ATATTTTTTT TTGCCTCTTA TGCTGAATAT    11621
  | | || |       |||     | |||    ||||   |   |||||||   ||     ||| 
GTATTTTTTT TGGCGGAATA TTTGAGGCTC GTATTAGCTG CTGCCTCTAG TGACAGCTAT      541


GGATTAGGCT GATCATTTTA GATGAATATA AACGAGATCA GATGTACACA TTTATCATTC    11681
|| ||||||  ||  ||  |   ||  | |   || ||||||| ||||||  ||  ||   |||| 
GGGTTAGGCA GA--ATGCT- CATATAAACC AA-GAGATCA GATGTATTCA ATTTCTATTC      597


TTTTATACGT GAAGGC-TTG TTTTAGCGAG GCTGGATGAT TGAGACCAGT TGTAATGACA    11740
||||  ||    ||||| ||| || | | |||  ||||  ||| || | ||||| |||||||||| 
TTTTGAACTC CAAGGCTTTG TTATGGTGAG TCTGGTCGAT TGGGGCCAGT TGTAATGACA      657


TG    11742
 |
CG      659





********************************************************************************
EST sequence  108 -strand (File: 24768712-)

     1  CAATTGAAAA TAGTTGGTGT TCAAGCATCA GGGGGGATTT TTGCTGGTGC TGTGCCCTCT
    61  TTTGTTACGA CTCCCATAGA TACAATCAAG ACCAGGCTGC AGGTTATGGA TAATGAAAAT
   121  AAGCCAAAAG CTGGGGAAGT TGTTAAAAGA TTGATCGCTG AAGATGGATG GAAAGGTTTG
   181  TACAGAGGGT TGGGTCCAAG ATTTTTCAGC TCATCAGCTT GGGGTCCCTC AATGATAGTA
   241  TGCTACGAGT ACCTGAAGCG CTTGTGTGCT AAAGTTGAAG AGGTCTGACT TCTGTTCTTA
   301  CTATTCTGGA AGTTTTGTAT TAGAAGAAGT GAAATAATGC TGTATGTCGA CAACATTGAC
   361  ACCACCGGAA GCTTCAGTTC TTGCTGACGT AGGTGAAAGC ATTCAACATG GATGTTTGAT
   421  GGTGTACTTC ATTTGGTGCT AGACAATAGT CTTTACAAAC TTTGCTTCTC TGGGCTATAT
   481  CTCAAAAAAT GTAGGGCCCT ATATTTTTTT GCTCATATGA TGAATATGGG TTTGGCGGAT
   541  TATTTTAGGT GAGTATAAAC GATATCAGAT GTACACACTT CTCATTCTTT TATACATGAA
   601  GGCTATTTTA GCGAGGCTGT ATGATTATGA CCAGTCTGGA TGATTGAGCC CAGTTGTAAT
   661  GACACGGAAC GATGTTTCTG GGAGATGCTG TTTAAAAAAA AAAAAAAAAA ACACGAGGGG
   721  GGGCCCGGTA CCC

Predicted gene structure (within gDNA segment 9393 to 12269):

 Exon  1   9738   9839 ( 102 n);  cDNA      1    102 ( 102 n); score: 0.941
  Intron  1   9840  10515 ( 676 n); Pd: 0.994 (s: 0.96), Pa: 1.000 (s: 0.94)
 Exon  2  10516  10669 ( 154 n);  cDNA    103    256 ( 154 n); score: 0.961
  Intron  2  10670  11329 ( 660 n); Pd: 0.961 (s: 0.96), Pa: 0.992 (s: 0.84)
 Exon  3  11330  11738 ( 409 n);  cDNA    257    643 ( 387 n); score: 0.792
 PPA                              cDNA    694    713

MATCH	21326110+	24768712-	0.854	665	0.907	C
PGS_21326110+_24768712-	(9738  9839,10516  10669,11330  11738)

Alignment (genomic DNA sequence = upper lines):

CAATTGAAAC TAGTTGGTGT TCAAGCATCA GGGGGGGTTT TTGCCGGTGC CGTGACCTCT     9797
|||||||||  |||||||||| |||||||||| |||||| ||| |||| |||||  ||| ||||| 
CAATTGAAAA TAGTTGGTGT TCAAGCATCA GGGGGGATTT TTGCTGGTGC TGTGCCCTCT       60


TTTGTTACGA CTCCCATAGA TACAATAAAG ACCAGGCTGC AGGTACTGTG TGACATTCTG     9857
|||||||||| |||||||||| |||||| ||| |||||||||| ||                    
TTTGTTACGA CTCCCATAGA TACAATCAAG ACCAGGCTGC AG........ ..........      102


TTTGCTGATT ACTCTTGTAA TTTGATTTGT GTGGGTATAT TTTGTGAGGC TTACCCTTGT     9917
                                                                  
.......... .......... .......... .......... .......... ..........      102


GACTTAATGA TTCTTGTCTT TACATTTATG CTGCTCATTT GCAATAATTT GATTCCTTAT     9977
                                                                  
.......... .......... .......... .......... .......... ..........      102


CAATGCAATG CCACTAAGTT TAGGGGAATG GATATTTTGT TTTGGAAGTA TATTTGATGT    10037
                                                                  
.......... .......... .......... .......... .......... ..........      102


CAGACTTGAA GACCTAAATG TTCTTTTATA CTGATATTTC CTCCAATGGC GGGCTATTGA    10097
                                                                  
.......... .......... .......... .......... .......... ..........      102


GGTGCTGGAC TGGAATGCTG TCTATATTAA ACAATATATA CTTCTATGTT TACAGCTGTT    10157
                                                                  
.......... .......... .......... .......... .......... ..........      102


TGTTTTCTGC TGACATACCA TGACCAATTT GTCATGGTTT CAGTTATGAG GTCAGAAAAA    10217
                                                                  
.......... .......... .......... .......... .......... ..........      102


AAGAAACTTC CATTGGGAAA ACTTGATATC TATTACTTCA TTATTTATAG TGAGTAACAA    10277
                                                                  
.......... .......... .......... .......... .......... ..........      102


AAGTTAGCAC TTTCAAACTG ACTAAAGTAT GCCAGGGACG TATCATGCAT TTTACAACAT    10337
                                                                  
.......... .......... .......... .......... .......... ..........      102


GCTCCACATA TCTCCAAATA TCACATATTA CGCTTGTAGT GGTAAACTGA TAATACATCT    10397
                                                                  
.......... .......... .......... .......... .......... ..........      102


ACCAACACTG AAAGTTCTCA CAAGTCAGAA CCCTATATTT GACAGTTGTG GTCTCCCTCC    10457
                                                                  
.......... .......... .......... .......... .......... ..........      102


TTCCCTCTGC ATTTGTTGCT ACAGATGATT ACACTGAGTT TTGTTTCTTG TCATTTAGGT    10517
                                                               || 
.......... .......... .......... .......... .......... ........GT      104


TATGGATAAT GAAAATAAGC CAAAAGCCAG GGAAGTTGTC AAAAGATTGA TTGCTGAAGA    10577
|||||||||| |||||||||| |||||||  | |||||||||  |||||||||| | |||||||| 
TATGGATAAT GAAAATAAGC CAAAAGCTGG GGAAGTTGTT AAAAGATTGA TCGCTGAAGA      164


TGGATGGAAA GGTTTGTACA GAGGGTTGGG TCCAAGATTT TTCAGCTCAT CAGCTTGGGG    10637
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TGGATGGAAA GGTTTGTACA GAGGGTTGGG TCCAAGATTT TTCAGCTCAT CAGCTTGGGG      224


AACCTCAATG ATAGTATGCT ACGAGTACCT GAGTATGTTT CGTCTTCCCT TGTCAAATGT    10697
  |||||||| |||||||||| |||||||||| ||                               
TCCCTCAATG ATAGTATGCT ACGAGTACCT GA........ .......... ..........      256


ACACATGCAT ATGTAGTGTT ATATATCACT GCATCCCATG CAGGTTAATT TTAAGTACCC    10757
                                                                  
.......... .......... .......... .......... .......... ..........      256


AGATACTTCT TCTCATTTAG AATTTAGTTA AAATGACATC ATTCAGGTCA GTTGGCATCT    10817
                                                                  
.......... .......... .......... .......... .......... ..........      256


CCAGTACACT GCTTTTGTAA GTTGTATCAT AAATCCCATT TGCAATGAAA TTTTTGACTC    10877
                                                                  
.......... .......... .......... .......... .......... ..........      256


AAGTTGCAGC CTGTAACTTT TCTATATTTT TCGAATAAAG CTATCACCGT ACATGAAACC    10937
                                                                  
.......... .......... .......... .......... .......... ..........      256


TGCTTCTGTT AATGCCAAGG AGCGCACATT ATTTCCTGTA GACCGGCTTG GATGTTGAAC    10997
                                                                  
.......... .......... .......... .......... .......... ..........      256


AATTGGCACA TGCAAGTAGC AAAGAGCAGC CTTGTGCTTG CAACAATCTG GTCCACCTGT    11057
                                                                  
.......... .......... .......... .......... .......... ..........      256


GGATATGTTC GCTGTGAAAG AAACCAATTA GTCCTTGTAT GAAACATGGT ATTAGCGCTT    11117
                                                                  
.......... .......... .......... .......... .......... ..........      256


CATGAATAAA ACCACTGATT CTGATTTCTT ATTTTCAATG AATGGATGGG CATTACCAAA    11177
                                                                  
.......... .......... .......... .......... .......... ..........      256


GTTATCATGA TTAAAGATCT ATTTCATATA AGTTTATTTT TATACATTAG AGTTTATTTA    11237
                                                                  
.......... .......... .......... .......... .......... ..........      256


GAGAACAAGG TATATTTAGT TTTGGTAATT TTGTGAACTG CACTCAGACG ACTTTGGTAT    11297
                                                                  
.......... .......... .......... .......... .......... ..........      256


TCTTACTGTA ATTTTGTTTT GTTTTCCTAC AGAGCGCTTG TGTGCTAAAG TTGAAGAGGT    11357
                                   |||||||| |||||||||| |||||||||| 
.......... .......... .......... ..AGCGCTTG TGTGCTAAAG TTGAAGAGGT      284


CTGATTTCTG AGCTGCCTTA AACTCAGAAC GCAATTCCTA CAATTCTGGA AGTTTTGTAT    11417
|||| |||||   ||  | ||   ||  |||  |   ||  |   | |    || |||    ||  
CTGACTTCTG TTCTTAC-TA TTCT-GGAA- G---TT-TTG TATTAGAAGA AGTGAAATAA      337


TAGCAGAAGT GT-AATAATG CTGTACACCA ACGGAAGCTT CAGTTCTTGC TGACATAGGT    11476
| || | | | ||  | ||    || ||||||  ||||||||| |||||||||| |||| ||||| 
T-GCTGTA-T GTCGACAACA TTG-ACACCA CCGGAAGCTT CAGTTCTTGC TGACGTAGGT      394


GAAAGTATTA AACATGGATG TTTGATGGTG TTAAAGACGT CATTTGATGC TAGACAATAG    11536
||||| |||  |||||||||| ||||||||||  |    || | |||||| ||| |||||||||| 
GAAAGCATTC AACATGGATG TTTGATGGTG -T----ACTT CATTTGGTGC TAGACAATAG      449


TCCTTACAAA CTTTGGTTCT CTGAGCAGAG TATTCTCAAA AAAATGCAGG GGCCTATATT    11596
|| ||||||| ||||| |||| ||| ||  |  || |||| || |||||| ||| | ||||||   
TCTTTACAAA CTTTGCTTCT CTGGGC-TA- TA-TCTC-AA AAAATGTAGG GCCCTATA--      503


TTTTTTTGCC TCTTATGCTG AATATGGATT AGGCTGATCA TTTTAGATGA ATATAAACGA    11656
|||||||| | || |||| || ||||||| ||  ||| ||| | |||||| |||  ||||||||| 
TTTTTTTG-C TCATATGATG AATATGGGTT TGGCGGATTA TTTTAGGTGA GTATAAACGA      562


GATCAGATGT ACACATTTAT CATTCTTTTA TACGTGAAGG CTTGTTTTAG CGAGGCTGGA    11716
 ||||||||| ||||| || | |||||||||| ||| |||||| | | |||||| |||||||| | 
TATCAGATGT ACACACTTCT CATTCTTTTA TACATGAAGG C-TATTTTAG CGAGGCTGTA      621


TGATTGAGAC CAGTTGTAAT GA    11738
|||||  ||| ||||    || ||
TGATTATGAC CAGTCTGGAT GA      643





********************************************************************************
EST sequence  102 -strand (File: 5058681-)

     1  CCAGGCTGCA GGTTATGGAT AATGAAAATA AGCCAAAAGC TGGGGAAGTT GTTAAAAGAT
    61  TGATTGCTGA AGATGGATGG AAAGGTTTGT ACAGAGGGTT GGGTCCAAGA TTTTTCAGCT
   121  CATCAGCTTG GGGTACCTCA ATGATAGTAT GCTACAAGTA CCTGAAGCGC TTGTGTGCTA
   181  AAGTTGAAGA GGTCTGACTT CTGTTCTTAC TATCCTGGAA GTTTTGTATT AGCAGAAGTG
   241  AAATAATGCT GTATGTCGCC AACATTGACC CCCCCGGAAG CTTCAGTTCT TGCTGACGTA
   301  GGTGAAAGCA TTCAACATGG ATGTTTGATG GTGTACTTCA TTTGATGCTA GCCAATAGTC
   361  TTTACAAACT TTGCTTCTCT GGGCTATATT CTCAAAAAAA TGGAGGGGCC TATATTTTTT
   421  TGCTCATATG ATGAATATGG GTTAGGCGGA TTATTTTAGG TGAGTATAAA CGATATCAGA
   481  TGTACACACT TCTCATTCTT TTATACATGA AGGCTGTTTT AGCGAGGCTG TATGATTATG
   541  ACCAGTCTGG ATGATTGAGA CCAGTTGTAA TGACACGGAA CGATGTTTCC CGGGAGATGC
   601  TGTTTTGCCC TTTTTTTTTC CCTCCATGCG GT

Predicted gene structure (within gDNA segment 10164 to 12196):

 Exon  1  10516  10669 ( 154 n);  cDNA     12    165 ( 154 n); score: 0.968
  Intron  1  10670  11329 ( 660 n); Pd: 0.961 (s: 0.96), Pa: 0.992 (s: 0.84)
 Exon  2  11330  11738 ( 409 n);  cDNA    166    554 ( 389 n); score: 0.800

MATCH	21326110+	5058681-	0.845	563	0.891	C
PGS_21326110+_5058681-	(10516  10669,11330  11738)

Alignment (genomic DNA sequence = upper lines):

GTTATGGATA ATGAAAATAA GCCAAAAGCC AGGGAAGTTG TCAAAAGATT GATTGCTGAA    10575
|||||||||| |||||||||| |||||||||   ||||||||| | |||||||| |||||||||| 
GTTATGGATA ATGAAAATAA GCCAAAAGCT GGGGAAGTTG TTAAAAGATT GATTGCTGAA       71


GATGGATGGA AAGGTTTGTA CAGAGGGTTG GGTCCAAGAT TTTTCAGCTC ATCAGCTTGG    10635
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GATGGATGGA AAGGTTTGTA CAGAGGGTTG GGTCCAAGAT TTTTCAGCTC ATCAGCTTGG      131


GGAACCTCAA TGATAGTATG CTACGAGTAC CTGAGTATGT TTCGTCTTCC CTTGTCAAAT    10695
|| ||||||| |||||||||| |||| ||||| ||||                             
GGTACCTCAA TGATAGTATG CTACAAGTAC CTGA...... .......... ..........      165


GTACACATGC ATATGTAGTG TTATATATCA CTGCATCCCA TGCAGGTTAA TTTTAAGTAC    10755
                                                                  
.......... .......... .......... .......... .......... ..........      165


CCAGATACTT CTTCTCATTT AGAATTTAGT TAAAATGACA TCATTCAGGT CAGTTGGCAT    10815
                                                                  
.......... .......... .......... .......... .......... ..........      165


CTCCAGTACA CTGCTTTTGT AAGTTGTATC ATAAATCCCA TTTGCAATGA AATTTTTGAC    10875
                                                                  
.......... .......... .......... .......... .......... ..........      165


TCAAGTTGCA GCCTGTAACT TTTCTATATT TTTCGAATAA AGCTATCACC GTACATGAAA    10935
                                                                  
.......... .......... .......... .......... .......... ..........      165


CCTGCTTCTG TTAATGCCAA GGAGCGCACA TTATTTCCTG TAGACCGGCT TGGATGTTGA    10995
                                                                  
.......... .......... .......... .......... .......... ..........      165


ACAATTGGCA CATGCAAGTA GCAAAGAGCA GCCTTGTGCT TGCAACAATC TGGTCCACCT    11055
                                                                  
.......... .......... .......... .......... .......... ..........      165


GTGGATATGT TCGCTGTGAA AGAAACCAAT TAGTCCTTGT ATGAAACATG GTATTAGCGC    11115
                                                                  
.......... .......... .......... .......... .......... ..........      165


TTCATGAATA AAACCACTGA TTCTGATTTC TTATTTTCAA TGAATGGATG GGCATTACCA    11175
                                                                  
.......... .......... .......... .......... .......... ..........      165


AAGTTATCAT GATTAAAGAT CTATTTCATA TAAGTTTATT TTTATACATT AGAGTTTATT    11235
                                                                  
.......... .......... .......... .......... .......... ..........      165


TAGAGAACAA GGTATATTTA GTTTTGGTAA TTTTGTGAAC TGCACTCAGA CGACTTTGGT    11295
                                                                  
.......... .......... .......... .......... .......... ..........      165


ATTCTTACTG TAATTTTGTT TTGTTTTCCT ACAGAGCGCT TGTGTGCTAA AGTTGAAGAG    11355
                                     |||||| |||||||||| |||||||||| 
.......... .......... .......... ....AGCGCT TGTGTGCTAA AGTTGAAGAG      191


GTCTGATTTC TGAGCTGCCT TAAACTCAGA ACGCAATTCC TACAATTCTG GAAGTTTTGT    11415
|||||| ||| ||  ||  |  ||  ||  || | |   ||   ||  |  |   |||||    | 
GTCTGACTTC TGTTCTTAC- TATCCT-GGA A-G--TTTTG TATTA-GC-A GAAGTGAAAT      244


ATTAGCAGAA GTGTAATAAT GCTGTACACC AACGGAAGCT TCAGTTCTTG CTGACATAGG    11475
| | || | |  |||    |    |  || ||   |||||||| |||||||||| ||||| |||| 
AAT-GCTGTA -TGTCGCCAA CATTGACCCC CCCGGAAGCT TCAGTTCTTG CTGACGTAGG      302


TGAAAGTATT AAACATGGAT GTTTGATGGT GTTAAAGACG TCATTTGATG CTAGACAATA    11535
|||||| |||  ||||||||| |||||||||| | |    ||  |||||||||| |||| ||||| 
TGAAAGCATT CAACATGGAT GTTTGATGGT G-T----ACT TCATTTGATG CTAGCCAATA      357


GTCCTTACAA ACTTTGGTTC TCTGAGCAGA GTATTCTCAA AAAAATGCAG GGGCCTATAT    11595
||| |||||| |||||| ||| |||| ||  |  ||||||||| ||||||| || |||||||||  
GTCTTTACAA ACTTTGCTTC TCTGGGC-TA -TATTCTCAA AAAAATGGAG GGGCCTATA-      414


TTTTTTTTGC CTCTTATGCT GAATATGGAT TAGGCTGATC ATTTTAGATG AATATAAACG    11655
 ||||||||  ||| |||| | |||||||| | ||||| |||  ||||||| || | |||||||| 
-TTTTTTTG- CTCATATGAT GAATATGGGT TAGGCGGATT ATTTTAGGTG AGTATAAACG      472


AGATCAGATG TACACATTTA TCATTCTTTT ATACGTGAAG GCTTGTTTTA GCGAGGCTGG    11715
| |||||||| |||||| ||  |||||||||| |||| ||||| || ||||||| |||||||||  
ATATCAGATG TACACACTTC TCATTCTTTT ATACATGAAG GC-TGTTTTA GCGAGGCTGT      531


ATGATTGAGA CCAGTTGTAA TGA    11738
||||||  || |||||    | |||
ATGATTATGA CCAGTCTGGA TGA      554





********************************************************************************
EST sequence   27 +strand (File: 4381116+)

     1  GCACGAGGGT GGGCAAGTTA TGGTTCGAGC CAGCGCTTCA TATGGAGCAA GCTCTTGGAT
    61  AATGGAACTG AGCATGGTGG GCCTGCTCCC AGCCAGGGGA AAATAGTGTC AGTTCAAGCT
   121  GCTGGTGGGA TCATCGCCGG TGCTACTGCA TCTTGCATAA CAACTCCATT GGACACCATT
   181  AAAACTAGGT TGCAGGTGAT GGGACACGAT AAGAGACCTA GTGCAGGGCA AGTAGTTAAG
   241  CAGCTAATTG CTGAAGATGG TTGGACAGGA TTTTACAGGG GATTAGGTCC AAGATTTGTC
   301  AGCATGTCAG CGTGGGGAAC CTCCATGATA CTTGCCTATG AATATCTCAA GCGCTTGTGT
   361  GCAGTAAACG AATAGATTGA TGAAAGCTAG CTGCCAGACG ACTCTTGCGG

Predicted gene structure (within gDNA segment 8671 to 11887):

 Exon  1   9729   9839 ( 111 n);  cDNA     85    195 ( 111 n); score: 0.667
  Intron  1   9840  10515 ( 676 n); Pd: 0.994 (s: 0.64), Pa: 1.000 (s: 0.56)
 Exon  2  10516  10669 ( 154 n);  cDNA    196    349 ( 154 n); score: 0.714
  Intron  2  10670  11329 ( 660 n); Pd: 0.961 (s: 0.74), Pa: 0.992 (s:    0)
 Exon  3  11330  11355 (  26 n);  cDNA    350    375 (  26 n); score: 0.731

MATCH	21326110+	4381116+	0.694	291	0.710	C
PGS_21326110+_4381116+	(9729  9839,10516  10669,11330  11355)

Alignment (genomic DNA sequence = upper lines):

GCTCCTAGCC AATTGAAACT AGTTGGTGTT CAAGCATCAG GGGGGGTTTT TGCCGGTGCC     9788
||||| |||| |   |||| | |||    ||| |||||  | | | ||| |  |  ||||||||  
GCTCCCAGCC AGGGGAAAAT AGTGTCAGTT CAAGCTGCTG GTGGGATCAT CGCCGGTGCT      144


GTGACCTCTT TTGTTACGAC TCCCATAGAT ACAATAAAGA CCAGGCTGCA GGTACTGTGT     9848
    | ||||    | || || |||  | ||  || || || | | ||| |||| |          
ACTGCATCTT GCATAACAAC TCCATTGGAC ACCATTAAAA CTAGGTTGCA G.........      195


GACATTCTGT TTGCTGATTA CTCTTGTAAT TTGATTTGTG TGGGTATATT TTGTGAGGCT     9908
                                                                  
.......... .......... .......... .......... .......... ..........      195


TACCCTTGTG ACTTAATGAT TCTTGTCTTT ACATTTATGC TGCTCATTTG CAATAATTTG     9968
                                                                  
.......... .......... .......... .......... .......... ..........      195


ATTCCTTATC AATGCAATGC CACTAAGTTT AGGGGAATGG ATATTTTGTT TTGGAAGTAT    10028
                                                                  
.......... .......... .......... .......... .......... ..........      195


ATTTGATGTC AGACTTGAAG ACCTAAATGT TCTTTTATAC TGATATTTCC TCCAATGGCG    10088
                                                                  
.......... .......... .......... .......... .......... ..........      195


GGCTATTGAG GTGCTGGACT GGAATGCTGT CTATATTAAA CAATATATAC TTCTATGTTT    10148
                                                                  
.......... .......... .......... .......... .......... ..........      195


ACAGCTGTTT GTTTTCTGCT GACATACCAT GACCAATTTG TCATGGTTTC AGTTATGAGG    10208
                                                                  
.......... .......... .......... .......... .......... ..........      195


TCAGAAAAAA AGAAACTTCC ATTGGGAAAA CTTGATATCT ATTACTTCAT TATTTATAGT    10268
                                                                  
.......... .......... .......... .......... .......... ..........      195


GAGTAACAAA AGTTAGCACT TTCAAACTGA CTAAAGTATG CCAGGGACGT ATCATGCATT    10328
                                                                  
.......... .......... .......... .......... .......... ..........      195


TTACAACATG CTCCACATAT CTCCAAATAT CACATATTAC GCTTGTAGTG GTAAACTGAT    10388
                                                                  
.......... .......... .......... .......... .......... ..........      195


AATACATCTA CCAACACTGA AAGTTCTCAC AAGTCAGAAC CCTATATTTG ACAGTTGTGG    10448
                                                                  
.......... .......... .......... .......... .......... ..........      195


TCTCCCTCCT TCCCTCTGCA TTTGTTGCTA CAGATGATTA CACTGAGTTT TGTTTCTTGT    10508
                                                                  
.......... .......... .......... .......... .......... ..........      195


CATTTAGGTT ATGGATAATG AAAATAAGCC AAAAGCCAGG GAAGTTGTCA AAAGATTGAT    10568
       ||  ||||   | | | || |  ||  |  ||  ||  |||| || | |     | || 
.......GTG ATGGGACACG ATAAGAGACC TAGTGCAGGG CAAGTAGTTA AGCAGCTAAT      248


TGCTGAAGAT GGATGGAAAG GTTTGTACAG AGGGTTGGGT CCAAGATTTT TCAGCTCATC    10628
|||||||||| || |||| || | || |||||  || || ||| |||||||||  |||||   || 
TGCTGAAGAT GGTTGGACAG GATTTTACAG GGGATTAGGT CCAAGATTTG TCAGCATGTC      308


AGCTTGGGGA ACCTCAATGA TAGTATGCTA CGAGTACCTG AGTATGTTTC GTCTTCCCTT    10688
||| |||||| ||||| |||| || |   |||  || || ||  |                     
AGCGTGGGGA ACCTCCATGA TACTTGCCTA TGAATATCTC A......... ..........      349


GTCAAATGTA CACATGCATA TGTAGTGTTA TATATCACTG CATCCCATGC AGGTTAATTT    10748
                                                                  
.......... .......... .......... .......... .......... ..........      349


TAAGTACCCA GATACTTCTT CTCATTTAGA ATTTAGTTAA AATGACATCA TTCAGGTCAG    10808
                                                                  
.......... .......... .......... .......... .......... ..........      349


TTGGCATCTC CAGTACACTG CTTTTGTAAG TTGTATCATA AATCCCATTT GCAATGAAAT    10868
                                                                  
.......... .......... .......... .......... .......... ..........      349


TTTTGACTCA AGTTGCAGCC TGTAACTTTT CTATATTTTT CGAATAAAGC TATCACCGTA    10928
                                                                  
.......... .......... .......... .......... .......... ..........      349


CATGAAACCT GCTTCTGTTA ATGCCAAGGA GCGCACATTA TTTCCTGTAG ACCGGCTTGG    10988
                                                                  
.......... .......... .......... .......... .......... ..........      349


ATGTTGAACA ATTGGCACAT GCAAGTAGCA AAGAGCAGCC TTGTGCTTGC AACAATCTGG    11048
                                                                  
.......... .......... .......... .......... .......... ..........      349


TCCACCTGTG GATATGTTCG CTGTGAAAGA AACCAATTAG TCCTTGTATG AAACATGGTA    11108
                                                                  
.......... .......... .......... .......... .......... ..........      349


TTAGCGCTTC ATGAATAAAA CCACTGATTC TGATTTCTTA TTTTCAATGA ATGGATGGGC    11168
                                                                  
.......... .......... .......... .......... .......... ..........      349


ATTACCAAAG TTATCATGAT TAAAGATCTA TTTCATATAA GTTTATTTTT ATACATTAGA    11228
                                                                  
.......... .......... .......... .......... .......... ..........      349


GTTTATTTAG AGAACAAGGT ATATTTAGTT TTGGTAATTT TGTGAACTGC ACTCAGACGA    11288
                                                                  
.......... .......... .......... .......... .......... ..........      349


CTTTGGTATT CTTACTGTAA TTTTGTTTTG TTTTCCTACA GAGCGCTTGT GTGCTAAAGT    11348
                                             ||||||||| ||||   |   
.......... .......... .......... .......... .AGCGCTTGT GTGCAGTAAA      368


TGAAGAG    11355
 ||| ||
CGAATAG      375





********************************************************************************
EST sequence   23 +strand (File: 15853351+)

     1  TACCTCAATG ATAGTATGCT ATGAATACCT TAAGCGCTTG TGTGTCTAAA TTGAAGAGGT
    61  CTGAGTCNAG CTTANAACCT ATCNCTCTGA TGCTCCCCAA TGGTGGAAAT TTTGTACCCT
   121  AAAATCCCAT AATGCTGTAT GCCCACACAC TGTGACCCCT GAGGAAGCTC TCTTTCTTGC
   181  TGACTTGATA CTAGATATCT TTAAAATTTT AGTGCTCTTG AGGCTATTTT GAAAATGCCG
   241  AGGTTCATAT TGTTTGCCTC TAACGATGAA TATGGATTAG GCAGAATGTT TTACATGATA
   301  TATAAACGAA AGATTAGATA TGTTCACTTT TCATTCTTTT TAGCTCCAGC CTCCACGGGC
   361  TTGTAATAGT GAGACCGGAG TATTGGAACC GGTTTCANGT GAGGAGGAGC CCAGGATATA
   421  TATACCTTTG CTCGTTTCTC TTCGATGTAC TCCAAATATC CTTCTTCGAA TTTTTTTACG
   481  ATGGTGCTGG TCTTCGTTTT GTATCCATAA TCCTTCGTAG CGAAATTATT TTCCAAAAAA
   541  AAAAAAAAAA AAAA

Predicted gene structure (within gDNA segment 10334 to 13295):

 Exon  1  10638  10669 (  32 n);  cDNA      1     32 (  32 n); score: 0.875
  Intron  1  10670  11329 ( 660 n); Pd: 0.961 (s:    0), Pa: 0.992 (s: 0.68)
 Exon  2  11330  11474 ( 145 n);  cDNA     33    170 ( 138 n); score: 0.572
  Intron  2  11475  11504 (  30 n); Pd: 0.443 (s: 0.50), Pa: 0.000 (s: 0.62) ??
 Exon  3  11505  11699 ( 195 n);  cDNA    171    353 ( 183 n); score: 0.662
 PPA                              cDNA    535    554

MATCH	21326110+	15853351+	0.624	372	0.671	C
PGS_21326110+_15853351+	(10638  10669,11330  11474,11505  11699)

Alignment (genomic DNA sequence = upper lines):

AACCTCAATG ATAGTATGCT ACGAGTACCT GAGTATGTTT CGTCTTCCCT TGTCAAATGT    10697
 ||||||||| |||||||||| | || |||||  |                               
TACCTCAATG ATAGTATGCT ATGAATACCT TA........ .......... ..........       32


ACACATGCAT ATGTAGTGTT ATATATCACT GCATCCCATG CAGGTTAATT TTAAGTACCC    10757
                                                                  
.......... .......... .......... .......... .......... ..........       32


AGATACTTCT TCTCATTTAG AATTTAGTTA AAATGACATC ATTCAGGTCA GTTGGCATCT    10817
                                                                  
.......... .......... .......... .......... .......... ..........       32


CCAGTACACT GCTTTTGTAA GTTGTATCAT AAATCCCATT TGCAATGAAA TTTTTGACTC    10877
                                                                  
.......... .......... .......... .......... .......... ..........       32


AAGTTGCAGC CTGTAACTTT TCTATATTTT TCGAATAAAG CTATCACCGT ACATGAAACC    10937
                                                                  
.......... .......... .......... .......... .......... ..........       32


TGCTTCTGTT AATGCCAAGG AGCGCACATT ATTTCCTGTA GACCGGCTTG GATGTTGAAC    10997
                                                                  
.......... .......... .......... .......... .......... ..........       32


AATTGGCACA TGCAAGTAGC AAAGAGCAGC CTTGTGCTTG CAACAATCTG GTCCACCTGT    11057
                                                                  
.......... .......... .......... .......... .......... ..........       32


GGATATGTTC GCTGTGAAAG AAACCAATTA GTCCTTGTAT GAAACATGGT ATTAGCGCTT    11117
                                                                  
.......... .......... .......... .......... .......... ..........       32


CATGAATAAA ACCACTGATT CTGATTTCTT ATTTTCAATG AATGGATGGG CATTACCAAA    11177
                                                                  
.......... .......... .......... .......... .......... ..........       32


GTTATCATGA TTAAAGATCT ATTTCATATA AGTTTATTTT TATACATTAG AGTTTATTTA    11237
                                                                  
.......... .......... .......... .......... .......... ..........       32


GAGAACAAGG TATATTTAGT TTTGGTAATT TTGTGAACTG CACTCAGACG ACTTTGGTAT    11297
                                                                  
.......... .......... .......... .......... .......... ..........       32


TCTTACTGTA ATTTTGTTTT GTTTTCCTAC AGAGCGCTTG TGTGCTAAAG TTGAAGAGGT    11357
                                   |||||||| ||||   ||  |||||||||| 
.......... .......... .......... ..AGCGCTTG TGTGTCTAAA TTGAAGAGGT       60


CTGATTTCTG AGCTGCCTTA AACTCAGAAC GCAATTCCTA CAATTCTGGA AGTTTTGTAT    11417
||||  ||   ||||          ||      |    |||   ||||  |||| | |||||||  
CTGA-GTC-N AGCTTANAAC CTATCNCTCT GATGCTCCC- CAATGGTGGA AATTTTGTA-      116


TAGCAGAAGT GTAATAATGC TGTACACCAA CGGAAGCTTC AGTTCTTGCT GACATAGGTG    11477
   |  || |    ||||||| ||||  || | |  |  ||       | ||   ||         
-CCCTAAAAT CCCATAATGC TGTATGCCCA C--ACACTGT GACCCCTGAG GAAGCTC...      170


AAAGTATTAA ACATGGATGT TTGATGGTGT TAAAGACGTC ATTTGATGCT AGACAATAGT    11537
                             | | |     | |  | ||||| || ||   ||| | 
.......... .......... .......TCT TTCTTGC-TG ACTTGATACT AG---ATA-T      198


CCTTACAAAC TTTGGTTCTC TGAGCAGAGT ATTCTCAAAA AAATGCAGGG GCCTATATTT    11597
| ||| |||  ||| || ||| |  | ||  | ||| |    | |||||| | | |  | |  |  
CTTTA-AAAT TTTAGTGCTC T-TG-AGGCT ATT-T--TGA AAATGCCGAG G--T-TCATA      249


TTTTTTGCCT CTTATGCTGA ATATGGATTA GGCTGATCAT TTTAGATGA- ATATAAACG-    11655
|| ||||||| || | | ||| |||||||||| ||| ||   | |||| ||||  |||||||||  
TTGTTTGCCT CTAACGATGA ATATGGATTA GGCAGAATGT TTTACATGAT ATATAAACGA      309


-AGATCAGAT GTACACATTT ATCATTCTTT TATACGTGAA GGCTT    11699
 |||| ||||  |   || ||  ||||||||| | ||  |  | | || 
AAGATTAGAT ATGTTCACTT TTCATTCTTT T-TAGCTCCA GCCTC      353





********************************************************************************
EST sequence  104 -strand (File: 4730326-)

     1  GCACGAGCTC CCCTGTCAAA TAAAATTCGC GTTCCTTGTA TTGAGGAAAG CGTTCAACAT
    61  GGATGTTTGA TGGTGTACTT CATTTGATGC TAGACAATAG TCTTTACAAA CTTTGCTTCT
   121  CTGGGCTATA TTCTCAAAAA AATGGAGGGG CCTATATTTT TTTGCTCATA TGATGAATAT
   181  GGGTTAGGCG GATTATTTTA GGTGAGTATA AACGATATCA GATGTACACA CTTCTCATTC
   241  TTTTATACAT GAAGGCTGTT TTAGCGAGGC TGTATGATTA TGACCAGTCT GGATGATTGA
   301  GACCAGTTGT AATGACACGG AACGATGTTT CCGGGAGATG CTGTTTTGAC CTTTTTTTTT
   361  TCCTCATGCG GTTTCAGTTA AAAAAAAAAA AAAAAAAACT

Predicted gene structure (within gDNA segment 10907 to 12214):

 Exon  1  11475  11738 ( 264 n);  cDNA     45    296 ( 252 n); score: 0.852
 PPA                              cDNA    380    399

MATCH	21326110+	4730326-	0.852	264	0.660	C
PGS_21326110+_4730326-	(11475  11738)

Alignment (genomic DNA sequence = upper lines):

GTGAAAGTAT TAAACATGGA TGTTTGATGG TGTTAAAGAC GTCATTTGAT GCTAGACAAT    11534
| |||||  | | |||||||| |||||||||| || |  |  |  ||||||||| |||||||||| 
G-GAAAGCGT TCAACATGGA TGTTTGATGG TG-T--A--C TTCATTTGAT GCTAGACAAT       98


AGTCCTTACA AACTTTGGTT CTCTGAGCAG AGTATTCTCA AAAAAATGCA GGGGCCTATA    11594
|||| ||||| ||||||| || ||||| ||   | |||||||| |||||||| | |||||||||| 
AGTCTTTACA AACTTTGCTT CTCTGGGCT- A-TATTCTCA AAAAAATGGA GGGGCCTATA      156


TTTTTTTTTG CCTCTTATGC TGAATATGGA TTAGGCTGAT CATTTTAGAT GAATATAAAC    11654
  ||||||||  ||| ||||  |||||||||  |||||| |||  ||||||| | || ||||||| 
--TTTTTTTG -CTCATATGA TGAATATGGG TTAGGCGGAT TATTTTAGGT GAGTATAAAC      213


GAGATCAGAT GTACACATTT ATCATTCTTT TATACGTGAA GGCTTGTTTT AGCGAGGCTG    11714
|| ||||||| ||||||| ||  ||||||||| ||||| |||| ||| |||||| |||||||||| 
GATATCAGAT GTACACACTT CTCATTCTTT TATACATGAA GGC-TGTTTT AGCGAGGCTG      272


GATGATTGAG ACCAGTTGTA ATGA    11738
 ||||||  | ||||||     ||||
TATGATTATG ACCAGTCTGG ATGA      296





********************************************************************************
EST sequence  103 -strand (File: 13557988-)

     1  GATGGTGTAC TTCATTTGAT GCTAGACAAT AGTCTTTACA AACTTTGCTT CTCTGGGCTA
    61  TATTCTCAAA AAAATGGAGG GGCCTATATT TTTTTGCTCA TATGATGAAT ATGGGTTAGG
   121  C

Predicted gene structure (within gDNA segment 11156 to 12031):

 Exon  1  11503  11630 ( 128 n);  cDNA      1    121 ( 121 n); score: 0.844

MATCH	21326110+	13557988-	0.844	128	1.058	C
PGS_21326110+_13557988-	(11503  11630)

Alignment (genomic DNA sequence = upper lines):

GGTGTTAAAG ACGTCATTTG ATGCTAGACA ATAGTCCTTA CAAACTTTGG TTCTCTGAGC    11562
| || |     || ||||||| |||||||||| |||||| ||| |||||||||  ||||||| || 
GATGGT--GT ACTTCATTTG ATGCTAGACA ATAGTCTTTA CAAACTTTGC TTCTCTGGGC       58


AGAGTATTCT CAAAAAAATG CAGGGGCCTA TATTTTTTTT TGCCTCTTAT GCTGAATATG    11622
  | |||||| ||||||||||  ||||||||| ||  |||||| || ||| ||| | |||||||| 
-TA-TATTCT CAAAAAAATG GAGGGGCCTA TA--TTTTTT TG-CTCATAT GATGAATATG      113


GATTAGGC    11630
| ||||||
GGTTAGGC      121





********************************************************************************
EST sequence   61 +strand (File: 13585839+)

     1  GCACGAGGCT TCTTCAGCTT CAGTCCAGTC ACAACTGAAT CCGCCGCGCA AGGCATCCAA
    61  GGATTTGTTC GTCCTTCGGA GGGTGGGGAA TCGAAGCGAC GAAAACGAAG CAATGAACGA
   121  GGCGGTGCAG GAGGCGAAGC TGCTGCGGCA GGTGAACGCG CTCATCGTGG CGCACCTCCG
   181  TAGCCAGAAC CTCGGGCAGG CCGCAGCCGC CGTCGCCGCC GCCACCATGA CCCCCATCTC
   241  CGCCGCCGAA TCCGTCCCCG CAAATCAACT CCTACGTCTC GTGGCCAAGG GCCTCGCGGC
   301  GGAGGGCGGA GGAGGAGCCG CTTCCGCATT CGACTCCGCC GGGTTCGGTG GGGCGGTGCA
   361  GCCGCTCGGC TCCAGTGCCG TGGATTTCAG TATGCAGGAT GTCAAGGGCT CATCCAAGAG
   421  CTTCCCCAAG CACGAGGCGA AGCATGTCTC TGACCATAAG AACGCTGCCC GG

Predicted gene structure (within gDNA segment 12020 to 13513):

 Exon  1  12352  12640 ( 289 n);  cDNA      1    289 ( 289 n); score: 0.983
  Intron  1  12641  12722 (  82 n); Pd: 0.000 (s: 1.00), Pa: 0.000 (s: 1.00)
 Exon  2  12723  12823 ( 101 n);  cDNA    290    390 ( 101 n); score: 1.000
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 1.00), Pa: 0.000 (s: 1.00)
 Exon  3  12921  12990 (  70 n);  cDNA    391    460 (  70 n); score: 1.000
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 1.00), Pa: 0.978 (s:    0)
 Exon  4  13197  13208 (  12 n);  cDNA    461    472 (  12 n); score: 1.000

MATCH	21326110+	13585839+	0.989	472	1.000	C
PGS_21326110+_13585839+	(12352  12640,12723  12823,12921  12990,13197  13208)

Alignment (genomic DNA sequence = upper lines):

TTGCTAGTCT TCTTCAGCTT CAGTCCAGTC ACAACTGAAT CCGCCGCGCA AGGCATCCAA    12411
   | || || |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GCACGAGGCT TCTTCAGCTT CAGTCCAGTC ACAACTGAAT CCGCCGCGCA AGGCATCCAA       60


GGATTTGTTC GTCCTTCGGA GGGTGGGGAA TCGAAGCGAC GAAAACGAAG CAATGAACGA    12471
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GGATTTGTTC GTCCTTCGGA GGGTGGGGAA TCGAAGCGAC GAAAACGAAG CAATGAACGA      120


GGCGGTGCAG GAGGCGAAGC TGCTGCGGCA GGTGAACGCG CTCATCGTGG CGCACCTCCG    12531
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GGCGGTGCAG GAGGCGAAGC TGCTGCGGCA GGTGAACGCG CTCATCGTGG CGCACCTCCG      180


TAGCCAGAAC CTCGGGCAGG CCGCAGCCGC CGTCGCCGCC GCCACCATGA CCCCCATCTC    12591
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TAGCCAGAAC CTCGGGCAGG CCGCAGCCGC CGTCGCCGCC GCCACCATGA CCCCCATCTC      240


CGCCGCCGAA TCCGTCCCCG CAAATCAACT CCTACGTCTC GTGGCCAAGG TCCCCCCACT    12651
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||             
CGCCGCCGAA TCCGTCCCCG CAAATCAACT CCTACGTCTC GTGGCCAAG. ..........      289


TTCCCCTTCC TCCGGCAGTC TGGCCTAGGA TTTGTTCTGC ACGGGCCTAA ACCCTCACTG    12711
                                                                  
.......... .......... .......... .......... .......... ..........      289


TTGGTTCGCA GGGCCTCGCG GCGGAGGGCG GAGGAGGAGC CGCTTCCGCA TTCGACTCCG    12771
            ||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.......... .GGCCTCGCG GCGGAGGGCG GAGGAGGAGC CGCTTCCGCA TTCGACTCCG      338


CCGGGTTCGG TGGGGCGGTG CAGCCGCTCG GCTCCAGTGC CGTGGATTTC AGGTAAACCC    12831
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| ||         
CCGGGTTCGG TGGGGCGGTG CAGCCGCTCG GCTCCAGTGC CGTGGATTTC AG........      390


CAACCTTGCG CCCCCGCGGT GTTGCCTAGT GGCAGTGTTT TTTCTGGTGC TGAACATTGG    12891
                                                                  
.......... .......... .......... .......... .......... ..........      390


TGAGGAGTGT TGACGCCGGT GCTGTGTAGT ATGCAGGATG TCAAGGGCTC ATCCAAGAGC    12951
                               | |||||||||| |||||||||| |||||||||| 
.......... .......... .........T ATGCAGGATG TCAAGGGCTC ATCCAAGAGC      421


TTCCCCAAGC ACGAGGCGAA GCATGTCTCT GACCATAAGG TGCTTATGAT TCCAATTTTC    13011
|||||||||| |||||||||| |||||||||| |||||||||                        
TTCCCCAAGC ACGAGGCGAA GCATGTCTCT GACCATAAG. .......... ..........      460


CCTTGCAAAT GCACCACTTG AAAGTTGAAA CAATTTTTGT GTCAGACTCC TGTTTATCTG    13071
                                                                  
.......... .......... .......... .......... .......... ..........      460


AATATTTACT ACTGCTATTG CACATTTTGC ACTTATCACA GTACCATGAT TATGTAGACA    13131
                                                                  
.......... .......... .......... .......... .......... ..........      460


ACTTGGGATT GACCAACAAT AGATTTTACT GATGTTTATT GGCTTACCAT TGCATTTTTC    13191
                                                                  
.......... .......... .......... .......... .......... ..........      460


TGTAGAACGC TGCCCGG    13208
     ||||| |||||||
.....AACGC TGCCCGG      472





********************************************************************************
EST sequence   62 +strand (File: 13585840+)

     1  GCACGAGGCT TCTTCAGCTT CAGTCCAGTC ACAACTGAAT CCGCCGCGCA AGGCATCCAA
    61  GGATTTGTTC GTCCTTCGGA GGGTGGGGAA TCGAAGCGAC GAAAACGAAG CAATGAACGA
   121  GGCGGTGCAG GAGGCGAAGC TGCTGCGGCA GGTGAACGCG CTCATCGTGG CGCACCTCCG
   181  TAGCCAGAAC CTCGGGCAGG CCGCAGCCGC CGTCGCCGCC GCCACCATGA CCCCCATCTC
   241  CGCCGCCGAA TCCGTCCCCG CAAATCAACT CCTACGTCTC GTGGCCAAGG GCCTCGCGGC
   301  GGAGGGCGGA GGAGGAGCCG CTTCCGCATT CGACTCCGCC GGGTTCGGTG GGGCGGTGCA
   361  GCCGCTCGGC TCCAGTGCCG TGGATTTCAG TATGCAGGAT GTCAAGGGCT CATCCAAGAG
   421  CTTCCCCAAG CACGAGGCGA AGCATGTCTC TGACCATAAG AACG

Predicted gene structure (within gDNA segment 12020 to 13315):

 Exon  1  12352  12640 ( 289 n);  cDNA      1    289 ( 289 n); score: 0.983
  Intron  1  12641  12722 (  82 n); Pd: 0.000 (s: 1.00), Pa: 0.000 (s: 1.00)
 Exon  2  12723  12823 ( 101 n);  cDNA    290    390 ( 101 n); score: 1.000
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 1.00), Pa: 0.000 (s: 1.00)
 Exon  3  12921  12990 (  70 n);  cDNA    391    460 (  70 n); score: 1.000

MATCH	21326110+	13585840+	0.989	460	0.991	C
PGS_21326110+_13585840+	(12352  12640,12723  12823,12921  12990)

Alignment (genomic DNA sequence = upper lines):

TTGCTAGTCT TCTTCAGCTT CAGTCCAGTC ACAACTGAAT CCGCCGCGCA AGGCATCCAA    12411
   | || || |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GCACGAGGCT TCTTCAGCTT CAGTCCAGTC ACAACTGAAT CCGCCGCGCA AGGCATCCAA       60


GGATTTGTTC GTCCTTCGGA GGGTGGGGAA TCGAAGCGAC GAAAACGAAG CAATGAACGA    12471
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GGATTTGTTC GTCCTTCGGA GGGTGGGGAA TCGAAGCGAC GAAAACGAAG CAATGAACGA      120


GGCGGTGCAG GAGGCGAAGC TGCTGCGGCA GGTGAACGCG CTCATCGTGG CGCACCTCCG    12531
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GGCGGTGCAG GAGGCGAAGC TGCTGCGGCA GGTGAACGCG CTCATCGTGG CGCACCTCCG      180


TAGCCAGAAC CTCGGGCAGG CCGCAGCCGC CGTCGCCGCC GCCACCATGA CCCCCATCTC    12591
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TAGCCAGAAC CTCGGGCAGG CCGCAGCCGC CGTCGCCGCC GCCACCATGA CCCCCATCTC      240


CGCCGCCGAA TCCGTCCCCG CAAATCAACT CCTACGTCTC GTGGCCAAGG TCCCCCCACT    12651
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||             
CGCCGCCGAA TCCGTCCCCG CAAATCAACT CCTACGTCTC GTGGCCAAG. ..........      289


TTCCCCTTCC TCCGGCAGTC TGGCCTAGGA TTTGTTCTGC ACGGGCCTAA ACCCTCACTG    12711
                                                                  
.......... .......... .......... .......... .......... ..........      289


TTGGTTCGCA GGGCCTCGCG GCGGAGGGCG GAGGAGGAGC CGCTTCCGCA TTCGACTCCG    12771
            ||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.......... .GGCCTCGCG GCGGAGGGCG GAGGAGGAGC CGCTTCCGCA TTCGACTCCG      338


CCGGGTTCGG TGGGGCGGTG CAGCCGCTCG GCTCCAGTGC CGTGGATTTC AGGTAAACCC    12831
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| ||         
CCGGGTTCGG TGGGGCGGTG CAGCCGCTCG GCTCCAGTGC CGTGGATTTC AG........      390


CAACCTTGCG CCCCCGCGGT GTTGCCTAGT GGCAGTGTTT TTTCTGGTGC TGAACATTGG    12891
                                                                  
.......... .......... .......... .......... .......... ..........      390


TGAGGAGTGT TGACGCCGGT GCTGTGTAGT ATGCAGGATG TCAAGGGCTC ATCCAAGAGC    12951
                               | |||||||||| |||||||||| |||||||||| 
.......... .......... .........T ATGCAGGATG TCAAGGGCTC ATCCAAGAGC      421


TTCCCCAAGC ACGAGGCGAA GCATGTCTCT GACCATAAG    12990
|||||||||| |||||||||| |||||||||| |||||||||
TTCCCCAAGC ACGAGGCGAA GCATGTCTCT GACCATAAG      460





********************************************************************************
EST sequence    8 +strand (File: 18965012+)

     1  ACGGGATAGT GTAGTAGCAA GCATAGGAGT TTTGCTGTCT TCTTCAGCTT CAGTAGTTCA
    61  GTCCAATCAC AGATCGCAGT ACAACCGAAC CCGCCGCACA AGGCATCCAA GGATTTGTTC
   121  GGCCTTCGGA CTTCGGAGGG TAGGGAATCG AAGCCACGAG AAGTCGAGAA CAAAGCAATG
   181  AACGAGGCGG TGCAGGAGGC GAAGCTGCTG CGGCAGGTGA ACGCGCTCAT CGTGGCACAC
   241  CTCCGTAGCC AGAACCTCGG GCAGGCCGCA GCTGCCGTCG CCGCCGCCAC CATGACCCCC
   301  ATCTCCGCTG CCGAATCCGT CCCCGCCAAT CACCTCCTGC GTCTCGTGGC CAAGGGCCTC
   361  GCCGCGGAGC ACGGAGGAGG TGACGCCGCT TCCGCATTCG ACTCCGCCGG GTTCGGTGTG
   421  GCGGTGCAGC CGCCCGGCTC CAGTGCCGTG GATTTCAGTA TTCAGGATGT CAAGGGCTCA
   481  TCCAAAAGCT TCCCCAAGCA CGAGGCGAAG CATGTCTCTG ACCATAAGAA CGCTGCCCG

Predicted gene structure (within gDNA segment 11878 to 13512):

 Exon  1  12380  12640 ( 261 n);  cDNA     80    354 ( 275 n); score: 0.835
  Intron  1  12641  12722 (  82 n); Pd: 0.000 (s: 0.92), Pa: 0.000 (s: 0.81)
 Exon  2  12723  12823 ( 101 n);  cDNA    355    458 ( 104 n); score: 0.891
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.96), Pa: 0.000 (s: 0.96)
 Exon  3  12921  12990 (  70 n);  cDNA    459    528 (  70 n); score: 0.971
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.98), Pa: 0.978 (s:    0)
 Exon  4  13197  13207 (  11 n);  cDNA    529    539 (  11 n); score: 1.000

MATCH	21326110+	18965012+	0.870	443	0.822	C
PGS_21326110+_18965012+	(12380  12640,12723  12823,12921  12990,13197  13207)

Alignment (genomic DNA sequence = upper lines):

TCACAACTGA ATCCGCCGCG CAAGGCATCC AAGGATTTGT TC-G---TC- --CTTCGGAG    12432
| ||||| || | |||||||  |||||||||| |||||||||| || |   ||    |||||||| 
T-ACAACCGA ACCCGCCGCA CAAGGCATCC AAGGATTTGT TCGGCCTTCG GACTTCGGAG      138


GGTGGGGAAT CGAAG---C- -G-A--CGAA AACGAAGCAA TGAACGAGGC GGTGCAGGAG    12484
||| |||||| |||||   |   | |  |||  ||| |||||| |||||||||| |||||||||| 
GGTAGGGAAT CGAAGCCACG AGAAGTCGAG AACAAAGCAA TGAACGAGGC GGTGCAGGAG      198


GCGAAGCTGC TGCGGCAGGT GAACGCGCTC ATCGTGGCGC ACCTCCGTAG CCAGAACCTC    12544
|||||||||| |||||||||| |||||||||| |||||||| | |||||||||| |||||||||| 
GCGAAGCTGC TGCGGCAGGT GAACGCGCTC ATCGTGGCAC ACCTCCGTAG CCAGAACCTC      258


GGGCAGGCCG CAGCCGCCGT CGCCGCCGCC ACCATGACCC CCATCTCCGC CGCCGAATCC    12604
|||||||||| |||| ||||| |||||||||| |||||||||| ||||||||||  ||||||||| 
GGGCAGGCCG CAGCTGCCGT CGCCGCCGCC ACCATGACCC CCATCTCCGC TGCCGAATCC      318


GTCCCCGCAA ATCAACTCCT ACGTCTCGTG GCCAAGGTCC CCCCACTTTC CCCTTCCTCC    12664
|||||||| | |||| |||||  ||||||||| ||||||                           
GTCCCCGCCA ATCACCTCCT GCGTCTCGTG GCCAAG.... .......... ..........      354


GGCAGTCTGG CCTAGGATTT GTTCTGCACG GGCCTAAACC CTCACTGTTG GTTCGCAGGG    12724
                                                               || 
.......... .......... .......... .......... .......... ........GG      356


CCTCGCGGCG GAGGGCGGAG GA-G-GA-GC CGCTTCCGCA TTCGACTCCG CCGGGTTCGG    12781
|||||| ||| |||  ||||| || | || || |||||||||| |||||||||| |||||||||| 
CCTCGCCGCG GAGCACGGAG GAGGTGACGC CGCTTCCGCA TTCGACTCCG CCGGGTTCGG      416


TGGGGCGGTG CAGCCGCTCG GCTCCAGTGC CGTGGATTTC AGGTAAACCC CAACCTTGCG    12841
|| ||||||| ||||||| || |||||||||| |||||||||| ||                    
TGTGGCGGTG CAGCCGCCCG GCTCCAGTGC CGTGGATTTC AG........ ..........      458


CCCCCGCGGT GTTGCCTAGT GGCAGTGTTT TTTCTGGTGC TGAACATTGG TGAGGAGTGT    12901
                                                                  
.......... .......... .......... .......... .......... ..........      458


TGACGCCGGT GCTGTGTAGT ATGCAGGATG TCAAGGGCTC ATCCAAGAGC TTCCCCAAGC    12961
                    | || ||||||| |||||||||| |||||| ||| |||||||||| 
.......... .........T ATTCAGGATG TCAAGGGCTC ATCCAAAAGC TTCCCCAAGC      499


ACGAGGCGAA GCATGTCTCT GACCATAAGG TGCTTATGAT TCCAATTTTC CCTTGCAAAT    13021
|||||||||| |||||||||| |||||||||                                   
ACGAGGCGAA GCATGTCTCT GACCATAAG. .......... .......... ..........      528


GCACCACTTG AAAGTTGAAA CAATTTTTGT GTCAGACTCC TGTTTATCTG AATATTTACT    13081
                                                                  
.......... .......... .......... .......... .......... ..........      528


ACTGCTATTG CACATTTTGC ACTTATCACA GTACCATGAT TATGTAGACA ACTTGGGATT    13141
                                                                  
.......... .......... .......... .......... .......... ..........      528


GACCAACAAT AGATTTTACT GATGTTTATT GGCTTACCAT TGCATTTTTC TGTAGAACGC    13201
                                                            ||||| 
.......... .......... .......... .......... .......... .....AACGC      533


TGCCCG    13207
||||||
TGCCCG      539





********************************************************************************
EST sequence   70 +strand (File: 13090650+)

     1  GACGGAGGGG AGGGCCGAGA TGGACGCGGC GGTGCAAGAG GCCAAGCTGC TGCGGCAAGT
    61  GAACGCCCTC ATCGTGGCGC ACCTGCGCGA CCAGAACCTC ACGCAAGCCG CCGCCGCCGT
   121  CGCCGCCGGC ACCATGACCC CCAAAGCCGA CGCCTCCCTC CCCAACCACC TTCTNCGGCT
   181  CGTCGCCAAG GGCCTCGCGG CTGAGCGGGA GGAGGCGGCC AGGGGAGGCG GAACTCCCCC
   241  CGCGTTTGAC TCCGCTGGCA GCGGTGGGCT GGCGCGCCCG CTCGGCACCA GCGCCGTGGA
   301  TTTCAGTGTG CAGAATGTCA TGGGCCCGTC CAAGACTTTC CCCAAGCACG AGACCAGGCA
   361  CATCTCCGAT CATAAGAATG TTGCCAGATG TGCGAAATTT AGTCCTGATG GGAAACATTT
   421  TGCAACTGGA AGTGGGGACA CATTCATTAA GTTCTTTGAG GTATCAAAAA TTAAGCAGAC
   481  GATGTTAGGA GACTCCAAAA AG

Predicted gene structure (within gDNA segment 11973 to 13815):

 Exon  1  12444  12648 ( 205 n);  cDNA      1    198 ( 198 n); score: 0.776
  Intron  1  12649  12713 (  65 n); Pd: 0.000 (s: 0.68), Pa: 0.000 (s: 0.60)
 Exon  2  12714  12823 ( 110 n);  cDNA    199    306 ( 108 n); score: 0.709
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.80), Pa: 0.000 (s: 0.82)
 Exon  3  12921  12990 (  70 n);  cDNA    307    376 (  70 n); score: 0.800
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.80), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13280 (  84 n);  cDNA    377    460 (  84 n); score: 0.857
  Intron  4  13281  13380 ( 100 n); Pd: 0.000 (s: 0.84), Pa: 1.000 (s: 0.81)
 Exon  5  13381  13422 (  42 n);  cDNA    461    502 (  42 n); score: 0.810

MATCH	21326110+	13090650+	0.778	511	1.018	C
PGS_21326110+_13090650+	(12444  12648,12714  12823,12921  12990,13197  13280,13381  13422)

Alignment (genomic DNA sequence = upper lines):

GAAGCGACGA AAACGAAGCA ATGAACGAGG CGGTGCAGGA GGCGAAGCTG CTGCGGCAGG    12503
|| | || |   |  |  |   ||| ||| || ||||||| || ||| |||||| |||||||| | 
GACG-GAGGG GAGGGCCGAG ATGGACGCGG CGGTGCAAGA GGCCAAGCTG CTGCGGCAAG       59


TGAACGCGCT CATCGTGGCG CACCTCCGTA GCCAGAACCT CGGGCAGGCC GCAGCCGCCG    12563
||||||| || |||||||||| ||||| ||    ||||||||| |  ||| ||| || ||||||| 
TGAACGCCCT CATCGTGGCG CACCTGCGCG ACCAGAACCT CACGCAAGCC GCCGCCGCCG      119


TCGCCGCCGC CACCATGACC CCCATCTCCG CCGCCGAATC CGTCCCCGCA AATCAACTCC    12623
|||||||||  |||||||||| ||||   |||  ||||   || | | ||| |  || || || | 
TCGCCGCCGG CACCATGACC CCCAAAGCCG ACGCC---TC CCT-CCC-C- AACCACCTTC      173


TACGTCTCGT GGCCAAGGTC CCCCCACTTT CCCCTTCCTC CGGCAGTCTG GCCTAGGATT    12683
| || |||||  ||||||| | | | |                                       
TNCGGCTCGT CGCCAAGGGC CTCGC..... .......... .......... ..........      198


TGTTCTGCAC GGGCCTAAAC CCTCACTGTT GGTTCGCAGG GCCTCGCGGC GGAGGGCGGA    12743
                                 || | | ||  |    | ||| ||   | ||| 
.......... .......... .......... GGCT-G-AGC GGGAGGAGGC GGCCAGGGGA      226


GGAGGAGCCG CTTCCGCATT CGACTCCGCC GGGTTCGGTG GGGCGGTGCA GCCGCTCGGC    12803
|| ||| |   |  |||| ||  ||||||||  ||   ||||| ||  || ||   ||||||||| 
GGCGGAACTC CCCCCGCGTT TGACTCCGCT GGCAGCGGTG GGCTGGCGCG CCCGCTCGGC      286


TCCAGTGCCG TGGATTTCAG GTAAACCCCA ACCTTGCGCC CCCGCGGTGT TGCCTAGTGG    12863
 |||| |||| ||||||||||                                             
ACCAGCGCCG TGGATTTCAG .......... .......... .......... ..........      306


CAGTGTTTTT TCTGGTGCTG AACATTGGTG AGGAGTGTTG ACGCCGGTGC TGTGTAGTAT    12923
                                                              | | 
.......... .......... .......... .......... .......... .......TGT      309


GCAGGATGTC AAGGGCTCAT CCAAGAGCTT CCCCAAGCAC GAGGCGAAGC ATGTCTCTGA    12983
|||| ||||| | |||| | | ||||||  || |||||||||| ||| | | || |  |||| || 
GCAGAATGTC ATGGGCCCGT CCAAGACTTT CCCCAAGCAC GAGACCAGGC ACATCTCCGA      369


CCATAAGGTG CTTATGATTC CAATTTTCCC TTGCAAATGC ACCACTTGAA AGTTGAAACA    13043
 ||||||                                                           
TCATAAG... .......... .......... .......... .......... ..........      376


ATTTTTGTGT CAGACTCCTG TTTATCTGAA TATTTACTAC TGCTATTGCA CATTTTGCAC    13103
                                                                  
.......... .......... .......... .......... .......... ..........      376


TTATCACAGT ACCATGATTA TGTAGACAAC TTGGGATTGA CCAACAATAG ATTTTACTGA    13163
                                                                  
.......... .......... .......... .......... .......... ..........      376


TGTTTATTGG CTTACCATTG CATTTTTCTG TAGAACGCTG CCCGGTGTGC GAAATTTAGT    13223
                                    || | || || | ||||| |||||||||| 
.......... .......... .......... ...AATGTTG CCAGATGTGC GAAATTTAGT      403


CCTGATGGGA AGTATTTTGC AACTGGGAGT GCTGATACAT CCATTAAGTT TTTTGAGGTG    13283
|||||||||| |  ||||||| |||||| ||| |  || ||||  |||||||||  ||||||    
CCTGATGGGA AACATTTTGC AACTGGAAGT GGGGACACAT TCATTAAGTT CTTTGAG...      460


AACTTGAAAT TTGAATTGCC ACTCAGGTTG CTAGGTGGGG CTTGTGCTGT TTTCTACTTA    13343
                                                                  
.......... .......... .......... .......... .......... ..........      460


GTTGCAACTT GTAACTCACT ATTGCTCTGT CCTGCAGGTT GCTAAAATTA AGCAGACTAT    13403
                                        ||   | ||||||| ||||||| || 
.......... .......... .......... .......GTA TCAAAAATTA AGCAGACGAT      483


GGTAGGGGAC TCCAAAGAT    13422
| |||| ||| |||||| | 
GTTAGGAGAC TCCAAAAAG      502





********************************************************************************
EST sequence   72 +strand (File: 12035017+)

     1  GGAACACTGA ACACATTTGC TCTGAAGCTT GAGTCCACTC CCACTCCATT TCACAGTTGG
    61  CCCCACCCCC ACGGGAGGAC GGAGGGGAGG GCCGAGATGG ACGCGGCGGT GCAGGAGGCC
   121  AAGCTGCTGC GGCAGGTGAA CGCCCTCATC GTGGCGCACC TCCGCGACCA GAACCTCACG
   181  CAGGCCGCCG CCGCCGTCGC CGCCGCCACC ATGACCCCCA AGGCCGACGC CTCCCTCCCC
   241  AACCACCTCC TCCGCCTCGT CGCCAAGGGC CTCGCGGCTG AGCGGGAGGA GGCGGCCAGG
   301  GGAGGCGGAG CTCCCCCCGC GTTTGACTCC GCTGGCGGCG GTGGGCTGGC GCGCCCGCTC
   361  GGCACCAGCG CCGTGGATTT CAGTGTGCAG AATGTCAGGG GCCCGTCCAA GACTTTCCCC
   421  AAGCACGAGA CCAGGCACAT CTCCGATCAT AAGAATGTTG CCAGATGTGC GAAATTTAGT
   481  CCTGATGGGA AACATTTTGC AACTGGAAGT GGGGACACAT CCATTAAGTT CTTTGAGGTA
   541  TCAAAAATTA AGCAGACGAT GTTAGGAGAC TCCAAAGAAG GCCCTGGCCG ACCTGTGGTC
   601  CGTACATTTT ATGACCATGT GCAAGCCCAT CAATGATCTG GGATTTCCAT CCTATTAGCC
   661  CAATACTGAT ATCTGCAGCA AAAGATAATA CGATTAAAGT

Predicted gene structure (within gDNA segment 11652 to 14373):

 Exon  1  12464  12648 ( 185 n);  cDNA     97    275 ( 179 n); score: 0.843
  Intron  1  12649  12713 (  65 n); Pd: 0.000 (s: 0.70), Pa: 0.000 (s: 0.62)
 Exon  2  12714  12823 ( 110 n);  cDNA    276    383 ( 108 n); score: 0.718
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.80), Pa: 0.000 (s: 0.82)
 Exon  3  12921  12990 (  70 n);  cDNA    384    453 (  70 n); score: 0.800
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.80), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13280 (  84 n);  cDNA    454    537 (  84 n); score: 0.869
  Intron  4  13281  13380 ( 100 n); Pd: 0.000 (s: 0.86), Pa: 1.000 (s: 0.82)
 Exon  5  13381  13467 (  87 n);  cDNA    538    625 (  88 n); score: 0.759
  Intron  5  13468  13886 ( 419 n); Pd: 0.992 (s: 0.69), Pa: 0.939 (s: 0.82)
 Exon  6  13887  13957 (  71 n);  cDNA    626    697 (  72 n); score: 0.817

MATCH	21326110+	12035017+	0.804	607	0.867	C
PGS_21326110+_12035017+	(12464  12648,12714  12823,12921  12990,13197  13280,13381  13467,13887  13957)

Alignment (genomic DNA sequence = upper lines):

ATGAACGAGG CGGTGCAGGA GGCGAAGCTG CTGCGGCAGG TGAACGCGCT CATCGTGGCG    12523
||| ||| || |||||||||| ||| |||||| |||||||||| ||||||| || |||||||||| 
ATGGACGCGG CGGTGCAGGA GGCCAAGCTG CTGCGGCAGG TGAACGCCCT CATCGTGGCG      156


CACCTCCGTA GCCAGAACCT CGGGCAGGCC GCAGCCGCCG TCGCCGCCGC CACCATGACC    12583
||||||||    ||||||||| |  ||||||| || ||||||| |||||||||| |||||||||| 
CACCTCCGCG ACCAGAACCT CACGCAGGCC GCCGCCGCCG TCGCCGCCGC CACCATGACC      216


CCCATCTCCG CCGCCGAATC CGTCCCCGCA AATCAACTCC TACGTCTCGT GGCCAAGGTC    12643
||||   |||  ||||   || | | ||| |  || || |||| | || |||||  ||||||| | 
CCCAAGGCCG ACGCC---TC CCT-CCC-C- AACCACCTCC TCCGCCTCGT CGCCAAGGGC      270


CCCCCACTTT CCCCTTCCTC CGGCAGTCTG GCCTAGGATT TGTTCTGCAC GGGCCTAAAC    12703
| | |                                                             
CTCGC..... .......... .......... .......... .......... ..........      275


CCTCACTGTT GGTTCGCAGG GCCTCGCGGC GGAGGGCGGA GGAGGAGCCG CTTCCGCATT    12763
           || | | ||  |    | ||| ||   | ||| || |||||   |  |||| || 
.......... GGCT-G-AGC GGGAGGAGGC GGCCAGGGGA GGCGGAGCTC CCCCCGCGTT      323


CGACTCCGCC GGGTTCGGTG GGGCGGTGCA GCCGCTCGGC TCCAGTGCCG TGGATTTCAG    12823
 ||||||||  ||   ||||| ||  || ||   |||||||||  |||| |||| |||||||||| 
TGACTCCGCT GGCGGCGGTG GGCTGGCGCG CCCGCTCGGC ACCAGCGCCG TGGATTTCAG      383


GTAAACCCCA ACCTTGCGCC CCCGCGGTGT TGCCTAGTGG CAGTGTTTTT TCTGGTGCTG    12883
                                                                  
.......... .......... .......... .......... .......... ..........      383


AACATTGGTG AGGAGTGTTG ACGCCGGTGC TGTGTAGTAT GCAGGATGTC AAGGGCTCAT    12943
                                        | | |||| ||||| | |||| | | 
.......... .......... .......... .......TGT GCAGAATGTC AGGGGCCCGT      406


CCAAGAGCTT CCCCAAGCAC GAGGCGAAGC ATGTCTCTGA CCATAAGGTG CTTATGATTC    13003
||||||  || |||||||||| ||| | | || |  |||| ||  ||||||               
CCAAGACTTT CCCCAAGCAC GAGACCAGGC ACATCTCCGA TCATAAG... ..........      453


CAATTTTCCC TTGCAAATGC ACCACTTGAA AGTTGAAACA ATTTTTGTGT CAGACTCCTG    13063
                                                                  
.......... .......... .......... .......... .......... ..........      453


TTTATCTGAA TATTTACTAC TGCTATTGCA CATTTTGCAC TTATCACAGT ACCATGATTA    13123
                                                                  
.......... .......... .......... .......... .......... ..........      453


TGTAGACAAC TTGGGATTGA CCAACAATAG ATTTTACTGA TGTTTATTGG CTTACCATTG    13183
                                                                  
.......... .......... .......... .......... .......... ..........      453


CATTTTTCTG TAGAACGCTG CCCGGTGTGC GAAATTTAGT CCTGATGGGA AGTATTTTGC    13243
              || | || || | ||||| |||||||||| |||||||||| |  ||||||| 
.......... ...AATGTTG CCAGATGTGC GAAATTTAGT CCTGATGGGA AACATTTTGC      500


AACTGGGAGT GCTGATACAT CCATTAAGTT TTTTGAGGTG AACTTGAAAT TTGAATTGCC    13303
|||||| ||| |  || |||| ||||||||||  ||||||                          
AACTGGAAGT GGGGACACAT CCATTAAGTT CTTTGAG... .......... ..........      537


ACTCAGGTTG CTAGGTGGGG CTTGTGCTGT TTTCTACTTA GTTGCAACTT GTAACTCACT    13363
                                                                  
.......... .......... .......... .......... .......... ..........      537


ATTGCTCTGT CCTGCAGGTT GCTAAAATTA AGCAGACTAT GGTAGGGGAC TCCAAAGATG    13423
                  ||   | ||||||| ||||||| || | |||| ||| |||||||| | 
.......... .......GTA TCAAAAATTA AGCAGACGAT GTTAGGAGAC TCCAAAGAAG      580


GTCCTGCCAG GCCTGTGATT CGCACATTTT ATGATCACAC AC-AGGTGAG CATGTATTGC    13482
| |||| | |  |||||| |  || ||||||| |||| ||     | ||                 
GCCCTGGCCG ACCTGTGGTC CGTACATTTT ATGACCATGT GCAAG..... ..........      625


TCATATATGA CAGTTTATTT ACTCTTCAAG GTCGTGAGAC TCTTTTCAAC ACTTCCACAA    13542
                                                                  
.......... .......... .......... .......... .......... ..........      625


GATTGCCTCC GAGTTAGGTC TCCTGCAGTA TTTTTTTTCC TTTAATATGC GGAGAGCTGC    13602
                                                                  
.......... .......... .......... .......... .......... ..........      625


ATATCATTGC ATTATAGAAA GACTGAAATA CATGGGTAGA TCAAATCCAC CTGCCACCAC    13662
                                                                  
.......... .......... .......... .......... .......... ..........      625


AGACCACACT TATATACACA CGCTCAACTC ACGTTTAGCA CACTGGATGC ACACCTAGCA    13722
                                                                  
.......... .......... .......... .......... .......... ..........      625


GCTGCAATTT GTAGTTAGAT ATTTGCTTAC TGAGCTGTGT GGAGCATTGA CATGATATTC    13782
                                                                  
.......... .......... .......... .......... .......... ..........      625


AATTTTTTAA TAAACAACAT TTTTTTCCAT TTTCACTAGT TTCTACTTCA TTTCCCATTG    13842
                                                                  
.......... .......... .......... .......... .......... ..........      625


CTCAAATTTC CACTGTGCTC GTAAACATGA TTGATTTCTT GCAGGCCATC AATGATCT-G    13901
                                                 ||||| |||||||| | 
.......... .......... .......... .......... ....CCCATC AATGATCTGG      641


GATTTTCATC CTGAGAGTCC AATACTGATA TCAGCTGCAA AAGACAATAC AATAAA    13957
||||| |||| ||   || || |||||||||| || || |||| |||| |||||  || ||
GATTTCCATC CTATTAGCCC AATACTGATA TCTGCAGCAA AAGATAATAC GATTAA      697





********************************************************************************
EST sequence   73 +strand (File: 12035019+)

     1  GGAACACTGA ACACATTTGC TCTGAAGCTT GAGTCCACTC CCACTCCATT TCACAGTTGG
    61  CCCCACCCCC ACGGGAGGAC GGAGGGGAGG GCCGAGATGG ACGCGGCGGT GCAGGAGGCC
   121  AAGCTGCTGC GGCAGGTGAA CGCCCTCATC GTGGCGCACC TCCGCGACCA GAACCTCACG
   181  CAGGCCGCCG CCGCCGTCGC CGCCGCCACC ATGACCCCCA AGGCCGACGC CTCCCTCCCC
   241  AACCACCTCC TCCGCCTCGT CGCCAAGGGC CTCGCGGCTG AGCGGGAGGA GGCGGCCAGG
   301  GGAGGCGGAG CTCCCCCCGC GTTTGACTCC GCTGGCGGCG GTGGGCTGGC GCGCCCGCTC
   361  GGCACCAGCG CCGTGGATTT CAGTGTGCAG AATGTCAGGG GCCCGTCCAA GACTTTCCCC
   421  AAGCACGAGA CCAGGCACAT CTCCGATCAT AAGAATGTTG CCAGATGTGC GAAATTTAGT
   481  CCTGATGGGA AACATTTTGC AACTGGAAGT GGGGACACAT CCATTAAGTT CTTTGAGGTA
   541  TCAAAAATTA AGCAGACGAT GTTAGGAGAC TCCAAAGAAG GCCCTGGCCG ACCTGTGGTC
   601  CGTACATTTT ATGACCATTG TGCAAGCCC

Predicted gene structure (within gDNA segment 11652 to 14065):

 Exon  1  12464  12648 ( 185 n);  cDNA     97    275 ( 179 n); score: 0.843
  Intron  1  12649  12713 (  65 n); Pd: 0.000 (s: 0.70), Pa: 0.000 (s: 0.62)
 Exon  2  12714  12823 ( 110 n);  cDNA    276    383 ( 108 n); score: 0.718
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.80), Pa: 0.000 (s: 0.82)
 Exon  3  12921  12990 (  70 n);  cDNA    384    453 (  70 n); score: 0.800
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.80), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13280 (  84 n);  cDNA    454    537 (  84 n); score: 0.869
  Intron  4  13281  13380 ( 100 n); Pd: 0.000 (s: 0.86), Pa: 1.000 (s: 0.82)
 Exon  5  13381  13467 (  87 n);  cDNA    538    622 (  85 n); score: 0.770
  Intron  5  13468  13619 ( 152 n); Pd: 0.992 (s: 0.72), Pa: 0.559 (s:    0)
 Exon  6  13620  13626 (   7 n);  cDNA    623    629 (   7 n); score: 0.571

MATCH	21326110+	12035019+	0.804	543	0.863	C
PGS_21326110+_12035019+	(12464  12648,12714  12823,12921  12990,13197  13280,13381  13467,13620  13626)

Alignment (genomic DNA sequence = upper lines):

ATGAACGAGG CGGTGCAGGA GGCGAAGCTG CTGCGGCAGG TGAACGCGCT CATCGTGGCG    12523
||| ||| || |||||||||| ||| |||||| |||||||||| ||||||| || |||||||||| 
ATGGACGCGG CGGTGCAGGA GGCCAAGCTG CTGCGGCAGG TGAACGCCCT CATCGTGGCG      156


CACCTCCGTA GCCAGAACCT CGGGCAGGCC GCAGCCGCCG TCGCCGCCGC CACCATGACC    12583
||||||||    ||||||||| |  ||||||| || ||||||| |||||||||| |||||||||| 
CACCTCCGCG ACCAGAACCT CACGCAGGCC GCCGCCGCCG TCGCCGCCGC CACCATGACC      216


CCCATCTCCG CCGCCGAATC CGTCCCCGCA AATCAACTCC TACGTCTCGT GGCCAAGGTC    12643
||||   |||  ||||   || | | ||| |  || || |||| | || |||||  ||||||| | 
CCCAAGGCCG ACGCC---TC CCT-CCC-C- AACCACCTCC TCCGCCTCGT CGCCAAGGGC      270


CCCCCACTTT CCCCTTCCTC CGGCAGTCTG GCCTAGGATT TGTTCTGCAC GGGCCTAAAC    12703
| | |                                                             
CTCGC..... .......... .......... .......... .......... ..........      275


CCTCACTGTT GGTTCGCAGG GCCTCGCGGC GGAGGGCGGA GGAGGAGCCG CTTCCGCATT    12763
           || | | ||  |    | ||| ||   | ||| || |||||   |  |||| || 
.......... GGCT-G-AGC GGGAGGAGGC GGCCAGGGGA GGCGGAGCTC CCCCCGCGTT      323


CGACTCCGCC GGGTTCGGTG GGGCGGTGCA GCCGCTCGGC TCCAGTGCCG TGGATTTCAG    12823
 ||||||||  ||   ||||| ||  || ||   |||||||||  |||| |||| |||||||||| 
TGACTCCGCT GGCGGCGGTG GGCTGGCGCG CCCGCTCGGC ACCAGCGCCG TGGATTTCAG      383


GTAAACCCCA ACCTTGCGCC CCCGCGGTGT TGCCTAGTGG CAGTGTTTTT TCTGGTGCTG    12883
                                                                  
.......... .......... .......... .......... .......... ..........      383


AACATTGGTG AGGAGTGTTG ACGCCGGTGC TGTGTAGTAT GCAGGATGTC AAGGGCTCAT    12943
                                        | | |||| ||||| | |||| | | 
.......... .......... .......... .......TGT GCAGAATGTC AGGGGCCCGT      406


CCAAGAGCTT CCCCAAGCAC GAGGCGAAGC ATGTCTCTGA CCATAAGGTG CTTATGATTC    13003
||||||  || |||||||||| ||| | | || |  |||| ||  ||||||               
CCAAGACTTT CCCCAAGCAC GAGACCAGGC ACATCTCCGA TCATAAG... ..........      453


CAATTTTCCC TTGCAAATGC ACCACTTGAA AGTTGAAACA ATTTTTGTGT CAGACTCCTG    13063
                                                                  
.......... .......... .......... .......... .......... ..........      453


TTTATCTGAA TATTTACTAC TGCTATTGCA CATTTTGCAC TTATCACAGT ACCATGATTA    13123
                                                                  
.......... .......... .......... .......... .......... ..........      453


TGTAGACAAC TTGGGATTGA CCAACAATAG ATTTTACTGA TGTTTATTGG CTTACCATTG    13183
                                                                  
.......... .......... .......... .......... .......... ..........      453


CATTTTTCTG TAGAACGCTG CCCGGTGTGC GAAATTTAGT CCTGATGGGA AGTATTTTGC    13243
              || | || || | ||||| |||||||||| |||||||||| |  ||||||| 
.......... ...AATGTTG CCAGATGTGC GAAATTTAGT CCTGATGGGA AACATTTTGC      500


AACTGGGAGT GCTGATACAT CCATTAAGTT TTTTGAGGTG AACTTGAAAT TTGAATTGCC    13303
|||||| ||| |  || |||| ||||||||||  ||||||                          
AACTGGAAGT GGGGACACAT CCATTAAGTT CTTTGAG... .......... ..........      537


ACTCAGGTTG CTAGGTGGGG CTTGTGCTGT TTTCTACTTA GTTGCAACTT GTAACTCACT    13363
                                                                  
.......... .......... .......... .......... .......... ..........      537


ATTGCTCTGT CCTGCAGGTT GCTAAAATTA AGCAGACTAT GGTAGGGGAC TCCAAAGATG    13423
                  ||   | ||||||| ||||||| || | |||| ||| |||||||| | 
.......... .......GTA TCAAAAATTA AGCAGACGAT GTTAGGAGAC TCCAAAGAAG      580


GTCCTGCCAG GCCTGTGATT CGCACATTTT ATGATCACAC ACAGGTGAGC ATGTATTGCT    13483
| |||| | |  |||||| |  || ||||||| |||| | ||     |                  
GCCCTGGCCG ACCTGTGGTC CGTACATTTT ATGA-C-CAT TGTG...... ..........      622


CATATATGAC AGTTTATTTA CTCTTCAAGG TCGTGAGACT CTTTTCAACA CTTCCACAAG    13543
                                                                  
.......... .......... .......... .......... .......... ..........      622


ATTGCCTCCG AGTTAGGTCT CCTGCAGTAT TTTTTTTCCT TTAATATGCG GAGAGCTGCA    13603
                                                                  
.......... .......... .......... .......... .......... ..........      622


TATCATTGCA TTATAGAAAG ACT    13626
                  |||  | 
.......... ......CAAG CCC      629





********************************************************************************
EST sequence   78 +strand (File: 24328201+)

     1  GGACGCGGCG GTGCAGGAGG CCAAGCTGCT GCGGCAGGTG AACGCCCTCA TCGTGGCGCA
    61  CCTCCGCGAC CAGAACCTCA CGCAGGCCGC CGCCGCCGTC GCCGCCGCCA CCATGACCCC
   121  CAAGGCCGAC GCCTCCCTCC CCAACCACCT CCTCCGCCTC GTCGCCAAGG GCCTCGCGGC
   181  TGAGCGGGAG GAGGCGGCCA GGGGAGGCGG AGCTCCCCCC GCGTTTGACT CCGCTGGCGG
   241  CGGTGGGCTG GCGCGCCCGC TCGGCACCAG CGCCGTGGAT TTCAGTGTGC AGAATGTCAG
   301  GGGCCCGTCC AAGACTTTCC CCAAGCACGA GACCAGGCAC ATCTCCGATC ATAAGAATGT
   361  TGCCAGATGT GCGAAATTTA GTCCTGATGG GAAACATTTT GCAACTGGAA GTGGGGACAC
   421  ATCCATTAAG TTCTTTGAGG TATCAAAAAT TAAGCAGACG ATGTTAGGAG ACTCCAAAGA
   481  AGGCCCTGGC CGACCTGTGG TCCGTACATT TTATGACCAT GTGCAGCCCA TCAATGATCT
   541  GGATTTCCAT CCTATTAGCC CAATACTGAT ATCTGCAGCA AAAGATAATA CGATAAAGTT
   601  CTTTGAGTTC TCCAAAACTG CTGCAAG

Predicted gene structure (within gDNA segment 12142 to 14508):

 Exon  1  12466  12648 ( 183 n);  cDNA      1    177 ( 177 n); score: 0.842
  Intron  1  12649  12713 (  65 n); Pd: 0.000 (s: 0.70), Pa: 0.000 (s: 0.62)
 Exon  2  12714  12823 ( 110 n);  cDNA    178    285 ( 108 n); score: 0.718
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.80), Pa: 0.000 (s: 0.82)
 Exon  3  12921  12990 (  70 n);  cDNA    286    355 (  70 n); score: 0.800
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.80), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13280 (  84 n);  cDNA    356    439 (  84 n); score: 0.869
  Intron  4  13281  13380 ( 100 n); Pd: 0.000 (s: 0.86), Pa: 1.000 (s: 0.82)
 Exon  5  13381  13467 (  87 n);  cDNA    440    526 (  87 n); score: 0.782
  Intron  5  13468  13886 ( 419 n); Pd: 0.992 (s: 0.74), Pa: 0.939 (s: 0.86)
 Exon  6  13887  13957 (  71 n);  cDNA    527    597 (  71 n); score: 0.859
  Intron  6  13958  14109 ( 152 n); Pd: 0.973 (s: 0.84), Pa: 0.989 (s:    0)
 Exon  7  14110  14139 (  30 n);  cDNA    598    627 (  30 n); score: 0.700

MATCH	21326110+	24328201+	0.812	635	1.013	C
PGS_21326110+_24328201+	(12466  12648,12714  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14139)

Alignment (genomic DNA sequence = upper lines):

GAACGAGGCG GTGCAGGAGG CGAAGCTGCT GCGGCAGGTG AACGCGCTCA TCGTGGCGCA    12525
| ||| |||| |||||||||| | |||||||| |||||||||| ||||| |||| |||||||||| 
GGACGCGGCG GTGCAGGAGG CCAAGCTGCT GCGGCAGGTG AACGCCCTCA TCGTGGCGCA       60


CCTCCGTAGC CAGAACCTCG GGCAGGCCGC AGCCGCCGTC GCCGCCGCCA CCATGACCCC    12585
||||||   | |||||||||   |||||||||  ||||||||| |||||||||| |||||||||| 
CCTCCGCGAC CAGAACCTCA CGCAGGCCGC CGCCGCCGTC GCCGCCGCCA CCATGACCCC      120


CATCTCCGCC GCCGAATCCG TCCCCGCAAA TCAACTCCTA CGTCTCGTGG CCAAGGTCCC    12645
||   ||| | |||   |||  |||||  ||   || |||||  || ||||| | |||||| ||  
CAAGGCCGAC GCC---TCCC TCCCC--AAC -CACCTCCTC CGCCTCGTCG CCAAGGGCCT      174


CCCACTTTCC CCTTCCTCCG GCAGTCTGGC CTAGGATTTG TTCTGCACGG GCCTAAACCC    12705
| |                                                               
CGC....... .......... .......... .......... .......... ..........      177


TCACTGTTGG TTCGCAGGGC CTCGCGGCGG AGGGCGGAGG AGGAGCCGCT TCCGCATTCG    12765
        ||  | | || |     | |||||    | |||||  |||||  |   |||| || | 
........GG CT-G-AGCGG GAGGAGGCGG CCAGGGGAGG CGGAGCTCCC CCCGCGTTTG      227


ACTCCGCCGG GTTCGGTGGG GCGGTGCAGC CGCTCGGCTC CAGTGCCGTG GATTTCAGGT    12825
||||||| ||    |||||||   || ||  | |||||||| | ||| |||||| ||||||||   
ACTCCGCTGG CGGCGGTGGG CTGGCGCGCC CGCTCGGCAC CAGCGCCGTG GATTTCAG..      285


AAACCCCAAC CTTGCGCCCC CGCGGTGTTG CCTAGTGGCA GTGTTTTTTC TGGTGCTGAA    12885
                                                                  
.......... .......... .......... .......... .......... ..........      285


CATTGGTGAG GAGTGTTGAC GCCGGTGCTG TGTAGTATGC AGGATGTCAA GGGCTCATCC    12945
                                      | ||| || ||||||  |||| | ||| 
.......... .......... .......... .....TGTGC AGAATGTCAG GGGCCCGTCC      310


AAGAGCTTCC CCAAGCACGA GGCGAAGCAT GTCTCTGACC ATAAGGTGCT TATGATTCCA    13005
||||  |||| |||||||||| | | | |||   |||| || | |||||                 
AAGACTTTCC CCAAGCACGA GACCAGGCAC ATCTCCGATC ATAAG..... ..........      355


ATTTTCCCTT GCAAATGCAC CACTTGAAAG TTGAAACAAT TTTTGTGTCA GACTCCTGTT    13065
                                                                  
.......... .......... .......... .......... .......... ..........      355


TATCTGAATA TTTACTACTG CTATTGCACA TTTTGCACTT ATCACAGTAC CATGATTATG    13125
                                                                  
.......... .......... .......... .......... .......... ..........      355


TAGACAACTT GGGATTGACC AACAATAGAT TTTACTGATG TTTATTGGCT TACCATTGCA    13185
                                                                  
.......... .......... .......... .......... .......... ..........      355


TTTTTCTGTA GAACGCTGCC CGGTGTGCGA AATTTAGTCC TGATGGGAAG TATTTTGCAA    13245
            || | ||||  | ||||||| |||||||||| |||||||||   ||||||||| 
.......... .AATGTTGCC AGATGTGCGA AATTTAGTCC TGATGGGAAA CATTTTGCAA      404


CTGGGAGTGC TGATACATCC ATTAAGTTTT TTGAGGTGAA CTTGAAATTT GAATTGCCAC    13305
|||| ||||   || |||||| |||||||| | |||||                            
CTGGAAGTGG GGACACATCC ATTAAGTTCT TTGAG..... .......... ..........      439


TCAGGTTGCT AGGTGGGGCT TGTGCTGTTT TCTACTTAGT TGCAACTTGT AACTCACTAT    13365
                                                                  
.......... .......... .......... .......... .......... ..........      439


TGCTCTGTCC TGCAGGTTGC TAAAATTAAG CAGACTATGG TAGGGGACTC CAAAGATGGT    13425
                ||  |  ||||||||| ||||| |||  |||| ||||| |||||| ||  
.......... .....GTATC AAAAATTAAG CAGACGATGT TAGGAGACTC CAAAGAAGGC      484


CCTGCCAGGC CTGTGATTCG CACATTTTAT GATCACACAC AGGTGAGCAT GTATTGCTCA    13485
|||| | | | ||||| | ||  ||||||||| || ||    | ||                    
CCTGGCCGAC CTGTGGTCCG TACATTTTAT GACCATGTGC AG........ ..........      526


TATATGACAG TTTATTTACT CTTCAAGGTC GTGAGACTCT TTTCAACACT TCCACAAGAT    13545
                                                                  
.......... .......... .......... .......... .......... ..........      526


TGCCTCCGAG TTAGGTCTCC TGCAGTATTT TTTTTCCTTT AATATGCGGA GAGCTGCATA    13605
                                                                  
.......... .......... .......... .......... .......... ..........      526


TCATTGCATT ATAGAAAGAC TGAAATACAT GGGTAGATCA AATCCACCTG CCACCACAGA    13665
                                                                  
.......... .......... .......... .......... .......... ..........      526


CCACACTTAT ATACACACGC TCAACTCACG TTTAGCACAC TGGATGCACA CCTAGCAGCT    13725
                                                                  
.......... .......... .......... .......... .......... ..........      526


GCAATTTGTA GTTAGATATT TGCTTACTGA GCTGTGTGGA GCATTGACAT GATATTCAAT    13785
                                                                  
.......... .......... .......... .......... .......... ..........      526


TTTTTAATAA ACAACATTTT TTTCCATTTT CACTAGTTTC TACTTCATTT CCCATTGCTC    13845
                                                                  
.......... .......... .......... .......... .......... ..........      526


AAATTTCCAC TGTGCTCGTA AACATGATTG ATTTCTTGCA GGCCATCAAT GATCTGGATT    13905
                                              |||||||| |||||||||| 
.......... .......... .......... .......... .CCCATCAAT GATCTGGATT      545


TTCATCCTGA GAGTCCAATA CTGATATCAG CTGCAAAAGA CAATACAATA AAGTATGCTT    13965
| ||||||    || |||||| |||||||| | | ||||||||  ||||| ||| ||         
TCCATCCTAT TAGCCCAATA CTGATATCTG CAGCAAAAGA TAATACGATA AA........      597


ATCCTTGATG TCTACACTCC GTGCTGTTAA ATTGTCTATT TGAAGTGCTC ATACTAGGAT    14025
                                                                  
.......... .......... .......... .......... .......... ..........      597


TAAGCATGAT TTTTTAGGAA TTTTTTGCGG TATTAATTGC TATCTGTGTT ATTGTTTTGT    14085
                                                                  
.......... .......... .......... .......... .......... ..........      597


ACATGAAAAA ATTTTGCTCA ACAGATTTTT TGACTTCTCA AAGACCAATG CGAG    14139
                           || || ||| |||||  || ||   || | ||
.......... .......... ....GTTCTT TGAGTTCTCC AAAACTGCTG CAAG      627





********************************************************************************
EST sequence   12 +strand (File: 20809597+)

     1  GATTCGGCAC GAGCGAAGGG GAGGAAGGTC GGGGCCGAGA TGGACGCGGC GGTGCAGGAG
    61  GCGAAGCTGC TGCGGCAGGT GAACGCCCTC ATCGTGGCGC ACCTCCGGCG ACCAGAACCT
   121  CACGCAGGCC GCCACCGGCC GTCGCCGCCG CCACCATGAC CCCCAGGGCC GACGCCTCCG
   181  TCCCCAACCA CCTCCTCCGC CTCGTCGGCA AGGGTCTCGC GGTAGAGCAA GAGGAGGCGG
   241  GGAGAGGAGG CGGAGCTCCC GCCGCGGCTG GGCTGGCGCG CCCGGTCGGC ACCAATGCCG
   301  TGGATTTCAG TGTGCAGAAT GTTAGGGGCC CGTCCAAGAC TTTCCCCAAG CATGAAACCA
   361  GGCACATCTC CGATCATAAG AATGTTGCCA GATGTGCAAA ATTTAGTCCT GATGGGAAAT
   421  ATTTTGCAAC TGGAAGTGGG GACACATCCA TTAAGTTCTT TGAGGTGTCG AAAATTAAGC
   481  AGACTATGTT AGGAGACTCC AAAGAAAGCT CTGGCCGGCC TGTGGTCCGT ACATTTTATG
   541  ACCATGTGCA GCCCATCAAT GATCTGGATT TCCATCCTAT TAGCCCAATA CTGATATCTG
   601  GAGC

Predicted gene structure (within gDNA segment 11937 to 14268):

 Exon  1  12473  12640 ( 168 n);  cDNA     49    212 ( 164 n); score: 0.839
  Intron  1  12641  12722 (  82 n); Pd: 0.000 (s: 0.74), Pa: 0.000 (s: 0.54)
 Exon  2  12723  12823 ( 101 n);  cDNA    213    310 (  98 n); score: 0.634
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.72), Pa: 0.000 (s: 0.76)
 Exon  3  12921  12990 (  70 n);  cDNA    311    380 (  70 n); score: 0.757
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.76), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13280 (  84 n);  cDNA    381    464 (  84 n); score: 0.869
  Intron  4  13281  13380 ( 100 n); Pd: 0.000 (s: 0.88), Pa: 1.000 (s: 0.80)
 Exon  5  13381  13467 (  87 n);  cDNA    465    551 (  87 n); score: 0.782
  Intron  5  13468  13886 ( 419 n); Pd: 0.992 (s: 0.72), Pa: 0.939 (s: 0.84)
 Exon  6  13887  13939 (  53 n);  cDNA    552    604 (  53 n); score: 0.830

MATCH	21326110+	20809597+	0.787	563	0.932	C
PGS_21326110+_20809597+	(12473  12640,12723  12823,12921  12990,13197  13280,13381  13467,13887  13939)

Alignment (genomic DNA sequence = upper lines):

GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCGC TCATCGTGGC GCACCTCCGT    12532
|||||||||| |||||||||| |||||||||| |||||||| | |||||||||| |||||||||  
GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCCC TCATCGTGGC GCACCTCCGG      108


AG-CCAGAAC CTCGGGCAGG CCG-CAGCCG CCGTCGCCGC CGCCACCATG ACCCCCATCT    12590
 | ||||||| |||  ||||| ||| || | | |||||||||| |||||||||| |||||||    
CGACCAGAAC CTCACGCAGG CCGCCACCGG CCGTCGCCGC CGCCACCATG ACCCCCAGGG      168


CCGCCGCCGA ATCCGTCCCC GCAAATCAAC TCCTACGTCT CGTGGCCAAG GTCCCCCCAC    12650
||| ||||    ||||| |||  | || || | |||| || || ||| | ||||            
CCGACGCC-- -TCCGT-CCC -C-AACCACC TCCTCCGCCT CGTCGGCAAG ..........      212


TTTCCCCTTC CTCCGGCAGT CTGGCCTAGG ATTTGTTCTG CACGGGCCTA AACCCTCACT    12710
                                                                  
.......... .......... .......... .......... .......... ..........      212


GTTGGTTCGC AGGGCCTCGC GGCGGAGGGC GGAGGAGGAG CCGCTTCCGC ATTCGACTCC    12770
             || ||||| ||  || |    ||||| | | | |     |  |  ||   |  
.......... ..GGTCTCGC GGTAGA-GCA AGAGGA-G-G CGGGGAGAGG AGGCGGAGCT      257


GCCGGGTTCG GTGGGGCGGT GCAGCCGCTC GGCTCCAGTG CCGTGGATTT CAGGTAAACC    12830
 |||     |  ||||  ||  ||  ||| || ||| ||| || |||||||||| |||        
CCCGCCGCGG CTGGGCTGGC GCGCCCGGTC GGCACCAATG CCGTGGATTT CAG.......      310


CCAACCTTGC GCCCCCGCGG TGTTGCCTAG TGGCAGTGTT TTTTCTGGTG CTGAACATTG    12890
                                                                  
.......... .......... .......... .......... .......... ..........      310


GTGAGGAGTG TTGACGCCGG TGCTGTGTAG TATGCAGGAT GTCAAGGGCT CATCCAAGAG    12950
                                 | ||||| || || | ||||  | |||||||  
.......... .......... .......... TGTGCAGAAT GTTAGGGGCC CGTCCAAGAC      340


CTTCCCCAAG CACGAGGCGA AGCATGTCTC TGACCATAAG GTGCTTATGA TTCCAATTTT    13010
 ||||||||| || ||  | |  |||  ||||  || ||||||                       
TTTCCCCAAG CATGAAACCA GGCACATCTC CGATCATAAG .......... ..........      380


CCCTTGCAAA TGCACCACTT GAAAGTTGAA ACAATTTTTG TGTCAGACTC CTGTTTATCT    13070
                                                                  
.......... .......... .......... .......... .......... ..........      380


GAATATTTAC TACTGCTATT GCACATTTTG CACTTATCAC AGTACCATGA TTATGTAGAC    13130
                                                                  
.......... .......... .......... .......... .......... ..........      380


AACTTGGGAT TGACCAACAA TAGATTTTAC TGATGTTTAT TGGCTTACCA TTGCATTTTT    13190
                                                                  
.......... .......... .......... .......... .......... ..........      380


CTGTAGAACG CTGCCCGGTG TGCGAAATTT AGTCCTGATG GGAAGTATTT TGCAACTGGG    13250
      || |  |||| | || ||| |||||| |||||||||| |||| ||||| |||||||||  
......AATG TTGCCAGATG TGCAAAATTT AGTCCTGATG GGAAATATTT TGCAACTGGA      434


AGTGCTGATA CATCCATTAA GTTTTTTGAG GTGAACTTGA AATTTGAATT GCCACTCAGG    13310
||||  || | |||||||||| ||| ||||||                                  
AGTGGGGACA CATCCATTAA GTTCTTTGAG .......... .......... ..........      464


TTGCTAGGTG GGGCTTGTGC TGTTTTCTAC TTAGTTGCAA CTTGTAACTC ACTATTGCTC    13370
                                                                  
.......... .......... .......... .......... .......... ..........      464


TGTCCTGCAG GTTGCTAAAA TTAAGCAGAC TATGGTAGGG GACTCCAAAG ATGGTCCTGC    13430
           ||  | |||| |||||||||| |||| ||||  |||||||||| |  |  |||  
.......... GTGTCGAAAA TTAAGCAGAC TATGTTAGGA GACTCCAAAG AAAGCTCTGG      514


CAGGCCTGTG ATTCGCACAT TTTATGATCA CACACAGGTG AGCATGTATT GCTCATATAT    13490
| ||||||||  | || |||| ||||||| ||     |||                          
CCGGCCTGTG GTCCGTACAT TTTATGACCA TGTGCAG... .......... ..........      551


GACAGTTTAT TTACTCTTCA AGGTCGTGAG ACTCTTTTCA ACACTTCCAC AAGATTGCCT    13550
                                                                  
.......... .......... .......... .......... .......... ..........      551


CCGAGTTAGG TCTCCTGCAG TATTTTTTTT CCTTTAATAT GCGGAGAGCT GCATATCATT    13610
                                                                  
.......... .......... .......... .......... .......... ..........      551


GCATTATAGA AAGACTGAAA TACATGGGTA GATCAAATCC ACCTGCCACC ACAGACCACA    13670
                                                                  
.......... .......... .......... .......... .......... ..........      551


CTTATATACA CACGCTCAAC TCACGTTTAG CACACTGGAT GCACACCTAG CAGCTGCAAT    13730
                                                                  
.......... .......... .......... .......... .......... ..........      551


TTGTAGTTAG ATATTTGCTT ACTGAGCTGT GTGGAGCATT GACATGATAT TCAATTTTTT    13790
                                                                  
.......... .......... .......... .......... .......... ..........      551


AATAAACAAC ATTTTTTTCC ATTTTCACTA GTTTCTACTT CATTTCCCAT TGCTCAAATT    13850
                                                                  
.......... .......... .......... .......... .......... ..........      551


TCCACTGTGC TCGTAAACAT GATTGATTTC TTGCAGGCCA TCAATGATCT GGATTTTCAT    13910
                                        ||| |||||||||| |||||| ||| 
.......... .......... .......... ......CCCA TCAATGATCT GGATTTCCAT      575


CCTGAGAGTC CAATACTGAT ATCAGCTGC    13939
|||   || | |||||||||| ||| |  ||
CCTATTAGCC CAATACTGAT ATCTGGAGC      604





********************************************************************************
EST sequence   83 +strand (File: 9661046+)

     1  CCCGTTTCAT TAGCTCCCTT CCACTCCGTC AGAGATGGAC GCGGCGGTGC AGGAGGCGAA
    61  GCTGCTGCGG CAGGTGAACG CCCTCATCGT GGCGCACCTC CGCGACCAGA ACCTCACGCA
   121  GGCCGCCACC GCCGTCGCCG CCGCCACCAT GACCCCCAAG GCCGACGCCT CCGTCCCCAA
   181  CCACCTCCTC CGCCTCGTCG CCAAGGGCCT CGCCGCCGAG CGGGAGGAGG CGGCCAGGGG
   241  AGGCGGAGCT CCCGCCGCGT TTGACTCCGC TGCTGGCGGC GGTGGGCCGG CGCGCCCGCT
   301  CGGCACCAAT GCCGTGGATT TCAGTGTGCA GAATGTTAGG GGCCCGTCCA AGACTTTCCC
   361  CAAGCATGAA ACCAGGCACA TCTCCGATCA TAAGAATGTT GCCAGATGTG CAAAATTTAG
   421  TCCTGATGGG AAATATTTTG CAACTGGAAG TGGGGACACA TCCATTAAGT TCTTTGAGGT
   481  ATCGAAAATT A

Predicted gene structure (within gDNA segment 11962 to 13678):

 Exon  1  12473  12650 ( 178 n);  cDNA     44    216 ( 173 n); score: 0.843
  Intron  1  12651  12717 (  67 n); Pd: 0.000 (s: 0.73), Pa: 0.000 (s: 0.64)
 Exon  2  12718  12823 ( 106 n);  cDNA    217    324 ( 108 n); score: 0.689
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.82), Pa: 0.000 (s: 0.76)
 Exon  3  12921  12990 (  70 n);  cDNA    325    394 (  70 n); score: 0.757
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.76), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13295 (  99 n);  cDNA    395    491 (  97 n); score: 0.828

MATCH	21326110+	9661046+	0.790	453	0.923	C
PGS_21326110+_9661046+	(12473  12650,12718  12823,12921  12990,13197  13295)

Alignment (genomic DNA sequence = upper lines):

GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCGC TCATCGTGGC GCACCTCCGT    12532
|||||||||| |||||||||| |||||||||| |||||||| | |||||||||| |||||||||  
GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCCC TCATCGTGGC GCACCTCCGC      103


AGCCAGAACC TCGGGCAGGC CGCAGCCGCC GTCGCCGCCG CCACCATGAC CCCCATCTCC    12592
  |||||||| ||  |||||| |||  ||||| |||||||||| |||||||||| |||||   || 
GACCAGAACC TCACGCAGGC CGCCACCGCC GTCGCCGCCG CCACCATGAC CCCCAAGGCC      163


GCCGCCGAAT CCGTCCCCGC AAATCAACTC CTACGTCTCG TGGCCAAGGT CC-CCCCACT    12651
| ||||   | |||| ||| |  || || ||| || || |||| | |||||||  || | || |  
GACGCC---T CCGT-CCC-C -AACCACCTC CTCCGCCTCG TCGCCAAGGG CCTCGCCGC.      216


TTCCCCTTCC TCCGGCAGTC TGGCCTAGGA TTTGTTCTGC ACGGGCCTAA ACCCTCACTG    12711
                                                                  
.......... .......... .......... .......... .......... ..........      216


TTGGTTCGCA GGGCCTCGCG GCGGAGGGCG GAGGAGGAGC CGCTTCCGCA TTCGACTCCG    12771
      || | | |    | | ||||   | | |||| |||||   |  ||||  || ||||||| 
......CG-A GCGGGAGGAG GCGGCCAGGG GAGGCGGAGC TCCCGCCGCG TTTGACTCCG      269


C--C-GGGTT CGGTGGGGCG GTGCAGCCGC TCGGCTCCAG TGCCGTGGAT TTCAGGTAAA    12828
|  | ||    ||||||| || | ||  |||| ||||| |||  |||||||||| |||||      
CTGCTGGCGG CGGTGGGCCG GCGCGCCCGC TCGGCACCAA TGCCGTGGAT TTCAG.....      324


CCCCAACCTT GCGCCCCCGC GGTGTTGCCT AGTGGCAGTG TTTTTTCTGG TGCTGAACAT    12888
                                                                  
.......... .......... .......... .......... .......... ..........      324


TGGTGAGGAG TGTTGACGCC GGTGCTGTGT AGTATGCAGG ATGTCAAGGG CTCATCCAAG    12948
                                   | |||||  |||| | ||| | | |||||| 
.......... .......... .......... ..TGTGCAGA ATGTTAGGGG CCCGTCCAAG      352


AGCTTCCCCA AGCACGAGGC GAAGCATGTC TCTGACCATA AGGTGCTTAT GATTCCAATT    13008
|  ||||||| |||| ||  |  | |||  || || || |||| ||                    
ACTTTCCCCA AGCATGAAAC CAGGCACATC TCCGATCATA AG........ ..........      394


TTCCCTTGCA AATGCACCAC TTGAAAGTTG AAACAATTTT TGTGTCAGAC TCCTGTTTAT    13068
                                                                  
.......... .......... .......... .......... .......... ..........      394


CTGAATATTT ACTACTGCTA TTGCACATTT TGCACTTATC ACAGTACCAT GATTATGTAG    13128
                                                                  
.......... .......... .......... .......... .......... ..........      394


ACAACTTGGG ATTGACCAAC AATAGATTTT ACTGATGTTT ATTGGCTTAC CATTGCATTT    13188
                                                                  
.......... .......... .......... .......... .......... ..........      394


TTCTGTAGAA CGCTGCCCGG TGTGCGAAAT TTAGTCCTGA TGGGAAGTAT TTTGCAACTG    13248
        ||  | |||| |  ||||| |||| |||||||||| |||||| ||| |||||||||| 
........AA TGTTGCCAGA TGTGCAAAAT TTAGTCCTGA TGGGAAATAT TTTGCAACTG      446


GGAGTGCTGA TACATCCATT AAGTTTTTTG AGGTGAACTT GAAATTT    13295
| ||||  ||  ||||||||| ||||| |||| |||| | |    ||||| 
GAAGTGGGGA CACATCCATT AAGTTCTTTG AGGT-ATC-G AAAATTA      491





********************************************************************************
EST sequence   10 +strand (File: 9359764+)

     1  CGGACGCGTG GGCGGGGGCC GAGAGATGGA CGCGGCGGTG CAGGAGGCGA AGCTGCTGCG
    61  GCAGGTGAAC GCCCTCATCG TGGCGCACCT CCGCGACCAG AACCTCACGC AGGCCGCCAC
   121  CGCCGTCGCC GCCGCCACCA TGACCCCCAA GGCCGACGCC TCCGCCCCCA ACCACCTCCT
   181  CCGCCTCGTC GCCAAAGGCC TCGCGGCCGA GCGGGAGGAG GAGGCTAGGG GAGGCGGATA
   241  TCCCGCCGCG TTTGACCCCG CCGCGGTCGC TGCGGGCGGC GGGCTGGCGC GCCCTCTCGG
   301  CACCAATGCC GTGGATTTCA GTGTGCAGAA TGTTAGGGGC CCGTCCAAGA CTTTCCCCAA
   361  GCATGAAACC AGGCACATCT CCGATCATAA GAATGTTGCC AGATGTGCAA AATTTAGTCC
   421  TGATGGGAAA TATTTTGCAA CTGGAAGTGG GGACACA

Predicted gene structure (within gDNA segment 12007 to 13619):

 Exon  1  12473  12642 ( 170 n);  cDNA     35    198 ( 164 n); score: 0.853
  Intron  1  12643  12703 (  61 n); Pd: 0.000 (s: 0.72), Pa: 0.000 (s: 0.50)
 Exon  2  12704  12823 ( 120 n);  cDNA    199    321 ( 123 n); score: 0.558
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.76), Pa: 0.000 (s: 0.76)
 Exon  3  12921  12990 (  70 n);  cDNA    322    391 (  70 n); score: 0.757
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 0.76), Pa: 0.978 (s: 0.88)
 Exon  4  13197  13262 (  66 n);  cDNA    392    457 (  66 n); score: 0.848

MATCH	21326110+	9359764+	0.754	426	0.932	C
PGS_21326110+_9359764+	(12473  12642,12704  12823,12921  12990,13197  13262)

Alignment (genomic DNA sequence = upper lines):

GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCGC TCATCGTGGC GCACCTCCGT    12532
|||||||||| |||||||||| |||||||||| |||||||| | |||||||||| |||||||||  
GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCCC TCATCGTGGC GCACCTCCGC       94


AGCCAGAACC TCGGGCAGGC CGCAGCCGCC GTCGCCGCCG CCACCATGAC CCCCATCTCC    12592
  |||||||| ||  |||||| |||  ||||| |||||||||| |||||||||| |||||   || 
GACCAGAACC TCACGCAGGC CGCCACCGCC GTCGCCGCCG CCACCATGAC CCCCAAGGCC      154


GCCGCCGAAT CCGTCCCCGC AAATCAACTC CTACGTCTCG TGGCCAAGGT CCCCCCACTT    12652
| ||||   | ||| |||| |  || || ||| || || |||| | ||||| |             
GACGCC---T CCG-CCCC-C -AACCACCTC CTCCGCCTCG TCGCCAAAGG ..........      198


TCCCCTTCCT CCGGCAGTCT GGCCTAGGAT TTGTTCTGCA CGGGCCTAAA CCCTCACTGT    12712
                                                        |||| | |  
.......... .......... .......... .......... .......... .CCTCGCGGC      207


TGGTTCGCAG GGCCTCGCGG CGGAGGGCGG AGGAGGAGCC GCTTCCGCAT TCGACTCCG-    12771
 |    | || |     ||    ||  ||||| |      ||| || |  |     || | | |  
CGAGCGGGAG GAGGAGGCTA GGGGAGGCGG ATATCCCGCC GCGTTTGACC CCGCCGCGGT      267


C-C-GGGTTC GGTGGGGCGG TGCAGCCGCT CGGCTCCAGT GCCGTGGATT TCAGGTAAAC    12829
| | | |  | || |||  ||  ||  || || |||| ||| | |||||||||| ||||       
CGCTGCGGGC GGCGGGCTGG CGCGCCCTCT CGGCACCAAT GCCGTGGATT TCAG......      321


CCCAACCTTG CGCCCCCGCG GTGTTGCCTA GTGGCAGTGT TTTTTCTGGT GCTGAACATT    12889
                                                                  
.......... .......... .......... .......... .......... ..........      321


GGTGAGGAGT GTTGACGCCG GTGCTGTGTA GTATGCAGGA TGTCAAGGGC TCATCCAAGA    12949
                                  | ||||| | ||| | ||||  | ||||||| 
.......... .......... .......... .TGTGCAGAA TGTTAGGGGC CCGTCCAAGA      350


GCTTCCCCAA GCACGAGGCG AAGCATGTCT CTGACCATAA GGTGCTTATG ATTCCAATTT    13009
  |||||||| ||| ||  |  | |||  ||| | || ||||| |                     
CTTTCCCCAA GCATGAAACC AGGCACATCT CCGATCATAA G......... ..........      391


TCCCTTGCAA ATGCACCACT TGAAAGTTGA AACAATTTTT GTGTCAGACT CCTGTTTATC    13069
                                                                  
.......... .......... .......... .......... .......... ..........      391


TGAATATTTA CTACTGCTAT TGCACATTTT GCACTTATCA CAGTACCATG ATTATGTAGA    13129
                                                                  
.......... .......... .......... .......... .......... ..........      391


CAACTTGGGA TTGACCAACA ATAGATTTTA CTGATGTTTA TTGGCTTACC ATTGCATTTT    13189
                                                                  
.......... .......... .......... .......... .......... ..........      391


TCTGTAGAAC GCTGCCCGGT GTGCGAAATT TAGTCCTGAT GGGAAGTATT TTGCAACTGG    13249
       ||  | |||| | | |||| ||||| |||||||||| ||||| |||| |||||||||| 
.......AAT GTTGCCAGAT GTGCAAAATT TAGTCCTGAT GGGAAATATT TTGCAACTGG      444


GAGTGCTGAT ACA    13262
 ||||  ||  |||
AAGTGGGGAC ACA      457





********************************************************************************
EST sequence   74 +strand (File: 21935116+)

     1  GGAGGACGGA GGGGAGGGCC GAGATGGACG CGGCGGTGCA GGAGGCCAAG CTGCTGCGGC
    61  AGGTGAACGC CCTCATCGTG GCGCACCTCC GCGACCAGAA CCTCACGCAG GCCGCCGCCG
   121  CCGTCGCCGC CGCCACCATG ACCCCCAAGG CCGACGCCTC CCTCCCCAAC CACCTCCTCC
   181  GCCTCGTCGC CAAGGGCCTC GCGGCTGAGC GGGAGGAGGC GGCCAGGGGA GGCGGAGCTC
   241  CCCCCGCGTT TGACTCCGCT GGCGGCGGTG GGCTGGCGCG CCCGCTCGGC ACCAGCGCCG
   301  TGGATTTCAG TGTGCAGAAT GTCAGGGGCC CG

Predicted gene structure (within gDNA segment 12017 to 13238):

 Exon  1  12473  12648 ( 176 n);  cDNA     33    202 ( 170 n); score: 0.847
  Intron  1  12649  12713 (  65 n); Pd: 0.000 (s: 0.70), Pa: 0.000 (s: 0.62)
 Exon  2  12714  12823 ( 110 n);  cDNA    203    310 ( 108 n); score: 0.718
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 0.80), Pa: 0.000 (s:    0)
 Exon  3  12921  12942 (  22 n);  cDNA    311    332 (  22 n); score: 0.773

MATCH	21326110+	21935116+	0.797	308	0.928	C
PGS_21326110+_21935116+	(12473  12648,12714  12823,12921  12942)

Alignment (genomic DNA sequence = upper lines):

GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCGC TCATCGTGGC GCACCTCCGT    12532
|||||||||| |||| ||||| |||||||||| |||||||| | |||||||||| |||||||||  
GCGGTGCAGG AGGCCAAGCT GCTGCGGCAG GTGAACGCCC TCATCGTGGC GCACCTCCGC       92


AGCCAGAACC TCGGGCAGGC CGCAGCCGCC GTCGCCGCCG CCACCATGAC CCCCATCTCC    12592
  |||||||| ||  |||||| ||| |||||| |||||||||| |||||||||| |||||   || 
GACCAGAACC TCACGCAGGC CGCCGCCGCC GTCGCCGCCG CCACCATGAC CCCCAAGGCC      152


GCCGCCGAAT CCGTCCCCGC AAATCAACTC CTACGTCTCG TGGCCAAGGT CCCCCCACTT    12652
| ||||   | || | ||| |  || || ||| || || |||| | |||||||  || | |     
GACGCC---T CCCT-CCC-C -AACCACCTC CTCCGCCTCG TCGCCAAGGG CCTCGC....      202


TCCCCTTCCT CCGGCAGTCT GGCCTAGGAT TTGTTCTGCA CGGGCCTAAA CCCTCACTGT    12712
                                                                  
.......... .......... .......... .......... .......... ..........      202


TGGTTCGCAG GGCCTCGCGG CGGAGGGCGG AGGAGGAGCC GCTTCCGCAT TCGACTCCGC    12772
 || | | ||  |    | || |||   | || ||| |||||   |  |||| | | |||||||| 
.GGCT-G-AG CGGGAGGAGG CGGCCAGGGG AGGCGGAGCT CCCCCCGCGT TTGACTCCGC      259


CGGGTTCGGT GGGGCGGTGC AGCCGCTCGG CTCCAGTGCC GTGGATTTCA GGTAAACCCC    12832
 ||   |||| |||  || ||   |||||||| | |||| ||| |||||||||| |          
TGGCGGCGGT GGGCTGGCGC GCCCGCTCGG CACCAGCGCC GTGGATTTCA G.........      310


AACCTTGCGC CCCCGCGGTG TTGCCTAGTG GCAGTGTTTT TTCTGGTGCT GAACATTGGT    12892
                                                                  
.......... .......... .......... .......... .......... ..........      310


GAGGAGTGTT GACGCCGGTG CTGTGTAGTA TGCAGGATGT CAAGGGCTCA    12942
                              |  ||||| |||| || |||| |  
.......... .......... ........TG TGCAGAATGT CAGGGGCCCG      332





********************************************************************************
EST sequence   60 +strand (File: 14593236+)

     1  GCACGAGGCG AATCCGTCCC CGCAAATCAA CTCCTACGTC TCGTGGCCAA GGGCCTCGCG
    61  GCGGAGGGCG GAGGAGGAGC CGCTTCCGCA TTCGACTCCG CCGGGTTCGG TGGGGCGGTG
   121  CAGCCGCTCG GCTCCAGTGC CGTGGATTTC AGTATGCAGG ATGTCAAGGG CTCATCCAAG
   181  AGCTTCCCCA AGCACGAGGC GAAGCATGTC TCTGACCATA AGAACGCTGC CCGGTGTGCG
   241  AAATTTAGTC CTGATGGGAA GTATTTTGCA ACTGGGAGTG CTGATACATC CATTAAGTTT
   301  TTTGAGGTTG CTAAAATTAA GCAGACTATG GTAGGGGACT CCAAAGATGG TCCTGCCAGG
   361  CCTGTGATTC GCACATTTTA TGATCACACA CAGGCCATCA ATGATCTGGA TTTTCATCCT
   421  GAGAGTCCAA TACTGATATC AGCTGCAAAA GACAATACAA TAAAATTTTT TGACTTCTCA
   481  AAGACCAATG CGAGGAAAGC GTTCAGAGTT ATTCAGGATA CTC

Predicted gene structure (within gDNA segment 12258 to 14497):

 Exon  1  12590  12640 (  51 n);  cDNA      1     51 (  51 n); score: 0.882
  Intron  1  12641  12722 (  82 n); Pd: 0.000 (s: 0.90), Pa: 0.000 (s: 1.00)
 Exon  2  12723  12823 ( 101 n);  cDNA     52    152 ( 101 n); score: 1.000
  Intron  2  12824  12920 (  97 n); Pd: 0.511 (s: 1.00), Pa: 0.000 (s: 1.00)
 Exon  3  12921  12990 (  70 n);  cDNA    153    222 (  70 n); score: 1.000
  Intron  3  12991  13196 ( 206 n); Pd: 0.964 (s: 1.00), Pa: 0.978 (s: 1.00)
 Exon  4  13197  13280 (  84 n);  cDNA    223    306 (  84 n); score: 1.000
  Intron  4  13281  13380 ( 100 n); Pd: 0.000 (s: 1.00), Pa: 1.000 (s: 1.00)
 Exon  5  13381  13467 (  87 n);  cDNA    307    393 (  87 n); score: 1.000
  Intron  5  13468  13886 ( 419 n); Pd: 0.992 (s: 1.00), Pa: 0.939 (s: 1.00)
 Exon  6  13887  13957 (  71 n);  cDNA    394    464 (  71 n); score: 1.000
  Intron  6  13958  14109 ( 152 n); Pd: 0.973 (s: 1.00), Pa: 0.989 (s: 1.00)
 Exon  7  14110  14161 (  52 n);  cDNA    465    516 (  52 n); score: 1.000
  Intron  7  14162  14253 (  92 n); Pd: 0.890 (s: 1.00), Pa: 0.830 (s:    0)
 Exon  8  14254  14260 (   7 n);  cDNA    517    523 (   7 n); score: 1.000

MATCH	21326110+	14593236+	0.988	523	1.000	C
PGS_21326110+_14593236+	(12590  12640,12723  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14260)

Alignment (genomic DNA sequence = upper lines):

TCCGCCGCCG AATCCGTCCC CGCAAATCAA CTCCTACGTC TCGTGGCCAA GGTCCCCCCA    12649
 |    | || |||||||||| |||||||||| |||||||||| |||||||||| |          
GCACGAGGCG AATCCGTCCC CGCAAATCAA CTCCTACGTC TCGTGGCCAA G.........       51


CTTTCCCCTT CCTCCGGCAG TCTGGCCTAG GATTTGTTCT GCACGGGCCT AAACCCTCAC    12709
                                                                  
.......... .......... .......... .......... .......... ..........       51


TGTTGGTTCG CAGGGCCTCG CGGCGGAGGG CGGAGGAGGA GCCGCTTCCG CATTCGACTC    12769
              ||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.......... ...GGCCTCG CGGCGGAGGG CGGAGGAGGA GCCGCTTCCG CATTCGACTC       98


CGCCGGGTTC GGTGGGGCGG TGCAGCCGCT CGGCTCCAGT GCCGTGGATT TCAGGTAAAC    12829
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| ||||       
CGCCGGGTTC GGTGGGGCGG TGCAGCCGCT CGGCTCCAGT GCCGTGGATT TCAG......      152


CCCAACCTTG CGCCCCCGCG GTGTTGCCTA GTGGCAGTGT TTTTTCTGGT GCTGAACATT    12889
                                                                  
.......... .......... .......... .......... .......... ..........      152


GGTGAGGAGT GTTGACGCCG GTGCTGTGTA GTATGCAGGA TGTCAAGGGC TCATCCAAGA    12949
                                  ||||||||| |||||||||| |||||||||| 
.......... .......... .......... .TATGCAGGA TGTCAAGGGC TCATCCAAGA      181


GCTTCCCCAA GCACGAGGCG AAGCATGTCT CTGACCATAA GGTGCTTATG ATTCCAATTT    13009
|||||||||| |||||||||| |||||||||| |||||||||| |                     
GCTTCCCCAA GCACGAGGCG AAGCATGTCT CTGACCATAA G......... ..........      222


TCCCTTGCAA ATGCACCACT TGAAAGTTGA AACAATTTTT GTGTCAGACT CCTGTTTATC    13069
                                                                  
.......... .......... .......... .......... .......... ..........      222


TGAATATTTA CTACTGCTAT TGCACATTTT GCACTTATCA CAGTACCATG ATTATGTAGA    13129
                                                                  
.......... .......... .......... .......... .......... ..........      222


CAACTTGGGA TTGACCAACA ATAGATTTTA CTGATGTTTA TTGGCTTACC ATTGCATTTT    13189
                                                                  
.......... .......... .......... .......... .......... ..........      222


TCTGTAGAAC GCTGCCCGGT GTGCGAAATT TAGTCCTGAT GGGAAGTATT TTGCAACTGG    13249
       ||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.......AAC GCTGCCCGGT GTGCGAAATT TAGTCCTGAT GGGAAGTATT TTGCAACTGG      275


GAGTGCTGAT ACATCCATTA AGTTTTTTGA GGTGAACTTG AAATTTGAAT TGCCACTCAG    13309
|||||||||| |||||||||| |||||||||| |                                
GAGTGCTGAT ACATCCATTA AGTTTTTTGA G......... .......... ..........      306


GTTGCTAGGT GGGGCTTGTG CTGTTTTCTA CTTAGTTGCA ACTTGTAACT CACTATTGCT    13369
                                                                  
.......... .......... .......... .......... .......... ..........      306


CTGTCCTGCA GGTTGCTAAA ATTAAGCAGA CTATGGTAGG GGACTCCAAA GATGGTCCTG    13429
            ||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.......... .GTTGCTAAA ATTAAGCAGA CTATGGTAGG GGACTCCAAA GATGGTCCTG      355


CCAGGCCTGT GATTCGCACA TTTTATGATC ACACACAGGT GAGCATGTAT TGCTCATATA    13489
|||||||||| |||||||||| |||||||||| ||||||||                         
CCAGGCCTGT GATTCGCACA TTTTATGATC ACACACAG.. .......... ..........      393


TGACAGTTTA TTTACTCTTC AAGGTCGTGA GACTCTTTTC AACACTTCCA CAAGATTGCC    13549
                                                                  
.......... .......... .......... .......... .......... ..........      393


TCCGAGTTAG GTCTCCTGCA GTATTTTTTT TCCTTTAATA TGCGGAGAGC TGCATATCAT    13609
                                                                  
.......... .......... .......... .......... .......... ..........      393


TGCATTATAG AAAGACTGAA ATACATGGGT AGATCAAATC CACCTGCCAC CACAGACCAC    13669
                                                                  
.......... .......... .......... .......... .......... ..........      393


ACTTATATAC ACACGCTCAA CTCACGTTTA GCACACTGGA TGCACACCTA GCAGCTGCAA    13729
                                                                  
.......... .......... .......... .......... .......... ..........      393


TTTGTAGTTA GATATTTGCT TACTGAGCTG TGTGGAGCAT TGACATGATA TTCAATTTTT    13789
                                                                  
.......... .......... .......... .......... .......... ..........      393


TAATAAACAA CATTTTTTTC CATTTTCACT AGTTTCTACT TCATTTCCCA TTGCTCAAAT    13849
                                                                  
.......... .......... .......... .......... .......... ..........      393


TTCCACTGTG CTCGTAAACA TGATTGATTT CTTGCAGGCC ATCAATGATC TGGATTTTCA    13909
                                        ||| |||||||||| |||||||||| 
.......... .......... .......... .......GCC ATCAATGATC TGGATTTTCA      416


TCCTGAGAGT CCAATACTGA TATCAGCTGC AAAAGACAAT ACAATAAAGT ATGCTTATCC    13969
|||||||||| |||||||||| |||||||||| |||||||||| ||||||||              
TCCTGAGAGT CCAATACTGA TATCAGCTGC AAAAGACAAT ACAATAAA.. ..........      464


TTGATGTCTA CACTCCGTGC TGTTAAATTG TCTATTTGAA GTGCTCATAC TAGGATTAAG    14029
                                                                  
.......... .......... .......... .......... .......... ..........      464


CATGATTTTT TAGGAATTTT TTGCGGTATT AATTGCTATC TGTGTTATTG TTTTGTACAT    14089
                                                                  
.......... .......... .......... .......... .......... ..........      464


GAAAAAATTT TGCTCAACAG ATTTTTTGAC TTCTCAAAGA CCAATGCGAG GAAAGCGTTC    14149
                      |||||||||| |||||||||| |||||||||| |||||||||| 
.......... .......... ATTTTTTGAC TTCTCAAAGA CCAATGCGAG GAAAGCGTTC      504


AGAGTTATTC AGGTTGTAAA TTCTAGCAAT CCAATCTCTC TATATATCAT GTAAAATGGT    14209
|||||||||| ||                                                     
AGAGTTATTC AG........ .......... .......... .......... ..........      516


GTGTTCATTG CATTTAACCA GGCTCATTTG TTAATGCTTG GCAGGATACT C    14260
                                                |||||| |
.......... .......... .......... .......... ....GATACT C      523





********************************************************************************
EST sequence  106 -strand (File: 22490341-)

     1  ACTCCGCCGG GTTCGGTGTG GCGGTGCAGC CGCCCGGCTC CAGTGCCGTG GATTTCAGTA
    61  TTCAGGATGT CAAGGGCTCA TCCAAAAGCT TCCCCAAGCA CGAGGTGAAG CATGTCTCTG
   121  ACCATAAGAA CGCTGCCCGG TGTGTGAAAT TTAGTCCTGA TGGAAAGTAT TTTGCAACTG
   181  GGAGTGCTGA TACATCCATT AAGTTTTTTG AGGTTGCTAA GATTAAGCAG ACTATGGTAG
   241  GAGACTCTAA AGATGGCCCT GCCAGGCCTG TGATACGGAC ATTTTATGAT CACACACAGG
   301  CCATCAATGA TCTGGATTTT CATCCTGAGA GTCCAATACT GATATCAGCT GCAAAAGACA
   361  GTACAATAAG ATTCTTTGAC TTTTCAAAAA CCAATGCGAG GAAAGCGTTC AGAGTTATTC
   421  AGGATACTCA TAATGTTAGA TCTGTATGTT TTCATCCTTG TGGGGATTTC CTTTTAGCAG
   481  GGACTGATCA CCCAGTCGCT CATTTATATG ATATAAATAC TTTTACATGC TACTTATCAG
   541  CAAATGCACA GGATTCTAGT TCTCCCCGAC AGCAACG

Predicted gene structure (within gDNA segment 12461 to 15125):

 Exon  1  12766  12823 (  58 n);  cDNA      1     58 (  58 n); score: 0.966
  Intron  1  12824  12920 (  97 n); Pd: 0.511 (s: 0.96), Pa: 0.000 (s: 0.94)
 Exon  2  12921  12990 (  70 n);  cDNA     59    128 (  70 n); score: 0.957
  Intron  2  12991  13196 ( 206 n); Pd: 0.964 (s: 0.96), Pa: 0.978 (s: 0.96)
 Exon  3  13197  13280 (  84 n);  cDNA    129    212 (  84 n); score: 0.976
  Intron  3  13281  13380 ( 100 n); Pd: 0.000 (s: 0.98), Pa: 1.000 (s: 0.92)
 Exon  4  13381  13467 (  87 n);  cDNA    213    299 (  87 n); score: 0.931
  Intron  4  13468  13886 ( 419 n); Pd: 0.992 (s: 0.94), Pa: 0.939 (s: 1.00)
 Exon  5  13887  13957 (  71 n);  cDNA    300    370 (  71 n); score: 0.972
  Intron  5  13958  14109 ( 152 n); Pd: 0.973 (s: 0.96), Pa: 0.989 (s: 0.94)
 Exon  6  14110  14161 (  52 n);  cDNA    371    422 (  52 n); score: 0.942
  Intron  6  14162  14253 (  92 n); Pd: 0.890 (s: 0.94), Pa: 0.830 (s: 0.98)
 Exon  7  14254  14311 (  58 n);  cDNA    423    480 (  58 n); score: 0.983
  Intron  7  14312  14684 ( 373 n); Pd: 0.979 (s: 0.98), Pa: 0.910 (s: 0.98)
 Exon  8  14685  14779 (  95 n);  cDNA    481    575 (  95 n); score: 0.926

MATCH	21326110+	22490341-	0.955	575	0.997	C
PGS_21326110+_22490341-	(12766  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779)

Alignment (genomic DNA sequence = upper lines):

ACTCCGCCGG GTTCGGTGGG GCGGTGCAGC CGCTCGGCTC CAGTGCCGTG GATTTCAGGT    12825
|||||||||| |||||||| | |||||||||| ||| |||||| |||||||||| ||||||||   
ACTCCGCCGG GTTCGGTGTG GCGGTGCAGC CGCCCGGCTC CAGTGCCGTG GATTTCAG..       58


AAACCCCAAC CTTGCGCCCC CGCGGTGTTG CCTAGTGGCA GTGTTTTTTC TGGTGCTGAA    12885
                                                                  
.......... .......... .......... .......... .......... ..........       58


CATTGGTGAG GAGTGTTGAC GCCGGTGCTG TGTAGTATGC AGGATGTCAA GGGCTCATCC    12945
                                      ||| | |||||||||| |||||||||| 
.......... .......... .......... .....TATTC AGGATGTCAA GGGCTCATCC       83


AAGAGCTTCC CCAAGCACGA GGCGAAGCAT GTCTCTGACC ATAAGGTGCT TATGATTCCA    13005
|| ||||||| |||||||||| || ||||||| |||||||||| |||||                 
AAAAGCTTCC CCAAGCACGA GGTGAAGCAT GTCTCTGACC ATAAG..... ..........      128


ATTTTCCCTT GCAAATGCAC CACTTGAAAG TTGAAACAAT TTTTGTGTCA GACTCCTGTT    13065
                                                                  
.......... .......... .......... .......... .......... ..........      128


TATCTGAATA TTTACTACTG CTATTGCACA TTTTGCACTT ATCACAGTAC CATGATTATG    13125
                                                                  
.......... .......... .......... .......... .......... ..........      128


TAGACAACTT GGGATTGACC AACAATAGAT TTTACTGATG TTTATTGGCT TACCATTGCA    13185
                                                                  
.......... .......... .......... .......... .......... ..........      128


TTTTTCTGTA GAACGCTGCC CGGTGTGCGA AATTTAGTCC TGATGGGAAG TATTTTGCAA    13245
            ||||||||| ||||||| || |||||||||| |||||| ||| |||||||||| 
.......... .AACGCTGCC CGGTGTGTGA AATTTAGTCC TGATGGAAAG TATTTTGCAA      177


CTGGGAGTGC TGATACATCC ATTAAGTTTT TTGAGGTGAA CTTGAAATTT GAATTGCCAC    13305
|||||||||| |||||||||| |||||||||| |||||                            
CTGGGAGTGC TGATACATCC ATTAAGTTTT TTGAG..... .......... ..........      212


TCAGGTTGCT AGGTGGGGCT TGTGCTGTTT TCTACTTAGT TGCAACTTGT AACTCACTAT    13365
                                                                  
.......... .......... .......... .......... .......... ..........      212


TGCTCTGTCC TGCAGGTTGC TAAAATTAAG CAGACTATGG TAGGGGACTC CAAAGATGGT    13425
                ||||| ||| |||||| |||||||||| |||| |||||  ||||||||  
.......... .....GTTGC TAAGATTAAG CAGACTATGG TAGGAGACTC TAAAGATGGC      257


CCTGCCAGGC CTGTGATTCG CACATTTTAT GATCACACAC AGGTGAGCAT GTATTGCTCA    13485
|||||||||| ||||||| ||  ||||||||| |||||||||| ||                    
CCTGCCAGGC CTGTGATACG GACATTTTAT GATCACACAC AG........ ..........      299


TATATGACAG TTTATTTACT CTTCAAGGTC GTGAGACTCT TTTCAACACT TCCACAAGAT    13545
                                                                  
.......... .......... .......... .......... .......... ..........      299


TGCCTCCGAG TTAGGTCTCC TGCAGTATTT TTTTTCCTTT AATATGCGGA GAGCTGCATA    13605
                                                                  
.......... .......... .......... .......... .......... ..........      299


TCATTGCATT ATAGAAAGAC TGAAATACAT GGGTAGATCA AATCCACCTG CCACCACAGA    13665
                                                                  
.......... .......... .......... .......... .......... ..........      299


CCACACTTAT ATACACACGC TCAACTCACG TTTAGCACAC TGGATGCACA CCTAGCAGCT    13725
                                                                  
.......... .......... .......... .......... .......... ..........      299


GCAATTTGTA GTTAGATATT TGCTTACTGA GCTGTGTGGA GCATTGACAT GATATTCAAT    13785
                                                                  
.......... .......... .......... .......... .......... ..........      299


TTTTTAATAA ACAACATTTT TTTCCATTTT CACTAGTTTC TACTTCATTT CCCATTGCTC    13845
                                                                  
.......... .......... .......... .......... .......... ..........      299


AAATTTCCAC TGTGCTCGTA AACATGATTG ATTTCTTGCA GGCCATCAAT GATCTGGATT    13905
                                             ||||||||| |||||||||| 
.......... .......... .......... .......... .GCCATCAAT GATCTGGATT      318


TTCATCCTGA GAGTCCAATA CTGATATCAG CTGCAAAAGA CAATACAATA AAGTATGCTT    13965
|||||||||| |||||||||| |||||||||| |||||||||| || ||||||| |          
TTCATCCTGA GAGTCCAATA CTGATATCAG CTGCAAAAGA CAGTACAATA AG........      370


ATCCTTGATG TCTACACTCC GTGCTGTTAA ATTGTCTATT TGAAGTGCTC ATACTAGGAT    14025
                                                                  
.......... .......... .......... .......... .......... ..........      370


TAAGCATGAT TTTTTAGGAA TTTTTTGCGG TATTAATTGC TATCTGTGTT ATTGTTTTGT    14085
                                                                  
.......... .......... .......... .......... .......... ..........      370


ACATGAAAAA ATTTTGCTCA ACAGATTTTT TGACTTCTCA AAGACCAATG CGAGGAAAGC    14145
                          ||| || |||||| ||| || ||||||| |||||||||| 
.......... .......... ....ATTCTT TGACTTTTCA AAAACCAATG CGAGGAAAGC      406


GTTCAGAGTT ATTCAGGTTG TAAATTCTAG CAATCCAATC TCTCTATATA TCATGTAAAA    14205
|||||||||| ||||||                                                 
GTTCAGAGTT ATTCAG.... .......... .......... .......... ..........      422


TGGTGTGTTC ATTGCATTTA ACCAGGCTCA TTTGTTAATG CTTGGCAGGA TACTCATAAT    14265
                                                    || |||||||||| 
.......... .......... .......... .......... ........GA TACTCATAAT      434


GTTAGATCTG TATGTTTTCA TCCTTGTGGG GATTACCTTT TAGCAGGTAC TATGATCTTT    14325
|||||||||| |||||||||| |||||||||| |||| ||||| ||||||                
GTTAGATCTG TATGTTTTCA TCCTTGTGGG GATTTCCTTT TAGCAG.... ..........      480


TCACTAAATT TAAATTTGAT TTCTAGTTCT GCTGTGATTA ACTGATTCTT GATGTCTGAT    14385
                                                                  
.......... .......... .......... .......... .......... ..........      480


ATCAGTTTGA TATGCTCTGA TTTTTATGCA TTATAAGTTG TTAACATGTT TTCAGTTGTT    14445
                                                                  
.......... .......... .......... .......... .......... ..........      480


ATCTGTAAAG TAATTTAATC ATTTCACCAA AACAATTTGA TATTTGGGCT TAAGAATTTG    14505
                                                                  
.......... .......... .......... .......... .......... ..........      480


GATTTCGTTC CTGGATCAAC AGTTTCTGTC TCGTGGGCAT TTGAAAAATA CTGCAAGCAT    14565
                                                                  
.......... .......... .......... .......... .......... ..........      480


ATCGTATGGA ATTTTCTTCT TACATATAGT CAAATATTAA CATTCAAATA TGTATTTTTT    14625
                                                                  
.......... .......... .......... .......... .......... ..........      480


TTAAAAAAAC TCATTTTCAT ATATTTGGAA GCAAGTGACA CTGATAAAAT TATTTGCAGG    14685
                                                                | 
.......... .......... .......... .......... .......... .........G      481


GACTGATCAC CCAGTTGCTC ATTTATATGA TATAAATACT TTTACATGCT ACTTATCAGC    14745
|||||||||| ||||| |||| |||||||||| |||||||||| |||||||||| |||||||||| 
GACTGATCAC CCAGTCGCTC ATTTATATGA TATAAATACT TTTACATGCT ACTTATCAGC      541


AAATGCACAG GATTCTAGTT CTCCCATTAA CCAG    14779
|||||||||| |||||||||| |||||    |  || 
AAATGCACAG GATTCTAGTT CTCCCCGACA GCAA      575





********************************************************************************
EST sequence   65 +strand (File: 9410872+)

     1  GNCGCGCCCG CTCGGCACCA GCGCCGTGGA TTTCANTGTG CAGAATGTCA GGGGCCCGTC
    61  CAAGACTTTC CCCAAGCACG AGACCAGGCA CATCTCCGAT CATAAGAATG TTGCCAGATG
   121  TGCGAAATTT AGTCCTGATG GGAAACATTT TGCAACTGGA AGTGGGGACA CATCCATTAA
   181  GTTCTTTGAG GTATCAAAAA TTAAGCAGAC GATGTTAGGA GACTCCAAAG AAGGCCCTGG
   241  CCGACCTGTG GTCCGTACAT TTTATGACCA TGTGCAGCCC ATCAATGATC TGGATTTCCA
   301  TCCTATTAGC CCAATACTGA TATCTGCAGC AAAAGATAAT ACGATAAAGT TCTTTGAGTT
   361  CTCCAAAACT GCTGCAAGAA AAGCATTCAG AGTTATTCAG GATACTCATA ATGTTAGGTC
   421  TGTATGTTTT CATCCTTGCG GTGATTACAT TTTAGCAGGG ACTGATCACC CAGTAGCTCA
   481  TCTCTATGAT GTAAACACTT TCACATGCTT CTTATCCGCA AATCCGCAGG ACTCTAGTGC
   541  TGCCATCAAC CAGGTGCGCT CTCGGGTACT GGGAGCATGT ATGTGACTGC TTCTAAGGAT
   601  GGTTCTCTGC GCATCTGGGA TGGAGTATCT GCTGAATGTG TTCGTCCCAT AATTGGGGCA
   661  CATGGATCTG TAGAAGCTAC TAGTGCAATT TCACCAAAGA CGAGAGGTAC TCCTATCCAG
   721  TGGGAAGGAT TCGTGTATAA AGTTATGGGN AAGTTGGCAC

Predicted gene structure (within gDNA segment 12400 to 15700):

 Exon  1  12788  12823 (  36 n);  cDNA      1     36 (  36 n); score: 0.806
  Intron  1  12824  12920 (  97 n); Pd: 0.511 (s:    0), Pa: 0.000 (s: 0.82)
 Exon  2  12921  12990 (  70 n);  cDNA     37    106 (  70 n); score: 0.800
  Intron  2  12991  13196 ( 206 n); Pd: 0.964 (s: 0.80), Pa: 0.978 (s: 0.88)
 Exon  3  13197  13280 (  84 n);  cDNA    107    190 (  84 n); score: 0.869
  Intron  3  13281  13380 ( 100 n); Pd: 0.000 (s: 0.86), Pa: 1.000 (s: 0.82)
 Exon  4  13381  13467 (  87 n);  cDNA    191    277 (  87 n); score: 0.782
  Intron  4  13468  13886 ( 419 n); Pd: 0.992 (s: 0.74), Pa: 0.939 (s: 0.86)
 Exon  5  13887  13957 (  71 n);  cDNA    278    348 (  71 n); score: 0.859
  Intron  5  13958  14109 ( 152 n); Pd: 0.973 (s: 0.84), Pa: 0.989 (s: 0.78)
 Exon  6  14110  14161 (  52 n);  cDNA    349    400 (  52 n); score: 0.788
  Intron  6  14162  14253 (  92 n); Pd: 0.890 (s: 0.80), Pa: 0.830 (s: 0.92)
 Exon  7  14254  14311 (  58 n);  cDNA    401    458 (  58 n); score: 0.931
  Intron  7  14312  14684 ( 373 n); Pd: 0.979 (s: 0.92), Pa: 0.910 (s: 0.88)
 Exon  8  14685  14779 (  95 n);  cDNA    459    553 (  95 n); score: 0.853
  Intron  8  14780  14879 ( 100 n); Pd: 0.995 (s: 0.84), Pa: 0.000 (s: 0.88)
 Exon  9  14880  15034 ( 155 n);  cDNA    554    706 ( 153 n); score: 0.897
  Intron  9  15035  15519 ( 485 n); Pd: 0.794 (s: 0.90), Pa: 0.933 (s: 0.80)
 Exon 10  15520  15573 (  54 n);  cDNA    707    760 (  54 n); score: 0.815

MATCH	21326110+	9410872+	0.850	762	1.003	C
PGS_21326110+_9410872+	(12788  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15034,15520  15573)

Alignment (genomic DNA sequence = upper lines):

GGTGCAGCCG CTCGGCTCCA GTGCCGTGGA TTTCAGGTAA ACCCCAACCT TGCGCCCCCG    12847
|  ||  ||| |||||| ||| | |||||||| |||||                            
GNCGCGCCCG CTCGGCACCA GCGCCGTGGA TTTCAN.... .......... ..........       36


CGGTGTTGCC TAGTGGCAGT GTTTTTTCTG GTGCTGAACA TTGGTGAGGA GTGTTGACGC    12907
                                                                  
.......... .......... .......... .......... .......... ..........       36


CGGTGCTGTG TAGTATGCAG GATGTCAAGG GCTCATCCAA GAGCTTCCCC AAGCACGAGG    12967
              | |||||  |||||| || || | ||||| ||  |||||| |||||||||  
.......... ...TGTGCAG AATGTCAGGG GCCCGTCCAA GACTTTCCCC AAGCACGAGA       83


CGAAGCATGT CTCTGACCAT AAGGTGCTTA TGATTCCAAT TTTCCCTTGC AAATGCACCA    13027
| | |||  | ||| || ||| |||                                         
CCAGGCACAT CTCCGATCAT AAG....... .......... .......... ..........      106


CTTGAAAGTT GAAACAATTT TTGTGTCAGA CTCCTGTTTA TCTGAATATT TACTACTGCT    13087
                                                                  
.......... .......... .......... .......... .......... ..........      106


ATTGCACATT TTGCACTTAT CACAGTACCA TGATTATGTA GACAACTTGG GATTGACCAA    13147
                                                                  
.......... .......... .......... .......... .......... ..........      106


CAATAGATTT TACTGATGTT TATTGGCTTA CCATTGCATT TTTCTGTAGA ACGCTGCCCG    13207
                                                     | | | |||| | 
.......... .......... .......... .......... .........A ATGTTGCCAG      117


GTGTGCGAAA TTTAGTCCTG ATGGGAAGTA TTTTGCAACT GGGAGTGCTG ATACATCCAT    13267
 ||||||||| |||||||||| |||||||  | |||||||||| || ||||  | | |||||||| 
ATGTGCGAAA TTTAGTCCTG ATGGGAAACA TTTTGCAACT GGAAGTGGGG ACACATCCAT      177


TAAGTTTTTT GAGGTGAACT TGAAATTTGA ATTGCCACTC AGGTTGCTAG GTGGGGCTTG    13327
|||||| ||| |||                                                    
TAAGTTCTTT GAG....... .......... .......... .......... ..........      190


TGCTGTTTTC TACTTAGTTG CAACTTGTAA CTCACTATTG CTCTGTCCTG CAGGTTGCTA    13387
                                                          ||  | | 
.......... .......... .......... .......... .......... ...GTATCAA      197


AAATTAAGCA GACTATGGTA GGGGACTCCA AAGATGGTCC TGCCAGGCCT GTGATTCGCA    13447
|||||||||| ||| ||| || || ||||||| |||| || || || | | ||| ||| | || | 
AAATTAAGCA GACGATGTTA GGAGACTCCA AAGAAGGCCC TGGCCGACCT GTGGTCCGTA      257


CATTTTATGA TCACACACAG GTGAGCATGT ATTGCTCATA TATGACAGTT TATTTACTCT    13507
||||||||||  ||    |||                                             
CATTTTATGA CCATGTGCAG .......... .......... .......... ..........      277


TCAAGGTCGT GAGACTCTTT TCAACACTTC CACAAGATTG CCTCCGAGTT AGGTCTCCTG    13567
                                                                  
.......... .......... .......... .......... .......... ..........      277


CAGTATTTTT TTTCCTTTAA TATGCGGAGA GCTGCATATC ATTGCATTAT AGAAAGACTG    13627
                                                                  
.......... .......... .......... .......... .......... ..........      277


AAATACATGG GTAGATCAAA TCCACCTGCC ACCACAGACC ACACTTATAT ACACACGCTC    13687
                                                                  
.......... .......... .......... .......... .......... ..........      277


AACTCACGTT TAGCACACTG GATGCACACC TAGCAGCTGC AATTTGTAGT TAGATATTTG    13747
                                                                  
.......... .......... .......... .......... .......... ..........      277


CTTACTGAGC TGTGTGGAGC ATTGACATGA TATTCAATTT TTTAATAAAC AACATTTTTT    13807
                                                                  
.......... .......... .......... .......... .......... ..........      277


TCCATTTTCA CTAGTTTCTA CTTCATTTCC CATTGCTCAA ATTTCCACTG TGCTCGTAAA    13867
                                                                  
.......... .......... .......... .......... .......... ..........      277


CATGATTGAT TTCTTGCAGG CCATCAATGA TCTGGATTTT CATCCTGAGA GTCCAATACT    13927
                      |||||||||| |||||||||  ||||||   | | |||||||| 
.......... .........C CCATCAATGA TCTGGATTTC CATCCTATTA GCCCAATACT      318


GATATCAGCT GCAAAAGACA ATACAATAAA GTATGCTTAT CCTTGATGTC TACACTCCGT    13987
|||||| ||  |||||||| | |||| |||||                                  
GATATCTGCA GCAAAAGATA ATACGATAAA .......... .......... ..........      348


GCTGTTAAAT TGTCTATTTG AAGTGCTCAT ACTAGGATTA AGCATGATTT TTTAGGAATT    14047
                                                                  
.......... .......... .......... .......... .......... ..........      348


TTTTGCGGTA TTAATTGCTA TCTGTGTTAT TGTTTTGTAC ATGAAAAAAT TTTGCTCAAC    14107
                                                                  
.......... .......... .......... .......... .......... ..........      348


AGATTTTTTG ACTTCTCAAA GACCAATGCG AGGAAAGCGT TCAGAGTTAT TCAGGTTGTA    14167
   || |||| | ||||| ||  ||   |||  || ||||| | |||||||||| ||||       
..GTTCTTTG AGTTCTCCAA AACTGCTGCA AGAAAAGCAT TCAGAGTTAT TCAG......      400


AATTCTAGCA ATCCAATCTC TCTATATATC ATGTAAAATG GTGTGTTCAT TGCATTTAAC    14227
                                                                  
.......... .......... .......... .......... .......... ..........      400


CAGGCTCATT TGTTAATGCT TGGCAGGATA CTCATAATGT TAGATCTGTA TGTTTTCATC    14287
                            |||| |||||||||| ||| |||||| |||||||||| 
.......... .......... ......GATA CTCATAATGT TAGGTCTGTA TGTTTTCATC      434


CTTGTGGGGA TTACCTTTTA GCAGGTACTA TGATCTTTTC ACTAAATTTA AATTTGATTT    14347
|||| || || |||| ||||| ||||                                        
CTTGCGGTGA TTACATTTTA GCAG...... .......... .......... ..........      458


CTAGTTCTGC TGTGATTAAC TGATTCTTGA TGTCTGATAT CAGTTTGATA TGCTCTGATT    14407
                                                                  
.......... .......... .......... .......... .......... ..........      458


TTTATGCATT ATAAGTTGTT AACATGTTTT CAGTTGTTAT CTGTAAAGTA ATTTAATCAT    14467
                                                                  
.......... .......... .......... .......... .......... ..........      458


TTCACCAAAA CAATTTGATA TTTGGGCTTA AGAATTTGGA TTTCGTTCCT GGATCAACAG    14527
                                                                  
.......... .......... .......... .......... .......... ..........      458


TTTCTGTCTC GTGGGCATTT GAAAAATACT GCAAGCATAT CGTATGGAAT TTTCTTCTTA    14587
                                                                  
.......... .......... .......... .......... .......... ..........      458


CATATAGTCA AATATTAACA TTCAAATATG TATTTTTTTT AAAAAAACTC ATTTTCATAT    14647
                                                                  
.......... .......... .......... .......... .......... ..........      458


ATTTGGAAGC AAGTGACACT GATAAAATTA TTTGCAGGGA CTGATCACCC AGTTGCTCAT    14707
                                        ||| |||||||||| ||| |||||| 
.......... .......... .......... .......GGA CTGATCACCC AGTAGCTCAT      481


TTATATGATA TAAATACTTT TACATGCTAC TTATCAGCAA ATGCACAGGA TTCTAGTTCT    14767
 | ||||||  |||| |||||  ||||||| | ||||| |||| || | |||||  |||||| || 
CTCTATGATG TAAACACTTT CACATGCTTC TTATCCGCAA ATCCGCAGGA CTCTAGTGCT      541


CCCATTAACC AGGTAGCTTT TCTCTTTCCT TCTGATTCAC AAGCATTAGA TTGCATTGGT    14827
 |||| |||| ||                                                     
GCCATCAACC AG........ .......... .......... .......... ..........      553


TATATTCTCA TCAAAGTTCT CCGCCAGCCA TGCTTACTGA TGTTGCTGCC AGGTACGCTA    14887
                                                         || ||||  
.......... .......... .......... .......... .......... ..GTGCGCT-      560


CTCCTGTACT GGGAGCTTGT ATGTGACTGC TTCTAAAGAT GGTTCTCTGC GCATTTGGGA    14947
|||  ||||| |||||| ||| |||||||||| |||||| ||| |||||||||| |||| ||||| 
CTCGGGTACT GGGAGCATGT ATGTGACTGC TTCTAAGGAT GGTTCTCTGC GCATCTGGGA      620


TGGAGTATCT GCTGAATGTG TTCGACCTAT TATTGGAGCA CATGGATCTG CAGAAGCTAC    15007
|||||||||| |||||||||| |||| || ||  ||||| ||| ||||||||||  ||||||||| 
TGGAGTATCT GCTGAATGTG TTCGTCCCAT AATTGGGGCA CATGGATCTG TAGAAGCTAC      680


TAGCGCAATT TTCACCAGAG ATGAGAGGTA AGCGAGCTAC CAGCATGTCT AAGGTGCTCT    15067
||| |||| | ||||||| || | |||||                                     
TAGTGCAA-T TTCACCAAAG ACGAGAG... .......... .......... ..........      706


TCCCTCAAGA TAAAATCCAG TCATTGTTTG GTTTGAAGAA CAGAGAGAAA GGCATATGCT    15127
                                                                  
.......... .......... .......... .......... .......... ..........      706


GTATGATTCA AGACAGTAAC TACTTCAAAC CCTGTTTGGA ATGTGGGAAT CTTGTAGTGA    15187
                                                                  
.......... .......... .......... .......... .......... ..........      706


TTCTGAATGA TTTATAACAT GTCCTGGATA ATTTCCTGTG TTTCAGACGT GTCGTAACTT    15247
                                                                  
.......... .......... .......... .......... .......... ..........      706


TATAACACGA ATAACTCTTT CTCCTTTACC CTACTATTTC ACCACTAAAC AACTAACTTG    15307
                                                                  
.......... .......... .......... .......... .......... ..........      706


CCTATAAACA CTTTTTAGAC TTCTTCTGAA AGGCCTAGTG TTTATGTGGT TATATGCAGC    15367
                                                                  
.......... .......... .......... .......... .......... ..........      706


GTGAATGCAC TTGCATATAA GATTGATCTA AAAAATTGAT GTAGTGAACT TTGACTACCC    15427
                                                                  
.......... .......... .......... .......... .......... ..........      706


GAAGTATATG CTTAGATAGT TCATGGATTT CTTTCATAAA ACTGCACACT GTATTCTGGT    15487
                                                                  
.......... .......... .......... .......... .......... ..........      706


TATCTGTTAT GAAGTTTACT ACGTTCTTTC AGGTATGTCC TATCTTGTGG GAAAGATTCT    15547
                                   |||  ||| ||||  |||| ||| |||||  
.......... .......... .......... ..GTA-CTCC TATCCAGTGG GAAGGATTCG      733


TGTGTCAAGT TATGGG-AAG TTGGCAC    15573
||| | |||| |||||| ||| |||||||
TGTATAAAGT TATGGGNAAG TTGGCAC      760





********************************************************************************
EST sequence   68 +strand (File: 12030559+)

     1  CGCGCCCGCT CGGCACCAGC GCCGTGGATT TCANTGTGCA GAATGTCAGG GGCCCGTCCA
    61  AGACTTTCCC CAAGCACGAG ACCAGGCACA TCTCCGATCA TAAGAATGTT GCCAGATGTG
   121  CGAAATTTAG TCCTGATGGG AAACATTTTG CAACTGGAAG TGGGGACACA TCCATTAAGT
   181  TCTTTGAGGT ATCAAAAATT AAGCAGACGA TGTTAGGAGA CTCCAAAGAA GGCCCTGGCC
   241  GACCTGTGGT CCGTACATTT TATGACCATG TGCAGCCCAT CAATGATCTG GATTTCCATC
   301  CTATTAGCCC AATACTGATA TCTGCAGCAA AAGATAATAC GATAAAGTTC TTTGAGTTCT
   361  CCAAAACTGC TGCAAGAAAA GCATTCAGAG TTATTCAGGA TACTCATAAT GTTAGGTCTG
   421  TATGTTTTCA TCCTTGCGGT GATTACATTT TAGCAGGGAC TGATCACCCA GTAGCTCATC
   481  TCTATGATGT AAACACTTTC ACATGCTTCT TATCCGCAAA TCCGCAGGAC TCTAGTGCTG
   541  CCATCAACCA GGTGCGCTCT CGGGTACTGG GAGCATGTAT GTGACTGCTT CTAAGGATGG
   601  TTCTCTGCGC ATCTGGGATG GAGTATCTGC TGAATGTGTT CGTCCCATAA TTGGGGCACA
   661  TGGATCTGTA GAAGCTACTA GTGCAATTTC ACCAAAGACG

Predicted gene structure (within gDNA segment 12410 to 15410):

 Exon  1  12790  12823 (  34 n);  cDNA      1     34 (  34 n); score: 0.824
  Intron  1  12824  12920 (  97 n); Pd: 0.511 (s:    0), Pa: 0.000 (s: 0.82)
 Exon  2  12921  12990 (  70 n);  cDNA     35    104 (  70 n); score: 0.800
  Intron  2  12991  13196 ( 206 n); Pd: 0.964 (s: 0.80), Pa: 0.978 (s: 0.88)
 Exon  3  13197  13280 (  84 n);  cDNA    105    188 (  84 n); score: 0.869
  Intron  3  13281  13380 ( 100 n); Pd: 0.000 (s: 0.86), Pa: 1.000 (s: 0.82)
 Exon  4  13381  13467 (  87 n);  cDNA    189    275 (  87 n); score: 0.782
  Intron  4  13468  13886 ( 419 n); Pd: 0.992 (s: 0.74), Pa: 0.939 (s: 0.86)
 Exon  5  13887  13957 (  71 n);  cDNA    276    346 (  71 n); score: 0.859
  Intron  5  13958  14109 ( 152 n); Pd: 0.973 (s: 0.84), Pa: 0.989 (s: 0.78)
 Exon  6  14110  14161 (  52 n);  cDNA    347    398 (  52 n); score: 0.788
  Intron  6  14162  14253 (  92 n); Pd: 0.890 (s: 0.80), Pa: 0.830 (s: 0.92)
 Exon  7  14254  14311 (  58 n);  cDNA    399    456 (  58 n); score: 0.931
  Intron  7  14312  14684 ( 373 n); Pd: 0.979 (s: 0.92), Pa: 0.910 (s: 0.88)
 Exon  8  14685  14779 (  95 n);  cDNA    457    551 (  95 n); score: 0.853
  Intron  8  14780  14879 ( 100 n); Pd: 0.995 (s: 0.84), Pa: 0.000 (s: 0.88)
 Exon  9  14880  15030 ( 151 n);  cDNA    552    700 ( 149 n); score: 0.894

MATCH	21326110+	12030559+	0.852	702	1.003	C
PGS_21326110+_12030559+	(12790  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15030)

Alignment (genomic DNA sequence = upper lines):

TGCAGCCGCT CGGCTCCAGT GCCGTGGATT TCAGGTAAAC CCCAACCTTG CGCCCCCGCG    12849
 ||  ||||| |||| ||||  |||||||||| |||                              
CGCGCCCGCT CGGCACCAGC GCCGTGGATT TCAN...... .......... ..........       34


GTGTTGCCTA GTGGCAGTGT TTTTTCTGGT GCTGAACATT GGTGAGGAGT GTTGACGCCG    12909
                                                                  
.......... .......... .......... .......... .......... ..........       34


GTGCTGTGTA GTATGCAGGA TGTCAAGGGC TCATCCAAGA GCTTCCCCAA GCACGAGGCG    12969
            | ||||| | ||||| ||||  | |||||||   |||||||| ||||||| |  
.......... .TGTGCAGAA TGTCAGGGGC CCGTCCAAGA CTTTCCCCAA GCACGAGACC       83


AAGCATGTCT CTGACCATAA GGTGCTTATG ATTCCAATTT TCCCTTGCAA ATGCACCACT    13029
| |||  ||| | || ||||| |                                           
AGGCACATCT CCGATCATAA G......... .......... .......... ..........      104


TGAAAGTTGA AACAATTTTT GTGTCAGACT CCTGTTTATC TGAATATTTA CTACTGCTAT    13089
                                                                  
.......... .......... .......... .......... .......... ..........      104


TGCACATTTT GCACTTATCA CAGTACCATG ATTATGTAGA CAACTTGGGA TTGACCAACA    13149
                                                                  
.......... .......... .......... .......... .......... ..........      104


ATAGATTTTA CTGATGTTTA TTGGCTTACC ATTGCATTTT TCTGTAGAAC GCTGCCCGGT    13209
                                                   ||  | |||| | | 
.......... .......... .......... .......... .......AAT GTTGCCAGAT      117


GTGCGAAATT TAGTCCTGAT GGGAAGTATT TTGCAACTGG GAGTGCTGAT ACATCCATTA    13269
|||||||||| |||||||||| |||||  ||| ||||||||||  ||||  ||  |||||||||| 
GTGCGAAATT TAGTCCTGAT GGGAAACATT TTGCAACTGG AAGTGGGGAC ACATCCATTA      177


AGTTTTTTGA GGTGAACTTG AAATTTGAAT TGCCACTCAG GTTGCTAGGT GGGGCTTGTG    13329
|||| ||||| |                                                      
AGTTCTTTGA G......... .......... .......... .......... ..........      188


CTGTTTTCTA CTTAGTTGCA ACTTGTAACT CACTATTGCT CTGTCCTGCA GGTTGCTAAA    13389
                                                        ||  | ||| 
.......... .......... .......... .......... .......... .GTATCAAAA      197


ATTAAGCAGA CTATGGTAGG GGACTCCAAA GATGGTCCTG CCAGGCCTGT GATTCGCACA    13449
|||||||||| | ||| ||||  ||||||||| || || ||||  | | ||||| | | || ||| 
ATTAAGCAGA CGATGTTAGG AGACTCCAAA GAAGGCCCTG GCCGACCTGT GGTCCGTACA      257


TTTTATGATC ACACACAGGT GAGCATGTAT TGCTCATATA TGACAGTTTA TTTACTCTTC    13509
|||||||| | |    |||                                               
TTTTATGACC ATGTGCAG.. .......... .......... .......... ..........      275


AAGGTCGTGA GACTCTTTTC AACACTTCCA CAAGATTGCC TCCGAGTTAG GTCTCCTGCA    13569
                                                                  
.......... .......... .......... .......... .......... ..........      275


GTATTTTTTT TCCTTTAATA TGCGGAGAGC TGCATATCAT TGCATTATAG AAAGACTGAA    13629
                                                                  
.......... .......... .......... .......... .......... ..........      275


ATACATGGGT AGATCAAATC CACCTGCCAC CACAGACCAC ACTTATATAC ACACGCTCAA    13689
                                                                  
.......... .......... .......... .......... .......... ..........      275


CTCACGTTTA GCACACTGGA TGCACACCTA GCAGCTGCAA TTTGTAGTTA GATATTTGCT    13749
                                                                  
.......... .......... .......... .......... .......... ..........      275


TACTGAGCTG TGTGGAGCAT TGACATGATA TTCAATTTTT TAATAAACAA CATTTTTTTC    13809
                                                                  
.......... .......... .......... .......... .......... ..........      275


CATTTTCACT AGTTTCTACT TCATTTCCCA TTGCTCAAAT TTCCACTGTG CTCGTAAACA    13869
                                                                  
.......... .......... .......... .......... .......... ..........      275


TGATTGATTT CTTGCAGGCC ATCAATGATC TGGATTTTCA TCCTGAGAGT CCAATACTGA    13929
                   || |||||||||| ||||||| || ||||   ||  |||||||||| 
.......... .......CCC ATCAATGATC TGGATTTCCA TCCTATTAGC CCAATACTGA      318


TATCAGCTGC AAAAGACAAT ACAATAAAGT ATGCTTATCC TTGATGTCTA CACTCCGTGC    13989
|||| || || |||||| ||| || |||||                                    
TATCTGCAGC AAAAGATAAT ACGATAAA.. .......... .......... ..........      346


TGTTAAATTG TCTATTTGAA GTGCTCATAC TAGGATTAAG CATGATTTTT TAGGAATTTT    14049
                                                                  
.......... .......... .......... .......... .......... ..........      346


TTGCGGTATT AATTGCTATC TGTGTTATTG TTTTGTACAT GAAAAAATTT TGCTCAACAG    14109
                                                                  
.......... .......... .......... .......... .......... ..........      346


ATTTTTTGAC TTCTCAAAGA CCAATGCGAG GAAAGCGTTC AGAGTTATTC AGGTTGTAAA    14169
 || |||||  ||||| || | |   ||| ||  ||||| ||| |||||||||| ||         
GTTCTTTGAG TTCTCCAAAA CTGCTGCAAG AAAAGCATTC AGAGTTATTC AG........      398


TTCTAGCAAT CCAATCTCTC TATATATCAT GTAAAATGGT GTGTTCATTG CATTTAACCA    14229
                                                                  
.......... .......... .......... .......... .......... ..........      398


GGCTCATTTG TTAATGCTTG GCAGGATACT CATAATGTTA GATCTGTATG TTTTCATCCT    14289
                          |||||| |||||||||| | |||||||| |||||||||| 
.......... .......... ....GATACT CATAATGTTA GGTCTGTATG TTTTCATCCT      434


TGTGGGGATT ACCTTTTAGC AGGTACTATG ATCTTTTCAC TAAATTTAAA TTTGATTTCT    14349
|| || |||| || ||||||| ||                                          
TGCGGTGATT ACATTTTAGC AG........ .......... .......... ..........      456


AGTTCTGCTG TGATTAACTG ATTCTTGATG TCTGATATCA GTTTGATATG CTCTGATTTT    14409
                                                                  
.......... .......... .......... .......... .......... ..........      456


TATGCATTAT AAGTTGTTAA CATGTTTTCA GTTGTTATCT GTAAAGTAAT TTAATCATTT    14469
                                                                  
.......... .......... .......... .......... .......... ..........      456


CACCAAAACA ATTTGATATT TGGGCTTAAG AATTTGGATT TCGTTCCTGG ATCAACAGTT    14529
                                                                  
.......... .......... .......... .......... .......... ..........      456


TCTGTCTCGT GGGCATTTGA AAAATACTGC AAGCATATCG TATGGAATTT TCTTCTTACA    14589
                                                                  
.......... .......... .......... .......... .......... ..........      456


TATAGTCAAA TATTAACATT CAAATATGTA TTTTTTTTAA AAAAACTCAT TTTCATATAT    14649
                                                                  
.......... .......... .......... .......... .......... ..........      456


TTGGAAGCAA GTGACACTGA TAAAATTATT TGCAGGGACT GATCACCCAG TTGCTCATTT    14709
                                      ||||| |||||||||| | |||||| | 
.......... .......... .......... .....GGACT GATCACCCAG TAGCTCATCT      481


ATATGATATA AATACTTTTA CATGCTACTT ATCAGCAAAT GCACAGGATT CTAGTTCTCC    14769
 |||||| || || ||||| | |||||| ||| ||| ||||||  | ||||| | ||||| || | 
CTATGATGTA AACACTTTCA CATGCTTCTT ATCCGCAAAT CCGCAGGACT CTAGTGCTGC      541


CATTAACCAG GTAGCTTTTC TCTTTCCTTC TGATTCACAA GCATTAGATT GCATTGGTTA    14829
||| ||||||                                                        
CATCAACCAG .......... .......... .......... .......... ..........      551


TATTCTCATC AAAGTTCTCC GCCAGCCATG CTTACTGATG TTGCTGCCAG GTACGCTACT    14889
                                                       || |||| || 
.......... .......... .......... .......... .......... GTGCGCT-CT      560


CCTGTACTGG GAGCTTGTAT GTGACTGCTT CTAAAGATGG TTCTCTGCGC ATTTGGGATG    14949
|  ||||||| |||| ||||| |||||||||| |||| ||||| |||||||||| || ||||||| 
CGGGTACTGG GAGCATGTAT GTGACTGCTT CTAAGGATGG TTCTCTGCGC ATCTGGGATG      620


GAGTATCTGC TGAATGTGTT CGACCTATTA TTGGAGCACA TGGATCTGCA GAAGCTACTA    15009
|||||||||| |||||||||| || || || | |||| ||||| |||||||| | |||||||||| 
GAGTATCTGC TGAATGTGTT CGTCCCATAA TTGGGGCACA TGGATCTGTA GAAGCTACTA      680


GCGCAATTTT CACCAGAGAT G    15030
| |||| ||| ||||| |||  |
GTGCAA-TTT CACCAAAGAC G      700





********************************************************************************
EST sequence  107 -strand (File: 18965015-)

     1  TGGATTTCAG TATTCAGGAT GTCAAGGGCT CATCCAAAAG CTTCCCCAAG CACGAGGTGA
    61  AGCATGTCTC TGNCCATAAG AACGCTGCCC GGTGTGTGAA ATTTAGTCCT GATGGAAAGT
   121  ATTTTGCANC TGGGAGTGCT GATACATCCA TTAAGTTTTT TGAGGTTGCT AAGATTAAGC
   181  AGACTATGGT AGGAGACTCT AAAGATGGCC CTGCCAGGCC TGTGATACGG ACATTTTATG
   241  ATCACACACA GGCCATCAAT GATCTGGATT TTCATCCTGA GAGTCCAATA CTGATATCAG
   301  CTGCAAAAGA CAGTACAATA AGATTCTTTG ACTTTTCAAA AACCAATGCG AGGAAAGCGT
   361  TCAGAGTTAT TCAGGATACT CATAATGTTA GATCTGTATG TTTTCATCCC TGTGGGGATT
   421  TCCTTTTAGC AGGGACTGAT CACCCAGTCG CTCATTTATA TGATATAAAT ACTTTTACAT
   481  GCTACTTATC AGCAAATGCA CAGGATTCTA GTTCTCCCC

Predicted gene structure (within gDNA segment 12550 to 15075):

 Exon  1  12814  12823 (  10 n);  cDNA      1     10 (  10 n); score: 1.000
  Intron  1  12824  12920 (  97 n); Pd: 0.511 (s:    0), Pa: 0.000 (s: 0.94)
 Exon  2  12921  12990 (  70 n);  cDNA     11     80 (  70 n); score: 0.943
  Intron  2  12991  13196 ( 206 n); Pd: 0.964 (s: 0.94), Pa: 0.978 (s: 0.94)
 Exon  3  13197  13280 (  84 n);  cDNA     81    164 (  84 n); score: 0.964
  Intron  3  13281  13380 ( 100 n); Pd: 0.000 (s: 0.96), Pa: 1.000 (s: 0.92)
 Exon  4  13381  13467 (  87 n);  cDNA    165    251 (  87 n); score: 0.931
  Intron  4  13468  13886 ( 419 n); Pd: 0.992 (s: 0.94), Pa: 0.939 (s: 1.00)
 Exon  5  13887  13957 (  71 n);  cDNA    252    322 (  71 n); score: 0.972
  Intron  5  13958  14109 ( 152 n); Pd: 0.973 (s: 0.96), Pa: 0.989 (s: 0.94)
 Exon  6  14110  14161 (  52 n);  cDNA    323    374 (  52 n); score: 0.942
  Intron  6  14162  14253 (  92 n); Pd: 0.890 (s: 0.94), Pa: 0.830 (s: 0.96)
 Exon  7  14254  14311 (  58 n);  cDNA    375    432 (  58 n); score: 0.966
  Intron  7  14312  14684 ( 373 n); Pd: 0.979 (s: 0.96), Pa: 0.910 (s: 0.98)
 Exon  8  14685  14771 (  87 n);  cDNA    433    519 (  87 n); score: 0.977

MATCH	21326110+	18965015-	0.957	519	1.000	C
PGS_21326110+_18965015-	(12814  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14771)

Alignment (genomic DNA sequence = upper lines):

TGGATTTCAG GTAAACCCCA ACCTTGCGCC CCCGCGGTGT TGCCTAGTGG CAGTGTTTTT    12873
||||||||||                                                        
TGGATTTCAG .......... .......... .......... .......... ..........       10


TCTGGTGCTG AACATTGGTG AGGAGTGTTG ACGCCGGTGC TGTGTAGTAT GCAGGATGTC    12933
                                                   |||  ||||||||| 
.......... .......... .......... .......... .......TAT TCAGGATGTC       23


AAGGGCTCAT CCAAGAGCTT CCCCAAGCAC GAGGCGAAGC ATGTCTCTGA CCATAAGGTG    12993
|||||||||| |||| ||||| |||||||||| |||| ||||| |||||||||  |||||||    
AAGGGCTCAT CCAAAAGCTT CCCCAAGCAC GAGGTGAAGC ATGTCTCTGN CCATAAG...       80


CTTATGATTC CAATTTTCCC TTGCAAATGC ACCACTTGAA AGTTGAAACA ATTTTTGTGT    13053
                                                                  
.......... .......... .......... .......... .......... ..........       80


CAGACTCCTG TTTATCTGAA TATTTACTAC TGCTATTGCA CATTTTGCAC TTATCACAGT    13113
                                                                  
.......... .......... .......... .......... .......... ..........       80


ACCATGATTA TGTAGACAAC TTGGGATTGA CCAACAATAG ATTTTACTGA TGTTTATTGG    13173
                                                                  
.......... .......... .......... .......... .......... ..........       80


CTTACCATTG CATTTTTCTG TAGAACGCTG CCCGGTGTGC GAAATTTAGT CCTGATGGGA    13233
                         ||||||| |||||||||  |||||||||| |||||||| | 
.......... .......... ...AACGCTG CCCGGTGTGT GAAATTTAGT CCTGATGGAA      117


AGTATTTTGC AACTGGGAGT GCTGATACAT CCATTAAGTT TTTTGAGGTG AACTTGAAAT    13293
|||||||||| | |||||||| |||||||||| |||||||||| |||||||               
AGTATTTTGC ANCTGGGAGT GCTGATACAT CCATTAAGTT TTTTGAG... ..........      164


TTGAATTGCC ACTCAGGTTG CTAGGTGGGG CTTGTGCTGT TTTCTACTTA GTTGCAACTT    13353
                                                                  
.......... .......... .......... .......... .......... ..........      164


GTAACTCACT ATTGCTCTGT CCTGCAGGTT GCTAAAATTA AGCAGACTAT GGTAGGGGAC    13413
                             ||| ||||| |||| |||||||||| |||||| ||| 
.......... .......... .......GTT GCTAAGATTA AGCAGACTAT GGTAGGAGAC      197


TCCAAAGATG GTCCTGCCAG GCCTGTGATT CGCACATTTT ATGATCACAC ACAGGTGAGC    13473
|| ||||||| | |||||||| |||||||||  || ||||||| |||||||||| ||||       
TCTAAAGATG GCCCTGCCAG GCCTGTGATA CGGACATTTT ATGATCACAC ACAG......      251


ATGTATTGCT CATATATGAC AGTTTATTTA CTCTTCAAGG TCGTGAGACT CTTTTCAACA    13533
                                                                  
.......... .......... .......... .......... .......... ..........      251


CTTCCACAAG ATTGCCTCCG AGTTAGGTCT CCTGCAGTAT TTTTTTTCCT TTAATATGCG    13593
                                                                  
.......... .......... .......... .......... .......... ..........      251


GAGAGCTGCA TATCATTGCA TTATAGAAAG ACTGAAATAC ATGGGTAGAT CAAATCCACC    13653
                                                                  
.......... .......... .......... .......... .......... ..........      251


TGCCACCACA GACCACACTT ATATACACAC GCTCAACTCA CGTTTAGCAC ACTGGATGCA    13713
                                                                  
.......... .......... .......... .......... .......... ..........      251


CACCTAGCAG CTGCAATTTG TAGTTAGATA TTTGCTTACT GAGCTGTGTG GAGCATTGAC    13773
                                                                  
.......... .......... .......... .......... .......... ..........      251


ATGATATTCA ATTTTTTAAT AAACAACATT TTTTTCCATT TTCACTAGTT TCTACTTCAT    13833
                                                                  
.......... .......... .......... .......... .......... ..........      251


TTCCCATTGC TCAAATTTCC ACTGTGCTCG TAAACATGAT TGATTTCTTG CAGGCCATCA    13893
                                                          ||||||| 
.......... .......... .......... .......... .......... ...GCCATCA      258


ATGATCTGGA TTTTCATCCT GAGAGTCCAA TACTGATATC AGCTGCAAAA GACAATACAA    13953
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||| ||||| 
ATGATCTGGA TTTTCATCCT GAGAGTCCAA TACTGATATC AGCTGCAAAA GACAGTACAA      318


TAAAGTATGC TTATCCTTGA TGTCTACACT CCGTGCTGTT AAATTGTCTA TTTGAAGTGC    14013
|||                                                               
TAAG...... .......... .......... .......... .......... ..........      322


TCATACTAGG ATTAAGCATG ATTTTTTAGG AATTTTTTGC GGTATTAATT GCTATCTGTG    14073
                                                                  
.......... .......... .......... .......... .......... ..........      322


TTATTGTTTT GTACATGAAA AAATTTTGCT CAACAGATTT TTTGACTTCT CAAAGACCAA    14133
                                       |||  |||||||| | |||| ||||| 
.......... .......... .......... ......ATTC TTTGACTTTT CAAAAACCAA      346


TGCGAGGAAA GCGTTCAGAG TTATTCAGGT TGTAAATTCT AGCAATCCAA TCTCTCTATA    14193
|||||||||| |||||||||| ||||||||                                    
TGCGAGGAAA GCGTTCAGAG TTATTCAG.. .......... .......... ..........      374


TATCATGTAA AATGGTGTGT TCATTGCATT TAACCAGGCT CATTTGTTAA TGCTTGGCAG    14253
                                                                  
.......... .......... .......... .......... .......... ..........      374


GATACTCATA ATGTTAGATC TGTATGTTTT CATCCTTGTG GGGATTACCT TTTAGCAGGT    14313
|||||||||| |||||||||| |||||||||| ||||| |||| |||||| ||| ||||||||   
GATACTCATA ATGTTAGATC TGTATGTTTT CATCCCTGTG GGGATTTCCT TTTAGCAG..      432


ACTATGATCT TTTCACTAAA TTTAAATTTG ATTTCTAGTT CTGCTGTGAT TAACTGATTC    14373
                                                                  
.......... .......... .......... .......... .......... ..........      432


TTGATGTCTG ATATCAGTTT GATATGCTCT GATTTTTATG CATTATAAGT TGTTAACATG    14433
                                                                  
.......... .......... .......... .......... .......... ..........      432


TTTTCAGTTG TTATCTGTAA AGTAATTTAA TCATTTCACC AAAACAATTT GATATTTGGG    14493
                                                                  
.......... .......... .......... .......... .......... ..........      432


CTTAAGAATT TGGATTTCGT TCCTGGATCA ACAGTTTCTG TCTCGTGGGC ATTTGAAAAA    14553
                                                                  
.......... .......... .......... .......... .......... ..........      432


TACTGCAAGC ATATCGTATG GAATTTTCTT CTTACATATA GTCAAATATT AACATTCAAA    14613
                                                                  
.......... .......... .......... .......... .......... ..........      432


TATGTATTTT TTTTAAAAAA ACTCATTTTC ATATATTTGG AAGCAAGTGA CACTGATAAA    14673
                                                                  
.......... .......... .......... .......... .......... ..........      432


ATTATTTGCA GGGACTGATC ACCCAGTTGC TCATTTATAT GATATAAATA CTTTTACATG    14733
            ||||||||| ||||||| || |||||||||| |||||||||| |||||||||| 
.......... .GGACTGATC ACCCAGTCGC TCATTTATAT GATATAAATA CTTTTACATG      481


CTACTTATCA GCAAATGCAC AGGATTCTAG TTCTCCCA    14771
|||||||||| |||||||||| |||||||||| ||||||| 
CTACTTATCA GCAAATGCAC AGGATTCTAG TTCTCCCC      519





********************************************************************************
EST sequence   76 +strand (File: 21278903+)

     1  CGGCACGAGG CCCACGGGAG GACGGAGGGG AGGGCCGAGA TGGACGCGGC GGTGCAGGAG
    61  GCCAAGCTGC TGCGGCAGGT GAACGCCCTC ATCGTGGCGC ACCTCCGCGA CCAGAACCTC
   121  ACGCAGGCCG CCGTCGCCGT CGCCGCCGCC ACCATGACCC CCAAGGCCGA CGCCTCCCTC
   181  CCCAACCACC TCCTCCGACT CGTCGCCAAG GGCCTCGCGG TTGAGCGGGA GGAGGCGGCC
   241  AGGGGAGGCG GAGCTCCCCC CGCGTTTGAC

Predicted gene structure (within gDNA segment 11937 to 13287):

 Exon  1  12473  12640 ( 168 n);  cDNA     49    210 ( 162 n); score: 0.851

MATCH	21326110+	21278903+	0.851	168	0.622	C
PGS_21326110+_21278903+	(12473  12640)

Alignment (genomic DNA sequence = upper lines):

GCGGTGCAGG AGGCGAAGCT GCTGCGGCAG GTGAACGCGC TCATCGTGGC GCACCTCCGT    12532
|||||||||| |||| ||||| |||||||||| |||||||| | |||||||||| |||||||||  
GCGGTGCAGG AGGCCAAGCT GCTGCGGCAG GTGAACGCCC TCATCGTGGC GCACCTCCGC      108


AGCCAGAACC TCGGGCAGGC CGCAGCCGCC GTCGCCGCCG CCACCATGAC CCCCATCTCC    12592
  |||||||| ||  |||||| ||| | |||| |||||||||| |||||||||| |||||   || 
GACCAGAACC TCACGCAGGC CGCCGTCGCC GTCGCCGCCG CCACCATGAC CCCCAAGGCC      168


GCCGCCGAAT CCGTCCCCGC AAATCAACTC CTACGTCTCG TGGCCAAG    12640
| ||||   | || | ||| |  || || ||| || || |||| | ||||||
GACGCC---T CCCT-CCC-C -AACCACCTC CTCCGACTCG TCGCCAAG      210





********************************************************************************
EST sequence   16 +strand (File: 25415362+)

     1  GCAGGAGGCG AAGCTGCTGC GGCAGGTGAA CGCCCTCATC GTGGCGCACC TCCGCGACCA
    61  GAACCTCACG CAGGCCGCCA CCGCCGTCGC CGCCGCCACC ATGACCCCCA AGGCCGACGC
   121  CTCCGCCCCC AACCACCTCC TCCGCCTCCG TCGCCAAGGG

Predicted gene structure (within gDNA segment 12178 to 13142):

 Exon  1  12478  12586 ( 109 n);  cDNA      1    109 ( 109 n); score: 0.927

MATCH	21326110+	25415362+	0.927	109	0.681	C
PGS_21326110+_25415362+	(12478  12586)

Alignment (genomic DNA sequence = upper lines):

GCAGGAGGCG AAGCTGCTGC GGCAGGTGAA CGCGCTCATC GTGGCGCACC TCCGTAGCCA    12537
|||||||||| |||||||||| |||||||||| ||| |||||| |||||||||| ||||   ||| 
GCAGGAGGCG AAGCTGCTGC GGCAGGTGAA CGCCCTCATC GTGGCGCACC TCCGCGACCA       60


GAACCTCGGG CAGGCCGCAG CCGCCGTCGC CGCCGCCACC ATGACCCCC    12586
|||||||  | ||||||||   |||||||||| |||||||||| |||||||||
GAACCTCACG CAGGCCGCCA CCGCCGTCGC CGCCGCCACC ATGACCCCC      109





********************************************************************************
EST sequence   69 +strand (File: 13120649+)

     1  TGGAAGTGGG GACACATCCA TTAAGTTCTT TGAGGTATCA AAAATTAAGC AGACGATGTT
    61  AGGAGACTCC AAAGAAGGCC CTGGCCGACC TGTGGTCCGT ACATTTTATG ACCATGTGCA
   121  GCCCATCAAT GATCTGGATT TCCATCCTAT TAGCCCAATA CTGATATCTG CAGCAAAAGA
   181  TAATACGATA AAGTTCTTTG AGTTCTCCAA AACTGCTGCA AGAAAAGCAT TCAGAGTTAT
   241  TCAGGATACT CATAACGTTA GGTCTGTATG TTTTCATCCT TGCGGCGATT ACATTATAGC
   301  AGGGACTGAT CACCCAGTAG CTCATCTCTA TGATGTAAAC ACTTTCACAT GCTTCTTATC
   361  CGCAAATCCG CAGGACTCTA GTGCTGCCAT CAACCATGTG CGCTACTCGG GTACTGGGAG
   421  CATGTATGTG ACTGCTTCTA AGGATGGTTC TCTGCGCATC TGAGATGGAG TATCTGCTGA
   481  ATGTGTGCGT CCCATAATTG GGGCACATGG ATCTGTAGAA GCTACTAGTG CAATTTTCAC
   541  CA

Predicted gene structure (within gDNA segment 12895 to 15329):

 Exon  1  13247  13280 (  34 n);  cDNA      1     34 (  34 n); score: 0.853
  Intron  1  13281  13380 ( 100 n); Pd: 0.000 (s:    0), Pa: 1.000 (s: 0.82)
 Exon  2  13381  13467 (  87 n);  cDNA     35    121 (  87 n); score: 0.782
  Intron  2  13468  13886 ( 419 n); Pd: 0.992 (s: 0.74), Pa: 0.939 (s: 0.86)
 Exon  3  13887  13957 (  71 n);  cDNA    122    192 (  71 n); score: 0.859
  Intron  3  13958  14109 ( 152 n); Pd: 0.973 (s: 0.84), Pa: 0.989 (s: 0.78)
 Exon  4  14110  14161 (  52 n);  cDNA    193    244 (  52 n); score: 0.788
  Intron  4  14162  14253 (  92 n); Pd: 0.890 (s: 0.80), Pa: 0.830 (s: 0.90)
 Exon  5  14254  14311 (  58 n);  cDNA    245    302 (  58 n); score: 0.897
  Intron  5  14312  14684 ( 373 n); Pd: 0.979 (s: 0.88), Pa: 0.910 (s: 0.88)
 Exon  6  14685  14779 (  95 n);  cDNA    303    397 (  95 n); score: 0.842
  Intron  6  14780  14879 ( 100 n); Pd: 0.995 (s: 0.82), Pa: 0.000 (s: 0.90)
 Exon  7  14880  15024 ( 145 n);  cDNA    398    542 ( 145 n); score: 0.903

MATCH	21326110+	13120649+	0.852	542	1.000	C
PGS_21326110+_13120649+	(13247  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15024)

Alignment (genomic DNA sequence = upper lines):

TGGGAGTGCT GATACATCCA TTAAGTTTTT TGAGGTGAAC TTGAAATTTG AATTGCCACT    13306
||| ||||   || ||||||| ||||||| || ||||                             
TGGAAGTGGG GACACATCCA TTAAGTTCTT TGAG...... .......... ..........       34


CAGGTTGCTA GGTGGGGCTT GTGCTGTTTT CTACTTAGTT GCAACTTGTA ACTCACTATT    13366
                                                                  
.......... .......... .......... .......... .......... ..........       34


GCTCTGTCCT GCAGGTTGCT AAAATTAAGC AGACTATGGT AGGGGACTCC AAAGATGGTC    13426
               ||  |  |||||||||| |||| ||| | ||| |||||| ||||| || | 
.......... ....GTATCA AAAATTAAGC AGACGATGTT AGGAGACTCC AAAGAAGGCC       80


CTGCCAGGCC TGTGATTCGC ACATTTTATG ATCACACACA GGTGAGCATG TATTGCTCAT    13486
||| | | || |||| | ||  |||||||||| | ||    || |                     
CTGGCCGACC TGTGGTCCGT ACATTTTATG ACCATGTGCA G......... ..........      121


ATATGACAGT TTATTTACTC TTCAAGGTCG TGAGACTCTT TTCAACACTT CCACAAGATT    13546
                                                                  
.......... .......... .......... .......... .......... ..........      121


GCCTCCGAGT TAGGTCTCCT GCAGTATTTT TTTTCCTTTA ATATGCGGAG AGCTGCATAT    13606
                                                                  
.......... .......... .......... .......... .......... ..........      121


CATTGCATTA TAGAAAGACT GAAATACATG GGTAGATCAA ATCCACCTGC CACCACAGAC    13666
                                                                  
.......... .......... .......... .......... .......... ..........      121


CACACTTATA TACACACGCT CAACTCACGT TTAGCACACT GGATGCACAC CTAGCAGCTG    13726
                                                                  
.......... .......... .......... .......... .......... ..........      121


CAATTTGTAG TTAGATATTT GCTTACTGAG CTGTGTGGAG CATTGACATG ATATTCAATT    13786
                                                                  
.......... .......... .......... .......... .......... ..........      121


TTTTAATAAA CAACATTTTT TTCCATTTTC ACTAGTTTCT ACTTCATTTC CCATTGCTCA    13846
                                                                  
.......... .......... .......... .......... .......... ..........      121


AATTTCCACT GTGCTCGTAA ACATGATTGA TTTCTTGCAG GCCATCAATG ATCTGGATTT    13906
                                             ||||||||| |||||||||| 
.......... .......... .......... .......... CCCATCAATG ATCTGGATTT      141


TCATCCTGAG AGTCCAATAC TGATATCAGC TGCAAAAGAC AATACAATAA AGTATGCTTA    13966
 ||||||    || ||||||| ||||||| ||  ||||||||  ||||| |||| |          
CCATCCTATT AGCCCAATAC TGATATCTGC AGCAAAAGAT AATACGATAA A.........      192


TCCTTGATGT CTACACTCCG TGCTGTTAAA TTGTCTATTT GAAGTGCTCA TACTAGGATT    14026
                                                                  
.......... .......... .......... .......... .......... ..........      192


AAGCATGATT TTTTAGGAAT TTTTTGCGGT ATTAATTGCT ATCTGTGTTA TTGTTTTGTA    14086
                                                                  
.......... .......... .......... .......... .......... ..........      192


CATGAAAAAA TTTTGCTCAA CAGATTTTTT GACTTCTCAA AGACCAATGC GAGGAAAGCG    14146
                          || ||| || ||||| | | ||   |||  || |||||  
.......... .......... ...GTTCTTT GAGTTCTCCA AAACTGCTGC AAGAAAAGCA      229


TTCAGAGTTA TTCAGGTTGT AAATTCTAGC AATCCAATCT CTCTATATAT CATGTAAAAT    14206
|||||||||| |||||                                                  
TTCAGAGTTA TTCAG..... .......... .......... .......... ..........      244


GGTGTGTTCA TTGCATTTAA CCAGGCTCAT TTGTTAATGC TTGGCAGGAT ACTCATAATG    14266
                                                   ||| |||||||| | 
.......... .......... .......... .......... .......GAT ACTCATAACG      257


TTAGATCTGT ATGTTTTCAT CCTTGTGGGG ATTACCTTTT AGCAGGTACT ATGATCTTTT    14326
|||| ||||| |||||||||| ||||| || | ||||| || | |||||                 
TTAGGTCTGT ATGTTTTCAT CCTTGCGGCG ATTACATTAT AGCAG..... ..........      302


CACTAAATTT AAATTTGATT TCTAGTTCTG CTGTGATTAA CTGATTCTTG ATGTCTGATA    14386
                                                                  
.......... .......... .......... .......... .......... ..........      302


TCAGTTTGAT ATGCTCTGAT TTTTATGCAT TATAAGTTGT TAACATGTTT TCAGTTGTTA    14446
                                                                  
.......... .......... .......... .......... .......... ..........      302


TCTGTAAAGT AATTTAATCA TTTCACCAAA ACAATTTGAT ATTTGGGCTT AAGAATTTGG    14506
                                                                  
.......... .......... .......... .......... .......... ..........      302


ATTTCGTTCC TGGATCAACA GTTTCTGTCT CGTGGGCATT TGAAAAATAC TGCAAGCATA    14566
                                                                  
.......... .......... .......... .......... .......... ..........      302


TCGTATGGAA TTTTCTTCTT ACATATAGTC AAATATTAAC ATTCAAATAT GTATTTTTTT    14626
                                                                  
.......... .......... .......... .......... .......... ..........      302


TAAAAAAACT CATTTTCATA TATTTGGAAG CAAGTGACAC TGATAAAATT ATTTGCAGGG    14686
                                                               || 
.......... .......... .......... .......... .......... ........GG      304


ACTGATCACC CAGTTGCTCA TTTATATGAT ATAAATACTT TTACATGCTA CTTATCAGCA    14746
|||||||||| |||| ||||| | | ||||||  |||| |||| | |||||||  |||||| ||| 
ACTGATCACC CAGTAGCTCA TCTCTATGAT GTAAACACTT TCACATGCTT CTTATCCGCA      364


AATGCACAGG ATTCTAGTTC TCCCATTAAC CAGGTAGCTT TTCTCTTTCC TTCTGATTCA    14806
||| | |||| | |||||| | | |||| ||| ||                               
AATCCGCAGG ACTCTAGTGC TGCCATCAAC CAT....... .......... ..........      397


CAAGCATTAG ATTGCATTGG TTATATTCTC ATCAAAGTTC TCCGCCAGCC ATGCTTACTG    14866
                                                                  
.......... .......... .......... .......... .......... ..........      397


ATGTTGCTGC CAGGTACGCT ACTCCTGTAC TGGGAGCTTG TATGTGACTG CTTCTAAAGA    14926
              || |||| ||||  |||| ||||||| || |||||||||| ||||||| || 
.......... ...GTGCGCT ACTCGGGTAC TGGGAGCATG TATGTGACTG CTTCTAAGGA      444


TGGTTCTCTG CGCATTTGGG ATGGAGTATC TGCTGAATGT GTTCGACCTA TTATTGGAGC    14986
|||||||||| ||||| || | |||||||||| |||||||||| || || || | | ||||| || 
TGGTTCTCTG CGCATCTGAG ATGGAGTATC TGCTGAATGT GTGCGTCCCA TAATTGGGGC      504


ACATGGATCT GCAGAAGCTA CTAGCGCAAT TTTCACCA    15024
|||||||||| | |||||||| |||| ||||| ||||||||
ACATGGATCT GTAGAAGCTA CTAGTGCAAT TTTCACCA      542





********************************************************************************
EST sequence   79 +strand (File: 24301133+)

     1  CGGCACGAGG GAGAGAACTA GTCTCGAGTT TTCCAAAACT GCTGCAAGAA AAGCATTCAG
    61  AGTTATTCAG GATACTCATA ATGTTAGGTC TGTATGTTTT CATCCTTGCG GTGATTACAT
   121  TTTAGCAGGG ACTGATCACC CAGTAGCTCA TCTCTATGAT GTAAACACTT TCACATGCTT
   181  CTTATCCGCA AATCCGCAGG ACTCTAGTGC TGCCATCAAC CAGGTGCGCT ACTCGGGTAC
   241  TGGGAGCATG TATGTGACTG CTTCTAAGGA TGGTTCTCTG CGCATCTGGG ATGGAGTATC
   301  TGCTGAATGT GTTCGTCCCA TAATTGGGGC ACATGGATCT GTAGAAGCTA CTAGTGCAAT
   361  TTTCACCAAA GACGAGAGGT ACATCCTATC CAGTGGGAAG GATTCGTGTA TAAAGTTATG
   421  GGAAGTTGGC ACCGGAAGAC TTGTGAAGCA ATATCCAGGT GTTGTTAATA CACAATTCCG
   481  GTGTCAGGCT GTCTTCAACG AAACCGAGGA GTTTGTACTA TCAACCGACG AGCAAAACAA
   541  CGAGGTTGTC GTCT

Predicted gene structure (within gDNA segment 13572 to 16290):

 Exon  1  14110  14161 (  52 n);  cDNA     20     70 (  51 n); score: 0.731
  Intron  1  14162  14253 (  92 n); Pd: 0.890 (s: 0.74), Pa: 0.830 (s: 0.92)
 Exon  2  14254  14311 (  58 n);  cDNA     71    128 (  58 n); score: 0.931
  Intron  2  14312  14684 ( 373 n); Pd: 0.979 (s: 0.92), Pa: 0.910 (s: 0.88)
 Exon  3  14685  14779 (  95 n);  cDNA    129    223 (  95 n); score: 0.853
  Intron  3  14780  14879 ( 100 n); Pd: 0.995 (s: 0.84), Pa: 0.000 (s: 0.90)
 Exon  4  14880  15034 ( 155 n);  cDNA    224    378 ( 155 n); score: 0.910
  Intron  4  15035  15519 ( 485 n); Pd: 0.794 (s: 0.92), Pa: 0.933 (s: 0.84)
 Exon  5  15520  15628 ( 109 n);  cDNA    379    487 ( 109 n); score: 0.807
  Intron  5  15629  15846 ( 218 n); Pd: 1.000 (s: 0.78), Pa: 0.995 (s: 0.82)
 Exon  6  15847  15903 (  57 n);  cDNA    488    544 (  57 n); score: 0.825
  Intron  6  15904  15975 (  72 n); Pd: 0.991 (s: 0.80), Pa: 0.993 (s:    0)
 Exon  7  15976  15985 (  10 n);  cDNA    545    554 (  10 n); score: 1.000

MATCH	21326110+	24301133+	0.854	536	0.968	C
PGS_21326110+_24301133+	(14110  14161,14254  14311,14685  14779,14880  15034,15520  15628,15847  15903,15976  15985)

Alignment (genomic DNA sequence = upper lines):

ATTTTTTGAC TTCTCAAAGA CCAATGCGAG GAAAGCGTTC AGAGTTATTC AGGTTGTAAA    14169
|  | | ||  || || || | |   ||| ||  ||||| ||| |||||||||| ||         
A-GTCTCGAG TTTTCCAAAA CTGCTGCAAG AAAAGCATTC AGAGTTATTC AG........       70


TTCTAGCAAT CCAATCTCTC TATATATCAT GTAAAATGGT GTGTTCATTG CATTTAACCA    14229
                                                                  
.......... .......... .......... .......... .......... ..........       70


GGCTCATTTG TTAATGCTTG GCAGGATACT CATAATGTTA GATCTGTATG TTTTCATCCT    14289
                          |||||| |||||||||| | |||||||| |||||||||| 
.......... .......... ....GATACT CATAATGTTA GGTCTGTATG TTTTCATCCT      106


TGTGGGGATT ACCTTTTAGC AGGTACTATG ATCTTTTCAC TAAATTTAAA TTTGATTTCT    14349
|| || |||| || ||||||| ||                                          
TGCGGTGATT ACATTTTAGC AG........ .......... .......... ..........      128


AGTTCTGCTG TGATTAACTG ATTCTTGATG TCTGATATCA GTTTGATATG CTCTGATTTT    14409
                                                                  
.......... .......... .......... .......... .......... ..........      128


TATGCATTAT AAGTTGTTAA CATGTTTTCA GTTGTTATCT GTAAAGTAAT TTAATCATTT    14469
                                                                  
.......... .......... .......... .......... .......... ..........      128


CACCAAAACA ATTTGATATT TGGGCTTAAG AATTTGGATT TCGTTCCTGG ATCAACAGTT    14529
                                                                  
.......... .......... .......... .......... .......... ..........      128


TCTGTCTCGT GGGCATTTGA AAAATACTGC AAGCATATCG TATGGAATTT TCTTCTTACA    14589
                                                                  
.......... .......... .......... .......... .......... ..........      128


TATAGTCAAA TATTAACATT CAAATATGTA TTTTTTTTAA AAAAACTCAT TTTCATATAT    14649
                                                                  
.......... .......... .......... .......... .......... ..........      128


TTGGAAGCAA GTGACACTGA TAAAATTATT TGCAGGGACT GATCACCCAG TTGCTCATTT    14709
                                      ||||| |||||||||| | |||||| | 
.......... .......... .......... .....GGACT GATCACCCAG TAGCTCATCT      153


ATATGATATA AATACTTTTA CATGCTACTT ATCAGCAAAT GCACAGGATT CTAGTTCTCC    14769
 |||||| || || ||||| | |||||| ||| ||| ||||||  | ||||| | ||||| || | 
CTATGATGTA AACACTTTCA CATGCTTCTT ATCCGCAAAT CCGCAGGACT CTAGTGCTGC      213


CATTAACCAG GTAGCTTTTC TCTTTCCTTC TGATTCACAA GCATTAGATT GCATTGGTTA    14829
||| ||||||                                                        
CATCAACCAG .......... .......... .......... .......... ..........      223


TATTCTCATC AAAGTTCTCC GCCAGCCATG CTTACTGATG TTGCTGCCAG GTACGCTACT    14889
                                                       || ||||||| 
.......... .......... .......... .......... .......... GTGCGCTACT      233


CCTGTACTGG GAGCTTGTAT GTGACTGCTT CTAAAGATGG TTCTCTGCGC ATTTGGGATG    14949
|  ||||||| |||| ||||| |||||||||| |||| ||||| |||||||||| || ||||||| 
CGGGTACTGG GAGCATGTAT GTGACTGCTT CTAAGGATGG TTCTCTGCGC ATCTGGGATG      293


GAGTATCTGC TGAATGTGTT CGACCTATTA TTGGAGCACA TGGATCTGCA GAAGCTACTA    15009
|||||||||| |||||||||| || || || | |||| ||||| |||||||| | |||||||||| 
GAGTATCTGC TGAATGTGTT CGTCCCATAA TTGGGGCACA TGGATCTGTA GAAGCTACTA      353


GCGCAATTTT CACCAGAGAT GAGAGGTAAG CGAGCTACCA GCATGTCTAA GGTGCTCTTC    15069
| |||||||| ||||| |||  |||||                                       
GTGCAATTTT CACCAAAGAC GAGAG..... .......... .......... ..........      378


CCTCAAGATA AAATCCAGTC ATTGTTTGGT TTGAAGAACA GAGAGAAAGG CATATGCTGT    15129
                                                                  
.......... .......... .......... .......... .......... ..........      378


ATGATTCAAG ACAGTAACTA CTTCAAACCC TGTTTGGAAT GTGGGAATCT TGTAGTGATT    15189
                                                                  
.......... .......... .......... .......... .......... ..........      378


CTGAATGATT TATAACATGT CCTGGATAAT TTCCTGTGTT TCAGACGTGT CGTAACTTTA    15249
                                                                  
.......... .......... .......... .......... .......... ..........      378


TAACACGAAT AACTCTTTCT CCTTTACCCT ACTATTTCAC CACTAAACAA CTAACTTGCC    15309
                                                                  
.......... .......... .......... .......... .......... ..........      378


TATAAACACT TTTTAGACTT CTTCTGAAAG GCCTAGTGTT TATGTGGTTA TATGCAGCGT    15369
                                                                  
.......... .......... .......... .......... .......... ..........      378


GAATGCACTT GCATATAAGA TTGATCTAAA AAATTGATGT AGTGAACTTT GACTACCCGA    15429
                                                                  
.......... .......... .......... .......... .......... ..........      378


AGTATATGCT TAGATAGTTC ATGGATTTCT TTCATAAAAC TGCACACTGT ATTCTGGTTA    15489
                                                                  
.......... .......... .......... .......... .......... ..........      378


TCTGTTATGA AGTTTACTAC GTTCTTTCAG GTATGTCCTA TCTTGTGGGA AAGATTCTTG    15549
                                 |||  ||||| ||  |||||| | ||||| || 
.......... .......... .......... GTACATCCTA TCCAGTGGGA AGGATTCGTG      408


TGTCAAGTTA TGGGAAGTTG GCACTGGACG ACTTGTGAAG CAATATGCAG GAGCCATTCG    15609
| | |||||| |||||||||| |||| ||| | |||||||||| |||||| ||| | |   ||   
TATAAAGTTA TGGGAAGTTG GCACCGGAAG ACTTGTGAAG CAATATCCAG GTGTTGTTAA      468


CAGACAATTT CGTTGTCAGG TTAGTTTCTC TGTGTTTCTA TAAGATTATT ATTTTTTCCT    15669
 | ||||||  || ||||||                                              
TACACAATTC CGGTGTCAG. .......... .......... .......... ..........      487


GATTTAAATT TACTCGTGTG CCATATATAT TATTTTTACC CAAAATTTTA GGAAACAAAA    15729
                                                                  
.......... .......... .......... .......... .......... ..........      487


TATTGCAATT CTTTAATTTG AAAATAGGCT GGTTTGAGCT TGCAGCTTAG GATAACAACA    15789
                                                                  
.......... .......... .......... .......... .......... ..........      487


TACCTAACCT TGCTATGATA GACAATAAAT ATGATAATAA CTGTTCTTAC TATCCAGGCT    15849
                                                              ||| 
.......... .......... .......... .......... .......... .......GCT      490


GTCTTCAATG AAACCGAAGA ATTTGTTCTA TCAGTTGATG AACAAAACAA TGAGGTAAAT    15909
|||||||| | ||||||| ||  ||||| ||| |||   || | | ||||||||  |||       
GTCTTCAACG AAACCGAGGA GTTTGTACTA TCAACCGACG AGCAAAACAA CGAG......      544


TCCAAATTGA GAACAGTATA TATATTTGTA TTTCAGCAAG CTTAACTATG ATACGTCACT    15969
                                                                  
.......... .......... .......... .......... .......... ..........      544


CTTCAGGTTG TCGTCT    15985
      |||| ||||||
......GTTG TCGTCT      554





********************************************************************************
EST sequence   58 +strand (File: 14571087+)

     1  GCATGGGAGA ATATTCAAAA AGCAAAAGCT GAGGCAGCAA TTCAGAAGTT AGTGGTATGT
    61  TCTTTGCTCT AATTCGAACT ATATTGCACT ATTTTTAACT GAATTGATGC TAGGATTGTT
   121  TGCAGGACAT TTTGTTTATA TCTAATGCAT CTAGTTGATC CTGAATTGTA CCCACACTTC
   181  TATGATATCA GATTAAGCTC GAGAAGAAAA GATCATCTTC CCTGGATAAG ATTTTGAACA
   241  CCCTCAAGTC TGCTCAAAGA AAAGCCCAGG TGATGCGTGA GCGTGAGCGT GATGCAGTAA
   301  CAGCAAACCA AGATGGAAAA GGCTCTAGGA AGGCAAAAAA GAGAGTGCAG CTTAGCAAGA
   361  ATGGTCAAAT CAGTTCACTG AGTGGCTGCT TCACTTGCCA TGCTTTCTGA TACATGTAAT
   421  TCCAAAATTG AGTAAGTTGC CATCAGACTG TTAGGGCCTG TTTAGTTCGC ACCCTGAAAA
   481  GTTTTTTTTT TGGGGGGGTA CTGTAGCACA TGTGTAACTA TATTAATTAG TGTCTAATCA
   541  TGGACCAACT AGACTCAAAA GGTTTGTCTC GCAAAATACA TGTAAACTGT GCAATTGGTT
   601  ATTTTTTTAT CTATATTTAA TGCTC

Predicted gene structure (within gDNA segment 13726 to 17349):

 Exon  1  14844  14868 (  25 n);  cDNA    387    411 (  25 n); score: 0.760
  Intron  1  14869  15233 ( 365 n); Pd: 0.000 (s:    0), Pa: 0.765 (s:    0)
 Exon  2  15234  15240 (   7 n);  cDNA    412    418 (   7 n); score: 0.714
  Intron  2  15241  15907 ( 667 n); Pd: 0.243 (s:    0), Pa: 0.000 (s:    0)
 Exon  3  15908  15924 (  17 n);  cDNA    419    435 (  17 n); score: 0.765
  Intron  3  15925  15975 (  51 n); Pd: 0.022 (s:    0), Pa: 0.993 (s:    0)
 Exon  4  15976  15981 (   6 n);  cDNA    436    441 (   6 n); score: 0.833
  Intron  4  15982  16320 ( 339 n); Pd: 0.000 (s:    0), Pa: 0.818 (s:    0)
 Exon  5  16321  16334 (  14 n);  cDNA    442    454 (  13 n); score: 0.571
  Intron  5  16335  16505 ( 171 n); Pd: 0.000 (s:    0), Pa: 0.758 (s:    0)
 Exon  6  16506  16536 (  31 n);  cDNA    455    486 (  32 n); score: 0.710
  Intron  6  16537  16896 ( 360 n); Pd: 0.000 (s:    0), Pa: 0.000 (s: 0.62)
 Exon  7  16897  17040 ( 144 n);  cDNA    487    625 ( 139 n); score: 0.736

MATCH	21326110+	14571087+	0.736	244	0.390	C
PGS_21326110+_14571087+	(14844  14868,15234  15240,15908  15924,15976  15981,16321  16334,16506  16536,16897  17040)

Alignment (genomic DNA sequence = upper lines):

TTCTCCGCCA GCCATGCTTA CTGATGTTGC TGCCAGGTAC GCTACTCCTG TACTGGGAGC    14903
| || | |   |||||||||  |||||                                       
TGCTTCACTT GCCATGCTTT CTGAT..... .......... .......... ..........      411


TTGTATGTGA CTGCTTCTAA AGATGGTTCT CTGCGCATTT GGGATGGAGT ATCTGCTGAA    14963
                                                                  
.......... .......... .......... .......... .......... ..........      411


TGTGTTCGAC CTATTATTGG AGCACATGGA TCTGCAGAAG CTACTAGCGC AATTTTCACC    15023
                                                                  
.......... .......... .......... .......... .......... ..........      411


AGAGATGAGA GGTAAGCGAG CTACCAGCAT GTCTAAGGTG CTCTTCCCTC AAGATAAAAT    15083
                                                                  
.......... .......... .......... .......... .......... ..........      411


CCAGTCATTG TTTGGTTTGA AGAACAGAGA GAAAGGCATA TGCTGTATGA TTCAAGACAG    15143
                                                                  
.......... .......... .......... .......... .......... ..........      411


TAACTACTTC AAACCCTGTT TGGAATGTGG GAATCTTGTA GTGATTCTGA ATGATTTATA    15203
                                                                  
.......... .......... .......... .......... .......... ..........      411


ACATGTCCTG GATAATTTCC TGTGTTTCAG ACGTGTCGTA ACTTTATAAC ACGAATAACT    15263
                                 || |||                           
.......... .......... .......... ACATGTA... .......... ..........      418


CTTTCTCCTT TACCCTACTA TTTCACCACT AAACAACTAA CTTGCCTATA AACACTTTTT    15323
                                                                  
.......... .......... .......... .......... .......... ..........      418


AGACTTCTTC TGAAAGGCCT AGTGTTTATG TGGTTATATG CAGCGTGAAT GCACTTGCAT    15383
                                                                  
.......... .......... .......... .......... .......... ..........      418


ATAAGATTGA TCTAAAAAAT TGATGTAGTG AACTTTGACT ACCCGAAGTA TATGCTTAGA    15443
                                                                  
.......... .......... .......... .......... .......... ..........      418


TAGTTCATGG ATTTCTTTCA TAAAACTGCA CACTGTATTC TGGTTATCTG TTATGAAGTT    15503
                                                                  
.......... .......... .......... .......... .......... ..........      418


TACTACGTTC TTTCAGGTAT GTCCTATCTT GTGGGAAAGA TTCTTGTGTC AAGTTATGGG    15563
                                                                  
.......... .......... .......... .......... .......... ..........      418


AAGTTGGCAC TGGACGACTT GTGAAGCAAT ATGCAGGAGC CATTCGCAGA CAATTTCGTT    15623
                                                                  
.......... .......... .......... .......... .......... ..........      418


GTCAGGTTAG TTTCTCTGTG TTTCTATAAG ATTATTATTT TTTCCTGATT TAAATTTACT    15683
                                                                  
.......... .......... .......... .......... .......... ..........      418


CGTGTGCCAT ATATATTATT TTTACCCAAA ATTTTAGGAA ACAAAATATT GCAATTCTTT    15743
                                                                  
.......... .......... .......... .......... .......... ..........      418


AATTTGAAAA TAGGCTGGTT TGAGCTTGCA GCTTAGGATA ACAACATACC TAACCTTGCT    15803
                                                                  
.......... .......... .......... .......... .......... ..........      418


ATGATAGACA ATAAATATGA TAATAACTGT TCTTACTATC CAGGCTGTCT TCAATGAAAC    15863
                                                                  
.......... .......... .......... .......... .......... ..........      418


CGAAGAATTT GTTCTATCAG TTGATGAACA AAACAATGAG GTAAATTCC- AAATTGAGAA    15922
                                                |||||  |||||||| | 
.......... .......... .......... .......... ....ATTCCA AAATTGAGTA      434


CAGTATATAT ATTTGTATTT CAGCAAGCTT AACTATGATA CGTCACTCTT CAGGTTGTCG    15982
 |                                                        |||| |  
-A........ .......... .......... .......... .......... ...GTTGCC.      441


TCTGGGATGC ACTTACTGCA GAAAAGGTTG CAAGATTGCC CTCTGGCAGC ACTGGTGCTC    16042
                                                                  
.......... .......... .......... .......... .......... ..........      441


CCAGATGGCT CGACCACTCC CCAGTTGAAC CAGTTTTTGT TATTTGTGGA AATGATAGAT    16102
                                                                  
.......... .......... .......... .......... .......... ..........      441


CGATCAGATT CTGGAAACAA ACCGTATAGC TTGTAGATTC AACCATTCAA ATCAAAAGTA    16162
                                                                  
.......... .......... .......... .......... .......... ..........      441


TGCTTTCAGT ATTACGTTTC AGGAGGAATG TGCTCATGTA ACTTTAGTTG TATATGGGAG    16222
                                                                  
.......... .......... .......... .......... .......... ..........      441


AAATTTGCAT AAGCATTTTT TTTATTGGAA ACTGCATAAG CAATTGATTG ATCTAATAGC    16282
                                                                  
.......... .......... .......... .......... .......... ..........      441


AAACCCCAAT GATATGTTTT TTTTTTGGCT CTGCATAGCT GATGACAGTT GTATGAACCC    16342
                                          |  | ||| |||            
.......... .......... .......... ........AT CA-GACTGTT AG........      454


TTGACCTGAT TCTTATTGGT CAGGCCCTTT TCGATGATTT GCTATTTTAT CCCAATTGTG    16402
                                                                  
.......... .......... .......... .......... .......... ..........      454


GATTGCGGAA TATATTTCTT CTTCGAATGT AATGATGGTC TCGCCCTACC ACATGTGTGA    16462
                                                                  
.......... .......... .......... .......... .......... ..........      454


TAGCCTATAA AAGTTCTACA ACACATTATT GCATTTCACT TAGGGCATGT TTAGATTG-A    16521
                                               ||| ||| |||| | | | 
.......... .......... .......... .......... ...GGCCTGT TTAGTTCGCA      471


AGATGAAAAT TTTTTAGGTC ACATCGGATA TGTCGGAAGG ATGTCGGGAG GGGTTTTTAA    16581
   ||||||  |||||                                                  
CCCTGAAAAG TTTTT..... .......... .......... .......... ..........      486


AAACTAATAA AAAAAACAAA TTACATAACT CGTCAGGAAA CTGCAAGACG AATCTATTAA    16641
                                                                  
.......... .......... .......... .......... .......... ..........      486


GTATAATTAA TCTATTATTA GCACATGTGG GTTACTGTAG CACTTAAGGC TAATCATGGA    16701
                                                                  
.......... .......... .......... .......... .......... ..........      486


CTAACTAGGC TTAAAAAATT CATCTCGCGA TTTTCAACCA AACTGTGTAA TTATTTTTTA    16761
                                                                  
.......... .......... .......... .......... .......... ..........      486


TCTACATTTA ATGTTTTATG TATGTGTCTA AAGATTCAAT GTGATGGATG AAAATTTTTT    16821
                                                                  
.......... .......... .......... .......... .......... ..........      486


AGGTGGGAAC TAAACAGGGC CTTATATTTT TTAAAAAAGA TGTGCAAGTG TCAGGCCTTG    16881
                                                                  
.......... .......... .......... .......... .......... ..........      486


TTTAGTTTCG AAAACTTTTT GGTTTTTGAG ACTGTAGCAC TTTCGTTTTT ATTTGACAAA    16941
                ||||| ||     |   ||||||||||  |  ||   | || |   ||  
.......... .....TTTTT GG--GGGGGT ACTGTAGCAC ATGTGTAACT ATAT--TAAT      527


TATTGTCTAA TCATAGAGTA ACTAGGTTTA AAAGATTTAT CTCGCGATTT ATAGGTAAAC    17001
|| ||||||| |||| ||  | |||||  | | |||| ||| | ||||| |  | | | |||||| 
TAGTGTCTAA TCATGGACCA ACTAGACTCA AAAGGTTTGT CTCGCAAAAT ACATGTAAAC      587


TGTGCAATTA GTTTTTATTT TTGTATATAT TTAATGCTT    17040
|||||||||  ||| || ||| || | ||||| |||||||| 
TGTGCAATTG GTTATT-TTT TTATCTATAT TTAATGCTC      625





********************************************************************************
EST sequence   88 +strand (File: 13469214+)

     1  TCTGACAAGA GCAACGAAGA GAATAATTGA TCTACAGTTT CTTTCCCCCG TCTGAAACTT
    61  TGGTTAGCTT AAATCTGGGA CACGTATTGG AACAGGAGTA CCATGGGAGT CTGCACTGCA
   121  AAAAAAAAAT GCAGATTATC GATCTTAGAT AGAAGGAAAC ATAGTGGGGG GGAAAGGAAC
   181  CTTTTGTTTT CTTTTACTAC AGAAGTATCA ATTCGTGCGT TTGTCCCGGT GTTAGTTTCT
   241  TCAGGAAACG GACATTGAAC TTAACAGTGC AATTTTCAGA CTTTGCAGCA AGTGCCATCA
   301  GACCACTCCA TTCTGTGTAG ACTCGGCCCT CAGGACGTTG TGGCCAACCT GACTATTCAC
   361  ATCTTTTGTG CGCCGCCCGT TTCACTTTCG TGGTGTTTCC TTGTAGCCTT TTTTGTCTGC
   421  CATGTTTGCT TGTTGCCAGA CGCTGAATCA GGCACGGCGG GCCTTGTTTA GTTCCAAAAT
   481  ATTTTGCAAA ATCGACACTG TAGCTCTTTC GTTTGTATTT GACAAATATT GTCTAATCAT
   541  AGACTAACTA GGTTC

Predicted gene structure (within gDNA segment 14280 to 17323):

 Exon  1  14280  14311 (  32 n);  cDNA    379    409 (  31 n); score: 0.656
  Intron  1  14312  14527 ( 216 n); Pd: 0.979 (s:    0), Pa: 0.640 (s:    0)
 Exon  2  14528  14537 (  10 n);  cDNA    410    419 (  10 n); score: 0.800
  Intron  2  14538  14854 ( 317 n); Pd: 0.000 (s:    0), Pa: 0.442 (s:    0)
 Exon  3  14855  14879 (  25 n);  cDNA    420    439 (  20 n); score: 0.720
  Intron  3  14880  15883 (1004 n); Pd: 0.978 (s:    0), Pa: 0.361 (s:    0)
 Exon  4  15884  15903 (  20 n);  cDNA    440    459 (  20 n); score: 0.500
  Intron  4  15904  16874 ( 971 n); Pd: 0.991 (s:    0), Pa: 0.000 (s: 0.74)
 Exon  5  16875  16970 (  96 n);  cDNA    460    555 (  96 n); score: 0.833

MATCH	21326110+	13469214+	0.833	183	0.330	C
PGS_21326110+_13469214+	(14280  14311,14528  14537,14855  14879,15884  15903,16875  16970)

Alignment (genomic DNA sequence = upper lines):

TTTTCATCCT TGTGGGGATT ACCTTTTAGC AGGTACTATG ATCTTTTCAC TAAATTTAAA    14339
 |||||   |  |||| | ||  |||| ||||                                  
GTTTCACTTT CGTGGTG-TT TCCTTGTAGC CT........ .......... ..........      409


TTTGATTTCT AGTTCTGCTG TGATTAACTG ATTCTTGATG TCTGATATCA GTTTGATATG    14399
                                                                  
.......... .......... .......... .......... .......... ..........      409


CTCTGATTTT TATGCATTAT AAGTTGTTAA CATGTTTTCA GTTGTTATCT GTAAAGTAAT    14459
                                                                  
.......... .......... .......... .......... .......... ..........      409


TTAATCATTT CACCAAAACA ATTTGATATT TGGGCTTAAG AATTTGGATT TCGTTCCTGG    14519
                                                                  
.......... .......... .......... .......... .......... ..........      409


ATCAACAGTT TCTGTCTCGT GGGCATTTGA AAAATACTGC AAGCATATCG TATGGAATTT    14579
        || | |||||                                                
........TT TTTGTCTG.. .......... .......... .......... ..........      419


TCTTCTTACA TATAGTCAAA TATTAACATT CAAATATGTA TTTTTTTTAA AAAAACTCAT    14639
                                                                  
.......... .......... .......... .......... .......... ..........      419


TTTCATATAT TTGGAAGCAA GTGACACTGA TAAAATTATT TGCAGGGACT GATCACCCAG    14699
                                                                  
.......... .......... .......... .......... .......... ..........      419


TTGCTCATTT ATATGATATA AATACTTTTA CATGCTACTT ATCAGCAAAT GCACAGGATT    14759
                                                                  
.......... .......... .......... .......... .......... ..........      419


CTAGTTCTCC CATTAACCAG GTAGCTTTTC TCTTTCCTTC TGATTCACAA GCATTAGATT    14819
                                                                  
.......... .......... .......... .......... .......... ..........      419


GCATTGGTTA TATTCTCATC AAAGTTCTCC GCCAGCCATG CTTACTGATG TTGCTGCCAG    14879
                                      |||||  ||  ||    ||| |||||| 
.......... .......... .......... .....CCATG -TT--TG--C TTGTTGCCAG      439


GTACGCTACT CCTGTACTGG GAGCTTGTAT GTGACTGCTT CTAAAGATGG TTCTCTGCGC    14939
                                                                  
.......... .......... .......... .......... .......... ..........      439


ATTTGGGATG GAGTATCTGC TGAATGTGTT CGACCTATTA TTGGAGCACA TGGATCTGCA    14999
                                                                  
.......... .......... .......... .......... .......... ..........      439


GAAGCTACTA GCGCAATTTT CACCAGAGAT GAGAGGTAAG CGAGCTACCA GCATGTCTAA    15059
                                                                  
.......... .......... .......... .......... .......... ..........      439


GGTGCTCTTC CCTCAAGATA AAATCCAGTC ATTGTTTGGT TTGAAGAACA GAGAGAAAGG    15119
                                                                  
.......... .......... .......... .......... .......... ..........      439


CATATGCTGT ATGATTCAAG ACAGTAACTA CTTCAAACCC TGTTTGGAAT GTGGGAATCT    15179
                                                                  
.......... .......... .......... .......... .......... ..........      439


TGTAGTGATT CTGAATGATT TATAACATGT CCTGGATAAT TTCCTGTGTT TCAGACGTGT    15239
                                                                  
.......... .......... .......... .......... .......... ..........      439


CGTAACTTTA TAACACGAAT AACTCTTTCT CCTTTACCCT ACTATTTCAC CACTAAACAA    15299
                                                                  
.......... .......... .......... .......... .......... ..........      439


CTAACTTGCC TATAAACACT TTTTAGACTT CTTCTGAAAG GCCTAGTGTT TATGTGGTTA    15359
                                                                  
.......... .......... .......... .......... .......... ..........      439


TATGCAGCGT GAATGCACTT GCATATAAGA TTGATCTAAA AAATTGATGT AGTGAACTTT    15419
                                                                  
.......... .......... .......... .......... .......... ..........      439


GACTACCCGA AGTATATGCT TAGATAGTTC ATGGATTTCT TTCATAAAAC TGCACACTGT    15479
                                                                  
.......... .......... .......... .......... .......... ..........      439


ATTCTGGTTA TCTGTTATGA AGTTTACTAC GTTCTTTCAG GTATGTCCTA TCTTGTGGGA    15539
                                                                  
.......... .......... .......... .......... .......... ..........      439


AAGATTCTTG TGTCAAGTTA TGGGAAGTTG GCACTGGACG ACTTGTGAAG CAATATGCAG    15599
                                                                  
.......... .......... .......... .......... .......... ..........      439


GAGCCATTCG CAGACAATTT CGTTGTCAGG TTAGTTTCTC TGTGTTTCTA TAAGATTATT    15659
                                                                  
.......... .......... .......... .......... .......... ..........      439


ATTTTTTCCT GATTTAAATT TACTCGTGTG CCATATATAT TATTTTTACC CAAAATTTTA    15719
                                                                  
.......... .......... .......... .......... .......... ..........      439


GGAAACAAAA TATTGCAATT CTTTAATTTG AAAATAGGCT GGTTTGAGCT TGCAGCTTAG    15779
                                                                  
.......... .......... .......... .......... .......... ..........      439


GATAACAACA TACCTAACCT TGCTATGATA GACAATAAAT ATGATAATAA CTGTTCTTAC    15839
                                                                  
.......... .......... .......... .......... .......... ..........      439


TATCCAGGCT GTCTTCAATG AAACCGAAGA ATTTGTTCTA TCAGTTGATG AACAAAACAA    15899
                                                  | || ||  |  ||  
.......... .......... .......... .......... ....ACGCTG AATCAGGCAC      455


TGAGGTAAAT TCCAAATTGA GAACAGTATA TATATTTGTA TTTCAGCAAG CTTAACTATG    15959
 | |                                                              
GGCG...... .......... .......... .......... .......... ..........      459


ATACGTCACT CTTCAGGTTG TCGTCTGGGA TGCACTTACT GCAGAAAAGG TTGCAAGATT    16019
                                                                  
.......... .......... .......... .......... .......... ..........      459


GCCCTCTGGC AGCACTGGTG CTCCCAGATG GCTCGACCAC TCCCCAGTTG AACCAGTTTT    16079
                                                                  
.......... .......... .......... .......... .......... ..........      459


TGTTATTTGT GGAAATGATA GATCGATCAG ATTCTGGAAA CAAACCGTAT AGCTTGTAGA    16139
                                                                  
.......... .......... .......... .......... .......... ..........      459


TTCAACCATT CAAATCAAAA GTATGCTTTC AGTATTACGT TTCAGGAGGA ATGTGCTCAT    16199
                                                                  
.......... .......... .......... .......... .......... ..........      459


GTAACTTTAG TTGTATATGG GAGAAATTTG CATAAGCATT TTTTTTATTG GAAACTGCAT    16259
                                                                  
.......... .......... .......... .......... .......... ..........      459


AAGCAATTGA TTGATCTAAT AGCAAACCCC AATGATATGT TTTTTTTTTG GCTCTGCATA    16319
                                                                  
.......... .......... .......... .......... .......... ..........      459


GCTGATGACA GTTGTATGAA CCCTTGACCT GATTCTTATT GGTCAGGCCC TTTTCGATGA    16379
                                                                  
.......... .......... .......... .......... .......... ..........      459


TTTGCTATTT TATCCCAATT GTGGATTGCG GAATATATTT CTTCTTCGAA TGTAATGATG    16439
                                                                  
.......... .......... .......... .......... .......... ..........      459


GTCTCGCCCT ACCACATGTG TGATAGCCTA TAAAAGTTCT ACAACACATT ATTGCATTTC    16499
                                                                  
.......... .......... .......... .......... .......... ..........      459


ACTTAGGGCA TGTTTAGATT GAAGATGAAA ATTTTTTAGG TCACATCGGA TATGTCGGAA    16559
                                                                  
.......... .......... .......... .......... .......... ..........      459


GGATGTCGGG AGGGGTTTTT AAAAACTAAT AAAAAAAACA AATTACATAA CTCGTCAGGA    16619
                                                                  
.......... .......... .......... .......... .......... ..........      459


AACTGCAAGA CGAATCTATT AAGTATAATT AATCTATTAT TAGCACATGT GGGTTACTGT    16679
                                                                  
.......... .......... .......... .......... .......... ..........      459


AGCACTTAAG GCTAATCATG GACTAACTAG GCTTAAAAAA TTCATCTCGC GATTTTCAAC    16739
                                                                  
.......... .......... .......... .......... .......... ..........      459


CAAACTGTGT AATTATTTTT TATCTACATT TAATGTTTTA TGTATGTGTC TAAAGATTCA    16799
                                                                  
.......... .......... .......... .......... .......... ..........      459


ATGTGATGGA TGAAAATTTT TTAGGTGGGA ACTAAACAGG GCCTTATATT TTTTAAAAAA    16859
                                                                  
.......... .......... .......... .......... .......... ..........      459


GATGTGCAAG TGTCAGGCCT TGTTTAGTTT CGAAAACTTT TTGGTTTTTG AGACTGTAGC    16919
                ||||| |||||||||  | |||  ||| |      | | | |||||||| 
.......... .....GGCCT TGTTTAGTTC CAAAATATTT TGCAAAATCG ACACTGTAGC      504


ACTTTCGTTT TTATTTGACA AATATTGTCT AATCATAGAG TAACTAGGTT T    16970
 |||||||||  ||||||||| |||||||||| |||||||||  ||||||||||  
TCTTTCGTTT GTATTTGACA AATATTGTCT AATCATAGAC TAACTAGGTT C      555





********************************************************************************
EST sequence  133 -strand (File: 12027888-)

     1  ATCCCCCGCA AAAATCCCCG CCAGGACCTC TTAGTTGCTT GCCCAATCAA ACCCAGGTGC
    61  CGCTACTCGG GGTACTTGGG AGCCATGTAT GTGACTGCTT CTAAGGATGT TCTCTGCGCA
   121  TCTTGGGATG GAGTATCTTG CTGAATGTGT TCGTCCCCAT AATTGGGGCA CATGGATCTG
   181  TAGAAGCTAC TAGTGCAATT TTCACCAAAG ACGAGAGGTA CATCCTATCC AGTGGGAAGG
   241  ATTCGTGTAT AAAGTTATGG GAAGTTGGCA CCGGAAGACT TGTGAAGCAA TATCCAGGTG
   301  TTGTTAATAC ACAATTCCGG TGTCAGGCTG TCTTCAACGA AACCGAGGAG TTTGTACTAT
   361  CAACCGACGA GCAAAACAAC GAGGTTGTCG TCTGGGACGC CCTTACTTCT GAAAGGGTGG
   421  CAAGATTGCC GTCTGGCCAC ACCGGCGCCC CTAGGTGGCT GGAGCACTCC CCTGTAGAGC
   481  CAGTGTTTGT TACATGCGGA AACGATCGAT CCGTCAGATT CTGGAAATAA ACGGTGTAGA
   541  TTCAATTCAA CCCTGGCATT TAAATCATGA AGTTTGTTGT ATCATGAGTA CTTCAGGGTA
   601  AAAGAAAGGA ATACTTGTAA TTGTAGTGGC TGTACTTATA CATGCTGTTG ATACATCTTC
   661  TTCTAAAAAA AAAAAAAAAA AAA

Predicted gene structure (within gDNA segment 14175 to 17199):

 Exon  1  14897  15034 ( 138 n);  cDNA     77    217 ( 141 n); score: 0.862
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s: 0.92), Pa: 0.933 (s: 0.84)
 Exon  2  15520  15628 ( 109 n);  cDNA    218    326 ( 109 n); score: 0.807
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 0.78), Pa: 0.995 (s: 0.82)
 Exon  3  15847  15903 (  57 n);  cDNA    327    383 (  57 n); score: 0.825
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 0.80), Pa: 0.993 (s: 0.86)
 Exon  4  15976  16159 ( 184 n);  cDNA    384    565 ( 182 n); score: 0.777
 PPA                              cDNA    665    683

MATCH	21326110+	12027888-	0.814	488	0.714	C
PGS_21326110+_12027888-	(14897  15034,15520  15628,15847  15903,15976  16159)

Alignment (genomic DNA sequence = upper lines):

TGGGAG-CTT GTATGTGACT GCTTCTAAAG ATGGTTCTCT GCGCAT-TTG GGATGGAGTA    14954
|||||| | | |||||||||| |||||||| | || ||||||| |||||| ||| |||||||||| 
TGGGAGCCAT GTATGTGACT GCTTCTAAGG AT-GTTCTCT GCGCATCTTG GGATGGAGTA      135


TC-TGCTGAA TGTGTTCG-A CCTATTATTG GAGCACATGG ATCTGCAGAA GCTACTAGCG    15012
|| ||||||| ||||||||   || || |||| | |||||||| ||||| |||| |||||||| | 
TCTTGCTGAA TGTGTTCGTC CCCATAATTG GGGCACATGG ATCTGTAGAA GCTACTAGTG      195


CAATTTTCAC CAGAGATGAG AGGTAAGCGA GCTACCAGCA TGTCTAAGGT GCTCTTCCCT    15072
|||||||||| || ||| ||| ||                                          
CAATTTTCAC CAAAGACGAG AG........ .......... .......... ..........      217


CAAGATAAAA TCCAGTCATT GTTTGGTTTG AAGAACAGAG AGAAAGGCAT ATGCTGTATG    15132
                                                                  
.......... .......... .......... .......... .......... ..........      217


ATTCAAGACA GTAACTACTT CAAACCCTGT TTGGAATGTG GGAATCTTGT AGTGATTCTG    15192
                                                                  
.......... .......... .......... .......... .......... ..........      217


AATGATTTAT AACATGTCCT GGATAATTTC CTGTGTTTCA GACGTGTCGT AACTTTATAA    15252
                                                                  
.......... .......... .......... .......... .......... ..........      217


CACGAATAAC TCTTTCTCCT TTACCCTACT ATTTCACCAC TAAACAACTA ACTTGCCTAT    15312
                                                                  
.......... .......... .......... .......... .......... ..........      217


AAACACTTTT TAGACTTCTT CTGAAAGGCC TAGTGTTTAT GTGGTTATAT GCAGCGTGAA    15372
                                                                  
.......... .......... .......... .......... .......... ..........      217


TGCACTTGCA TATAAGATTG ATCTAAAAAA TTGATGTAGT GAACTTTGAC TACCCGAAGT    15432
                                                                  
.......... .......... .......... .......... .......... ..........      217


ATATGCTTAG ATAGTTCATG GATTTCTTTC ATAAAACTGC ACACTGTATT CTGGTTATCT    15492
                                                                  
.......... .......... .......... .......... .......... ..........      217


GTTATGAAGT TTACTACGTT CTTTCAGGTA TGTCCTATCT TGTGGGAAAG ATTCTTGTGT    15552
                             |||   |||||||   ||||||| | |||| ||| | 
.......... .......... .......GTA CATCCTATCC AGTGGGAAGG ATTCGTGTAT      250


CAAGTTATGG GAAGTTGGCA CTGGACGACT TGTGAAGCAA TATGCAGGAG CCATTCGCAG    15612
 ||||||||| |||||||||| | ||| |||| |||||||||| ||| |||| |    ||   |  
AAAGTTATGG GAAGTTGGCA CCGGAAGACT TGTGAAGCAA TATCCAGGTG TTGTTAATAC      310


ACAATTTCGT TGTCAGGTTA GTTTCTCTGT GTTTCTATAA GATTATTATT TTTTCCTGAT    15672
|||||| ||  ||||||                                                 
ACAATTCCGG TGTCAG.... .......... .......... .......... ..........      326


TTAAATTTAC TCGTGTGCCA TATATATTAT TTTTACCCAA AATTTTAGGA AACAAAATAT    15732
                                                                  
.......... .......... .......... .......... .......... ..........      326


TGCAATTCTT TAATTTGAAA ATAGGCTGGT TTGAGCTTGC AGCTTAGGAT AACAACATAC    15792
                                                                  
.......... .......... .......... .......... .......... ..........      326


CTAACCTTGC TATGATAGAC AATAAATATG ATAATAACTG TTCTTACTAT CCAGGCTGTC    15852
                                                           |||||| 
.......... .......... .......... .......... .......... ....GCTGTC      332


TTCAATGAAA CCGAAGAATT TGTTCTATCA GTTGATGAAC AAAACAATGA GGTAAATTCC    15912
||||| |||| |||| || || ||| ||||||    || || | ||||||| || |          
TTCAACGAAA CCGAGGAGTT TGTACTATCA ACCGACGAGC AAAACAACGA G.........      383


AAATTGAGAA CAGTATATAT ATTTGTATTT CAGCAAGCTT AACTATGATA CGTCACTCTT    15972
                                                                  
.......... .......... .......... .......... .......... ..........      383


CAGGTTGTCG TCTGGGATGC ACTTACTGCA GAAAAGGTTG CAAGATTGCC CTCTGGCAGC    16032
   ||||||| ||||||| ||  |||||| |  |||| ||| | ||||||||||  ||||||  | 
...GTTGTCG TCTGGGACGC CCTTACTTCT GAAAGGGTGG CAAGATTGCC GTCTGGCCAC      440


ACTGGTGCTC CCAGATGGCT CGACCACTCC CCAGTTGAAC CAGTTTTTGT TATTTGTGGA    16092
|| || || | | || |||||  || |||||| || || || | |||| ||||| ||  || ||| 
ACCGGCGCCC CTAGGTGGCT GGAGCACTCC CCTGTAGAGC CAGTGTTTGT TACATGCGGA      500


AATGATAGAT CGATCAGATT CTGGAAACAA ACCGTATAGC TTGTAGATTC AACCATTCAA    16152
|| ||| ||| |  ||||||| ||||||| || || || |||  ||  | |||| |||| |   | 
AACGATCGAT CCGTCAGATT CTGGAAATAA ACGGTGTAGA TT-CA-ATTC AACCCTGGCA      558


ATCAAAA    16159
 | ||| 
TTTAAAT      565





********************************************************************************
EST sequence  135 -strand (File: 12038224-)

     1  GGAGGCATTG TATGTGACTT GCTTCTTAAG GATGGTTCTN TTGCGCATCT GGGATGGAGG
    61  TATCTTGCTG AATGTGTTCG TCCCATAATT GGGGCACATG GATCTTGTAG AAGCTACTTA
   121  GTGCAATTTT CACCCAAAGA CGAGAGGTAC ATCCTATCCA GTGGGAAGGA TTCGTGTATA
   181  AAGTTATGGG AAGTTGGCAC CGGAAGACTT GTGAAGCAAT ATCCAGGTGT TGTTAATACA
   241  CAATTCCGGT GTCAGGCTGT CTTCAACGAA ACCGAGGAGT TTGTACTATC AACCGACGAG
   301  CAAAACAACG AGGTTGTCGT NTGGGACGCC CTTACTTCTG AAAGGGTGGC AAGATTGCCG
   361  TCTGGCCACA CCGGCGCCCC TAGGTGGCTG GAGCACTCCC CTGTAGAGCC AGTGTTTGTT
   421  ACATGCGGAA ACGATCGATC CGTCAGATTC TGGAAATAAA CGGTGTAGAT TCAATTCAAC
   481  CCTGGCATTT AAATCATGAA GTTTGTTGTA TCATGAGTAC TTCAGGGTAA AAGAAAGGAA
   541  TACTTGTAAT TGTAGTGGCT GTACTTATAC ATGCTGTTGA TACATGGTGN TGTAAAAA

Predicted gene structure (within gDNA segment 14564 to 17129):

 Exon  1  14898  15034 ( 137 n);  cDNA      1    146 ( 146 n); score: 0.774
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s: 0.79), Pa: 0.933 (s: 0.84)
 Exon  2  15520  15628 ( 109 n);  cDNA    147    255 ( 109 n); score: 0.807
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 0.78), Pa: 0.995 (s: 0.82)
 Exon  3  15847  15903 (  57 n);  cDNA    256    312 (  57 n); score: 0.825
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 0.80), Pa: 0.993 (s: 0.84)
 Exon  4  15976  16159 ( 184 n);  cDNA    313    494 ( 182 n); score: 0.772

MATCH	21326110+	12038224-	0.786	487	0.814	C
PGS_21326110+_12038224-	(14898  15034,15520  15628,15847  15903,15976  16159)

Alignment (genomic DNA sequence = upper lines):

GGGAGC-TTG TATGTGAC-T GCTTCTAAA- GATGGTTCTC -TGCGCATTT GGGATGGAG-    14952
||  || ||| |||||||| | |||||| ||  |||||||||   ||||||| | |||||||||  
GGAGGCATTG TATGTGACTT GCTTCTTAAG GATGGTTCTN TTGCGCATCT GGGATGGAGG       60


TATC-TGCTG AATGTGTTCG ACCTATTATT GGAGCACATG GATC-TGCAG AAGCTAC-TA    15009
|||| ||||| ||||||||||  || || ||| || ||||||| |||| || || ||||||| || 
TATCTTGCTG AATGTGTTCG TCCCATAATT GGGGCACATG GATCTTGTAG AAGCTACTTA      120


GCGCAATTTT CA-CCAGAGA TGAGAGGTAA GCGAGCTACC AGCATGTCTA AGGTGCTCTT    15068
| |||||||| || ||| |||  |||||                                      
GTGCAATTTT CACCCAAAGA CGAGAG.... .......... .......... ..........      146


CCCTCAAGAT AAAATCCAGT CATTGTTTGG TTTGAAGAAC AGAGAGAAAG GCATATGCTG    15128
                                                                  
.......... .......... .......... .......... .......... ..........      146


TATGATTCAA GACAGTAACT ACTTCAAACC CTGTTTGGAA TGTGGGAATC TTGTAGTGAT    15188
                                                                  
.......... .......... .......... .......... .......... ..........      146


TCTGAATGAT TTATAACATG TCCTGGATAA TTTCCTGTGT TTCAGACGTG TCGTAACTTT    15248
                                                                  
.......... .......... .......... .......... .......... ..........      146


ATAACACGAA TAACTCTTTC TCCTTTACCC TACTATTTCA CCACTAAACA ACTAACTTGC    15308
                                                                  
.......... .......... .......... .......... .......... ..........      146


CTATAAACAC TTTTTAGACT TCTTCTGAAA GGCCTAGTGT TTATGTGGTT ATATGCAGCG    15368
                                                                  
.......... .......... .......... .......... .......... ..........      146


TGAATGCACT TGCATATAAG ATTGATCTAA AAAATTGATG TAGTGAACTT TGACTACCCG    15428
                                                                  
.......... .......... .......... .......... .......... ..........      146


AAGTATATGC TTAGATAGTT CATGGATTTC TTTCATAAAA CTGCACACTG TATTCTGGTT    15488
                                                                  
.......... .......... .......... .......... .......... ..........      146


ATCTGTTATG AAGTTTACTA CGTTCTTTCA GGTATGTCCT ATCTTGTGGG AAAGATTCTT    15548
                                  |||  |||| |||  ||||| || ||||| | 
.......... .......... .......... .GTACATCCT ATCCAGTGGG AAGGATTCGT      175


GTGTCAAGTT ATGGGAAGTT GGCACTGGAC GACTTGTGAA GCAATATGCA GGAGCCATTC    15608
|| | ||||| |||||||||| ||||| |||  |||||||||| ||||||| || || |   ||  
GTATAAAGTT ATGGGAAGTT GGCACCGGAA GACTTGTGAA GCAATATCCA GGTGTTGTTA      235


GCAGACAATT TCGTTGTCAG GTTAGTTTCT CTGTGTTTCT ATAAGATTAT TATTTTTTCC    15668
  | ||||||  || ||||||                                             
ATACACAATT CCGGTGTCAG .......... .......... .......... ..........      255


TGATTTAAAT TTACTCGTGT GCCATATATA TTATTTTTAC CCAAAATTTT AGGAAACAAA    15728
                                                                  
.......... .......... .......... .......... .......... ..........      255


ATATTGCAAT TCTTTAATTT GAAAATAGGC TGGTTTGAGC TTGCAGCTTA GGATAACAAC    15788
                                                                  
.......... .......... .......... .......... .......... ..........      255


ATACCTAACC TTGCTATGAT AGACAATAAA TATGATAATA ACTGTTCTTA CTATCCAGGC    15848
                                                               || 
.......... .......... .......... .......... .......... ........GC      257


TGTCTTCAAT GAAACCGAAG AATTTGTTCT ATCAGTTGAT GAACAAAACA ATGAGGTAAA    15908
|||||||||  |||||||| | | ||||| || ||||   ||  || ||||||| | |||      
TGTCTTCAAC GAAACCGAGG AGTTTGTACT ATCAACCGAC GAGCAAAACA ACGAG.....      312


TTCCAAATTG AGAACAGTAT ATATATTTGT ATTTCAGCAA GCTTAACTAT GATACGTCAC    15968
                                                                  
.......... .......... .......... .......... .......... ..........      312


TCTTCAGGTT GTCGTCTGGG ATGCACTTAC TGCAGAAAAG GTTGCAAGAT TGCCCTCTGG    16028
       ||| ||||| |||| | || ||||| | | |||| | || ||||||| |||| ||||| 
.......GTT GTCGTNTGGG ACGCCCTTAC TTCTGAAAGG GTGGCAAGAT TGCCGTCTGG      365


CAGCACTGGT GCTCCCAGAT GGCTCGACCA CTCCCCAGTT GAACCAGTTT TTGTTATTTG    16088
|  ||| ||  || || || | |||| || || |||||| ||  || ||||| | ||||||  || 
CCACACCGGC GCCCCTAGGT GGCTGGAGCA CTCCCCTGTA GAGCCAGTGT TTGTTACATG      425


TGGAAATGAT AGATCGATCA GATTCTGGAA ACAAACCGTA TAGCTTGTAG ATTCAACCAT    16148
 ||||| |||  ||||  ||| |||||||||| | |||| ||  ||| ||  |  |||||||| | 
CGGAAACGAT CGATCCGTCA GATTCTGGAA ATAAACGGTG TAGATT-CA- ATTCAACCCT      483


TCAAATCAAA A    16159
   | | |||  
GGCATTTAAA T      494





********************************************************************************
EST sequence  134 -strand (File: 12038221-)

     1  GTATGTGACT GCTTCNTAAG GATGGTTCTT CTTGCGCATT CTTGGGATGG GAGTATCTGC
    61  CTGAATGTGT TCGTCCCCAT AATTGGGGCA CATGGATCTG TAGAAGCTAC TAGTGCAATT
   121  TTCACCAAAG ACGAGAGGTA CATCCTATCC AGTGGGAAGG ATTCGTGTAT AAAGTTATGG
   181  GAAGTTGGCA CCGGAAGACT TGTGAAGCAA TATCCAGGTG TTGTTAATAC ACAATTCCGG
   241  TGTCAGGCTG TCTTCAACGA AACCGAGGAG TTTGTACTAT CAACCGACGA GCAAAACAAC
   301  GAGGTTGTCG TNTGGGACGC CCTTACTTCT GAAAGGGTGG CAAGATTGCC GTCTGGCCAC
   361  ACCGGCGCCC CTAGGTGGCT GGAGCACTCC CCTGTAGAGC CAGTGTTTGT TACATGCGGA
   421  AACGATCGAT CCGTCAGATT CTGGAAATNA ACGGTGTAGA TTCAATTCAA CCCTGGCATT
   481  TAAATCATGA AGTTTGTTGT ATCATGAGTA CTTCAGGGTA AAAGAAAGGA ATACTTGTAA
   541  TTGTAGTGGC TGTACTTATA CATGCTGTTG ATACATCTTC TTCTAAAAAA AAAAAAAAAA
   601  AAAAAAAAA

Predicted gene structure (within gDNA segment 14601 to 17229):

 Exon  1  14906  15034 ( 129 n);  cDNA      1    137 ( 137 n); score: 0.806
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s: 0.92), Pa: 0.933 (s: 0.84)
 Exon  2  15520  15628 ( 109 n);  cDNA    138    246 ( 109 n); score: 0.807
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 0.78), Pa: 0.995 (s: 0.82)
 Exon  3  15847  15903 (  57 n);  cDNA    247    303 (  57 n); score: 0.825
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 0.80), Pa: 0.993 (s: 0.84)
 Exon  4  15976  16159 ( 184 n);  cDNA    304    485 ( 182 n); score: 0.766
 PPA                              cDNA    585    609

MATCH	21326110+	12038221-	0.793	479	0.787	C
PGS_21326110+_12038221-	(14906  15034,15520  15628,15847  15903,15976  16159)

Alignment (genomic DNA sequence = upper lines):

GTATGTGACT GCTTC-TAAA GATGGTTC-T C-TGCGCA-T -TTGGGATG- GAGTATCTGC    14959
|||||||||| ||||| |||  |||||||| | | |||||| |  ||||||||  |||||||||| 
GTATGTGACT GCTTCNTAAG GATGGTTCTT CTTGCGCATT CTTGGGATGG GAGTATCTGC       60


-TGAATGTGT TCG-ACCTAT TATTGGAGCA CATGGATCTG CAGAAGCTAC TAGCGCAATT    15017
 ||||||||| |||  || ||  ||||| ||| ||||||||||  ||||||||| ||| |||||| 
CTGAATGTGT TCGTCCCCAT AATTGGGGCA CATGGATCTG TAGAAGCTAC TAGTGCAATT      120


TTCACCAGAG ATGAGAGGTA AGCGAGCTAC CAGCATGTCT AAGGTGCTCT TCCCTCAAGA    15077
||||||| || | |||||                                                
TTCACCAAAG ACGAGAG... .......... .......... .......... ..........      137


TAAAATCCAG TCATTGTTTG GTTTGAAGAA CAGAGAGAAA GGCATATGCT GTATGATTCA    15137
                                                                  
.......... .......... .......... .......... .......... ..........      137


AGACAGTAAC TACTTCAAAC CCTGTTTGGA ATGTGGGAAT CTTGTAGTGA TTCTGAATGA    15197
                                                                  
.......... .......... .......... .......... .......... ..........      137


TTTATAACAT GTCCTGGATA ATTTCCTGTG TTTCAGACGT GTCGTAACTT TATAACACGA    15257
                                                                  
.......... .......... .......... .......... .......... ..........      137


ATAACTCTTT CTCCTTTACC CTACTATTTC ACCACTAAAC AACTAACTTG CCTATAAACA    15317
                                                                  
.......... .......... .......... .......... .......... ..........      137


CTTTTTAGAC TTCTTCTGAA AGGCCTAGTG TTTATGTGGT TATATGCAGC GTGAATGCAC    15377
                                                                  
.......... .......... .......... .......... .......... ..........      137


TTGCATATAA GATTGATCTA AAAAATTGAT GTAGTGAACT TTGACTACCC GAAGTATATG    15437
                                                                  
.......... .......... .......... .......... .......... ..........      137


CTTAGATAGT TCATGGATTT CTTTCATAAA ACTGCACACT GTATTCTGGT TATCTGTTAT    15497
                                                                  
.......... .......... .......... .......... .......... ..........      137


GAAGTTTACT ACGTTCTTTC AGGTATGTCC TATCTTGTGG GAAAGATTCT TGTGTCAAGT    15557
                        |||  ||| ||||  |||| ||| |||||  ||| | |||| 
.......... .......... ..GTACATCC TATCCAGTGG GAAGGATTCG TGTATAAAGT      175


TATGGGAAGT TGGCACTGGA CGACTTGTGA AGCAATATGC AGGAGCCATT CGCAGACAAT    15617
|||||||||| |||||| |||  ||||||||| |||||||| | ||| |   ||    | ||||| 
TATGGGAAGT TGGCACCGGA AGACTTGTGA AGCAATATCC AGGTGTTGTT AATACACAAT      235


TTCGTTGTCA GGTTAGTTTC TCTGTGTTTC TATAAGATTA TTATTTTTTC CTGATTTAAA    15677
| || ||||| |                                                      
TCCGGTGTCA G......... .......... .......... .......... ..........      246


TTTACTCGTG TGCCATATAT ATTATTTTTA CCCAAAATTT TAGGAAACAA AATATTGCAA    15737
                                                                  
.......... .......... .......... .......... .......... ..........      246


TTCTTTAATT TGAAAATAGG CTGGTTTGAG CTTGCAGCTT AGGATAACAA CATACCTAAC    15797
                                                                  
.......... .......... .......... .......... .......... ..........      246


CTTGCTATGA TAGACAATAA ATATGATAAT AACTGTTCTT ACTATCCAGG CTGTCTTCAA    15857
                                                     | |||||||||| 
.......... .......... .......... .......... .........G CTGTCTTCAA      257


TGAAACCGAA GAATTTGTTC TATCAGTTGA TGAACAAAAC AATGAGGTAA ATTCCAAATT    15917
 ||||||||  || ||||| | |||||   ||  || |||||| || |||                
CGAAACCGAG GAGTTTGTAC TATCAACCGA CGAGCAAAAC AACGAG.... ..........      303


GAGAACAGTA TATATATTTG TATTTCAGCA AGCTTAACTA TGATACGTCA CTCTTCAGGT    15977
                                                               || 
.......... .......... .......... .......... .......... ........GT      305


TGTCGTCTGG GATGCACTTA CTGCAGAAAA GGTTGCAAGA TTGCCCTCTG GCAGCACTGG    16037
|||||| ||| || || |||| || | ||||  ||| |||||| ||||| |||| ||  ||| || 
TGTCGTNTGG GACGCCCTTA CTTCTGAAAG GGTGGCAAGA TTGCCGTCTG GCCACACCGG      365


TGCTCCCAGA TGGCTCGACC ACTCCCCAGT TGAACCAGTT TTTGTTATTT GTGGAAATGA    16097
 || || ||  ||||| || | ||||||| ||  || |||||  |||||||  | | ||||| || 
CGCCCCTAGG TGGCTGGAGC ACTCCCCTGT AGAGCCAGTG TTTGTTACAT GCGGAAACGA      425


TAGATCGATC AGATTCTGGA AACAAACCGT ATAGCTTGTA GATTCAACCA TTCAAATCAA    16157
| ||||  || |||||||||| ||  ||| ||  ||| ||  |  ||||||||  |   | | || 
TCGATCCGTC AGATTCTGGA AATNAACGGT GTAGATT-CA -ATTCAACCC TGGCATTTAA      483


AA    16159
| 
AT      485





********************************************************************************
EST sequence   57 +strand (File: 14570760+)

     1  GTATCTGCTG AATGTGTTCG ACCTATTATT GGAGCACATG GATCTGCAGA AGCTACTAGC
    61  GCAATTTTCA CCAGAGATGA GAGGTATGTC CTATCTTGTG GGAAAGATTC TTGTGTCAAG
   121  TTATGGGAAG TTGGCACTGG ACGACTTGTG AAGCAATATG CAGGAGCCAT TCGCAGACAA
   181  TTTCGTTGTC AGGCTGTCTT CAATGAAACC GAAGAATTTG TTCTATCAGT TGATGAACAA
   241  AACAATGAGG TTGTCGTCTG GGATGCACTT ACTGCAGAAA AGGTTGCAAG ATTGCCCTCT
   301  GGCAGCACTG GTGCTCCCAG ATGGCTCGAC CACTCCCCAG TTGAACCAGT TTTTGTTATT
   361  TGTGGAAATG ATAGATCGAT CAGATTCTGG AAACAAACCG TATAGCTTGT AGATTCAACC
   421  ATTCAAATCA AAAGTATGCT TTCAGTATTA CGTTTCAGGA GGAATGTGCT CATGTAACTT
   481  TAGTTGTATA TGGGAGAAAT TTGCATAAGC ATTTTTTTTA TTGGAAACTG CATAAGCAAT
   541  TGATTGATCT AATAGCAAAC CCCAATGATA GTTTTTT

Predicted gene structure (within gDNA segment 14652 to 16636):

 Exon  1  14952  15034 (  83 n);  cDNA      1     83 (  83 n); score: 1.000
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s: 1.00), Pa: 0.933 (s: 1.00)
 Exon  2  15520  15628 ( 109 n);  cDNA     84    192 ( 109 n); score: 1.000
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 1.00), Pa: 0.995 (s: 1.00)
 Exon  3  15847  15903 (  57 n);  cDNA    193    249 (  57 n); score: 1.000
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 1.00), Pa: 0.993 (s: 1.00)
 Exon  4  15976  16304 ( 329 n);  cDNA    250    577 ( 328 n); score: 0.997

MATCH	21326110+	14570760+	0.998	578	1.002	C
PGS_21326110+_14570760+	(14952  15034,15520  15628,15847  15903,15976  16304)

Alignment (genomic DNA sequence = upper lines):

GTATCTGCTG AATGTGTTCG ACCTATTATT GGAGCACATG GATCTGCAGA AGCTACTAGC    15011
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GTATCTGCTG AATGTGTTCG ACCTATTATT GGAGCACATG GATCTGCAGA AGCTACTAGC       60


GCAATTTTCA CCAGAGATGA GAGGTAAGCG AGCTACCAGC ATGTCTAAGG TGCTCTTCCC    15071
|||||||||| |||||||||| |||                                         
GCAATTTTCA CCAGAGATGA GAG....... .......... .......... ..........       83


TCAAGATAAA ATCCAGTCAT TGTTTGGTTT GAAGAACAGA GAGAAAGGCA TATGCTGTAT    15131
                                                                  
.......... .......... .......... .......... .......... ..........       83


GATTCAAGAC AGTAACTACT TCAAACCCTG TTTGGAATGT GGGAATCTTG TAGTGATTCT    15191
                                                                  
.......... .......... .......... .......... .......... ..........       83


GAATGATTTA TAACATGTCC TGGATAATTT CCTGTGTTTC AGACGTGTCG TAACTTTATA    15251
                                                                  
.......... .......... .......... .......... .......... ..........       83


ACACGAATAA CTCTTTCTCC TTTACCCTAC TATTTCACCA CTAAACAACT AACTTGCCTA    15311
                                                                  
.......... .......... .......... .......... .......... ..........       83


TAAACACTTT TTAGACTTCT TCTGAAAGGC CTAGTGTTTA TGTGGTTATA TGCAGCGTGA    15371
                                                                  
.......... .......... .......... .......... .......... ..........       83


ATGCACTTGC ATATAAGATT GATCTAAAAA ATTGATGTAG TGAACTTTGA CTACCCGAAG    15431
                                                                  
.......... .......... .......... .......... .......... ..........       83


TATATGCTTA GATAGTTCAT GGATTTCTTT CATAAAACTG CACACTGTAT TCTGGTTATC    15491
                                                                  
.......... .......... .......... .......... .......... ..........       83


TGTTATGAAG TTTACTACGT TCTTTCAGGT ATGTCCTATC TTGTGGGAAA GATTCTTGTG    15551
                              || |||||||||| |||||||||| |||||||||| 
.......... .......... ........GT ATGTCCTATC TTGTGGGAAA GATTCTTGTG      115


TCAAGTTATG GGAAGTTGGC ACTGGACGAC TTGTGAAGCA ATATGCAGGA GCCATTCGCA    15611
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TCAAGTTATG GGAAGTTGGC ACTGGACGAC TTGTGAAGCA ATATGCAGGA GCCATTCGCA      175


GACAATTTCG TTGTCAGGTT AGTTTCTCTG TGTTTCTATA AGATTATTAT TTTTTCCTGA    15671
|||||||||| |||||||                                                
GACAATTTCG TTGTCAG... .......... .......... .......... ..........      192


TTTAAATTTA CTCGTGTGCC ATATATATTA TTTTTACCCA AAATTTTAGG AAACAAAATA    15731
                                                                  
.......... .......... .......... .......... .......... ..........      192


TTGCAATTCT TTAATTTGAA AATAGGCTGG TTTGAGCTTG CAGCTTAGGA TAACAACATA    15791
                                                                  
.......... .......... .......... .......... .......... ..........      192


CCTAACCTTG CTATGATAGA CAATAAATAT GATAATAACT GTTCTTACTA TCCAGGCTGT    15851
                                                            ||||| 
.......... .......... .......... .......... .......... .....GCTGT      197


CTTCAATGAA ACCGAAGAAT TTGTTCTATC AGTTGATGAA CAAAACAATG AGGTAAATTC    15911
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| ||         
CTTCAATGAA ACCGAAGAAT TTGTTCTATC AGTTGATGAA CAAAACAATG AG........      249


CAAATTGAGA ACAGTATATA TATTTGTATT TCAGCAAGCT TAACTATGAT ACGTCACTCT    15971
                                                                  
.......... .......... .......... .......... .......... ..........      249


TCAGGTTGTC GTCTGGGATG CACTTACTGC AGAAAAGGTT GCAAGATTGC CCTCTGGCAG    16031
    |||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
....GTTGTC GTCTGGGATG CACTTACTGC AGAAAAGGTT GCAAGATTGC CCTCTGGCAG      305


CACTGGTGCT CCCAGATGGC TCGACCACTC CCCAGTTGAA CCAGTTTTTG TTATTTGTGG    16091
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
CACTGGTGCT CCCAGATGGC TCGACCACTC CCCAGTTGAA CCAGTTTTTG TTATTTGTGG      365


AAATGATAGA TCGATCAGAT TCTGGAAACA AACCGTATAG CTTGTAGATT CAACCATTCA    16151
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
AAATGATAGA TCGATCAGAT TCTGGAAACA AACCGTATAG CTTGTAGATT CAACCATTCA      425


AATCAAAAGT ATGCTTTCAG TATTACGTTT CAGGAGGAAT GTGCTCATGT AACTTTAGTT    16211
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
AATCAAAAGT ATGCTTTCAG TATTACGTTT CAGGAGGAAT GTGCTCATGT AACTTTAGTT      485


GTATATGGGA GAAATTTGCA TAAGCATTTT TTTTATTGGA AACTGCATAA GCAATTGATT    16271
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GTATATGGGA GAAATTTGCA TAAGCATTTT TTTTATTGGA AACTGCATAA GCAATTGATT      545


GATCTAATAG CAAACCCCAA TGATATGTTT TTT    16304
|||||||||| |||||||||| ||||| |||| |||
GATCTAATAG CAAACCCCAA TGATA-GTTT TTT      577





********************************************************************************
EST sequence   37 +strand (File: 13586923+)

     1  CTATTATTGG AGCACATGGA TCTGCAGAAG CTACTAGCGC AATTTTCACC AGAGATGAGA
    61  GGTATGTCCT ATCTTGTGGG AAAGATTCTT GTGTCAAGTT ATGGGAAGTT GGCACTGGAC
   121  GACTTGTGAA GCAATATGCA GGAGCCATTC GCAGACAATT TCGTTGTCAG GCTGTCTTCA
   181  ATGAAACCGA AGAATTTGTT CTATCAGTTG ATGAACAAAA CAATGAGGTT GTCGTCTGGG
   241  ATGCACTTAC TGCAGAAAAG GTTGCAAGAT TGCCCTCTGG CAGCACTGGT GCTCCCAGAT
   301  GGCTCGACCA CTCCCCAGTT GAACCAGTTT TTGTTATTTG TGGAAATGAT AGATCGATCA
   361  GATTCTGGAA ACAAACCGTA TAGCTTGTAG ATTCAACCAT TCAAATCAAA AGTATGCTTT
   421  CAGTATTACG TTTCAGAGAG GAATGTGCTC ATGTAACTTT AGTTGTATAT GGAAG

Predicted gene structure (within gDNA segment 14674 to 16539):

 Exon  1  14974  15034 (  61 n);  cDNA      1     61 (  61 n); score: 1.000
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s: 1.00), Pa: 0.933 (s: 1.00)
 Exon  2  15520  15628 ( 109 n);  cDNA     62    170 ( 109 n); score: 1.000
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 1.00), Pa: 0.995 (s: 1.00)
 Exon  3  15847  15903 (  57 n);  cDNA    171    227 (  57 n); score: 1.000
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 1.00), Pa: 0.993 (s: 1.00)
 Exon  4  15976  16222 ( 247 n);  cDNA    228    475 ( 248 n); score: 0.988

MATCH	21326110+	13586923+	0.994	474	0.998	C
PGS_21326110+_13586923+	(14974  15034,15520  15628,15847  15903,15976  16222)

Alignment (genomic DNA sequence = upper lines):

CTATTATTGG AGCACATGGA TCTGCAGAAG CTACTAGCGC AATTTTCACC AGAGATGAGA    15033
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
CTATTATTGG AGCACATGGA TCTGCAGAAG CTACTAGCGC AATTTTCACC AGAGATGAGA       60


GGTAAGCGAG CTACCAGCAT GTCTAAGGTG CTCTTCCCTC AAGATAAAAT CCAGTCATTG    15093
|                                                                 
G......... .......... .......... .......... .......... ..........       61


TTTGGTTTGA AGAACAGAGA GAAAGGCATA TGCTGTATGA TTCAAGACAG TAACTACTTC    15153
                                                                  
.......... .......... .......... .......... .......... ..........       61


AAACCCTGTT TGGAATGTGG GAATCTTGTA GTGATTCTGA ATGATTTATA ACATGTCCTG    15213
                                                                  
.......... .......... .......... .......... .......... ..........       61


GATAATTTCC TGTGTTTCAG ACGTGTCGTA ACTTTATAAC ACGAATAACT CTTTCTCCTT    15273
                                                                  
.......... .......... .......... .......... .......... ..........       61


TACCCTACTA TTTCACCACT AAACAACTAA CTTGCCTATA AACACTTTTT AGACTTCTTC    15333
                                                                  
.......... .......... .......... .......... .......... ..........       61


TGAAAGGCCT AGTGTTTATG TGGTTATATG CAGCGTGAAT GCACTTGCAT ATAAGATTGA    15393
                                                                  
.......... .......... .......... .......... .......... ..........       61


TCTAAAAAAT TGATGTAGTG AACTTTGACT ACCCGAAGTA TATGCTTAGA TAGTTCATGG    15453
                                                                  
.......... .......... .......... .......... .......... ..........       61


ATTTCTTTCA TAAAACTGCA CACTGTATTC TGGTTATCTG TTATGAAGTT TACTACGTTC    15513
                                                                  
.......... .......... .......... .......... .......... ..........       61


TTTCAGGTAT GTCCTATCTT GTGGGAAAGA TTCTTGTGTC AAGTTATGGG AAGTTGGCAC    15573
      |||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
......GTAT GTCCTATCTT GTGGGAAAGA TTCTTGTGTC AAGTTATGGG AAGTTGGCAC      115


TGGACGACTT GTGAAGCAAT ATGCAGGAGC CATTCGCAGA CAATTTCGTT GTCAGGTTAG    15633
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||      
TGGACGACTT GTGAAGCAAT ATGCAGGAGC CATTCGCAGA CAATTTCGTT GTCAG.....      170


TTTCTCTGTG TTTCTATAAG ATTATTATTT TTTCCTGATT TAAATTTACT CGTGTGCCAT    15693
                                                                  
.......... .......... .......... .......... .......... ..........      170


ATATATTATT TTTACCCAAA ATTTTAGGAA ACAAAATATT GCAATTCTTT AATTTGAAAA    15753
                                                                  
.......... .......... .......... .......... .......... ..........      170


TAGGCTGGTT TGAGCTTGCA GCTTAGGATA ACAACATACC TAACCTTGCT ATGATAGACA    15813
                                                                  
.......... .......... .......... .......... .......... ..........      170


ATAAATATGA TAATAACTGT TCTTACTATC CAGGCTGTCT TCAATGAAAC CGAAGAATTT    15873
                                    ||||||| |||||||||| |||||||||| 
.......... .......... .......... ...GCTGTCT TCAATGAAAC CGAAGAATTT      197


GTTCTATCAG TTGATGAACA AAACAATGAG GTAAATTCCA AATTGAGAAC AGTATATATA    15933
|||||||||| |||||||||| ||||||||||                                  
GTTCTATCAG TTGATGAACA AAACAATGAG .......... .......... ..........      227


TTTGTATTTC AGCAAGCTTA ACTATGATAC GTCACTCTTC AGGTTGTCGT CTGGGATGCA    15993
                                              |||||||| |||||||||| 
.......... .......... .......... .......... ..GTTGTCGT CTGGGATGCA      245


CTTACTGCAG AAAAGGTTGC AAGATTGCCC TCTGGCAGCA CTGGTGCTCC CAGATGGCTC    16053
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
CTTACTGCAG AAAAGGTTGC AAGATTGCCC TCTGGCAGCA CTGGTGCTCC CAGATGGCTC      305


GACCACTCCC CAGTTGAACC AGTTTTTGTT ATTTGTGGAA ATGATAGATC GATCAGATTC    16113
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GACCACTCCC CAGTTGAACC AGTTTTTGTT ATTTGTGGAA ATGATAGATC GATCAGATTC      365


TGGAAACAAA CCGTATAGCT TGTAGATTCA ACCATTCAAA TCAAAAGTAT GCTTTCAGTA    16173
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TGGAAACAAA CCGTATAGCT TGTAGATTCA ACCATTCAAA TCAAAAGTAT GCTTTCAGTA      425


TTACGTTTCA G-GAGGAATG TGCTCATGTA ACTTTAGTTG TATATGGGAG    16222
|||||||||| | |||||||| |||||||||| |||||||||| ||||||| || 
TTACGTTTCA GAGAGGAATG TGCTCATGTA ACTTTAGTTG TATATGGAAG      475





********************************************************************************
EST sequence  122 +strand (File: 25807618+)

     1  TTTTTTTTTT TTTTTTTTTT TTTTTATTTA AACTTTTTTC TTCAAACTTT CAACTTTTCC
    61  GTCACATCAA ATGTTTGAAT ACATATATGG AGCATTAAAT ATGGACGAAA AAAACCAATT
   121  ACACAGTTTG CATGTAAATT GCGAGACGAA TCTTTTGAGC CTAATTACGT CTTGATTTGA
   181  CAATGTGGGG CTACAGTAAA CATTTGCTAA TGACGAATTA ATTAGGCTTA ATAGATTCGT
   241  CTCGCAGTTT ACAGGCGAAA TCTGTAATCT GTTTTGTTAT TAGTCTACGT TTAATACTTC
   301  AAATGTGTCC GTATACTTCA AAAATTTTAT TTTGGCACAC GAACTAAACA CAGCCAAACT
   361  CAACAAAATT ATTCAGCAAT GTTATCTCTA CAAGAAATGA TGCAGCATTT GGCAGTGCTA
   421  AATTCGGCTT GAATCCCTCC CAAATATGAA CCTCCGAGTC CAGTCGGATA CCACCAGCAT
   481  CCGTGTGCGC CAACTCACTT GTTTGCCTGC ATATACGGAG TACCAGAGCC ACTGAGTGCT
   541  ATGGCCCATG GAAACCCAGT CCCCTGGGAG CTCTGCAGCA GCTTGCTCTC CACCCAAGGG
   601  TGCAAATTGC CCAAGATGCT TGTACCGGAA TGGGCGGAAA TTGTGCCATC CTGACCCTGG
   661  TCCTGTCATG CCCAACGGAC CTTTTGGA

Predicted gene structure (within gDNA segment 17789 to 14092):

 Exon  1  17066  16939 ( 128 n);  cDNA     64    188 ( 125 n); score: 0.750
  Intron  1  16938  16684 ( 255 n); Pd: 0.000 (s: 0.73), Pa: 0.000 (s: 0.78)
 Exon  2  16683  16583 ( 101 n);  cDNA    189    285 (  97 n); score: 0.782
  Intron  2  16582  16478 ( 105 n); Pd: 0.000 (s: 0.78), Pa: 0.593 (s:    0)
 Exon  3  16477  16452 (  26 n);  cDNA    286    307 (  22 n); score: 0.692
  Intron  3  16451  15877 ( 575 n); Pd: 0.000 (s:    0), Pa: 0.884 (s:    0)
 Exon  4  15876  15865 (  12 n);  cDNA    308    319 (  12 n); score: 0.583
  Intron  4  15864  15707 ( 158 n); Pd: 0.000 (s:    0), Pa: 0.000 (s:    0)
 Exon  5  15706  15680 (  27 n);  cDNA    320    345 (  26 n); score: 0.741
  Intron  5  15679  15647 (  33 n); Pd: 0.000 (s:    0), Pa: 0.334 (s:    0)
 Exon  6  15646  15628 (  19 n);  cDNA    346    364 (  19 n); score: 0.789
  Intron  6  15627  15223 ( 405 n); Pd: 0.000 (s:    0), Pa: 0.033 (s:    0)
 Exon  7  15222  15201 (  22 n);  cDNA    365    385 (  21 n); score: 0.818
 PPA                              cDNA     29      1

MATCH	21326110-	25807618+	0.764	335	0.487	C
PGS_21326110-_25807618+	(17066  16939,16683  16583,16477  16452,15876  15865,15706  15680,15646  15628,15222  15201)

Alignment (genomic DNA sequence = upper lines):

ACATCAAATA TTACGACACA TGCATGAAGC ATTAAATATA TACAAAAATA AAAACTAATT    17007
|||||||||  ||   | ||| |  ||| ||| |||||||||   ||   || | ||||| |||| 
ACATCAAATG TTTGAATACA TATATGGAGC ATTAAATATG GAC--GAA-A AAAACCAATT      120


GCACAGTTTA CCTATAAATC GCGAGATAAA TCTTTTAAAC CTAGTTAC-T CTATGATTAG    16948
 ||||||||  | | |||||  ||||||  || |||||| | | ||| |||| | || ||||| | 
ACACAGTTTG CATGTAAATT GCGAGACGAA TCTTTTGAGC CTAATTACGT CT-TGATTTG      179


ACAATATTTG TCAAATAAAA ACGAAAGTGC TACAGTCTCA AAAACCAAAA AGTTTTCGAA    16888
||||| |                                                           
ACAATGTGG. .......... .......... .......... .......... ..........      188


ACTAAACAAG GCCTGACACT TGCACATCTT TTTTAAAAAA TATAAGGCCC TGTTTAGTTC    16828
                                                                  
.......... .......... .......... .......... .......... ..........      188


CCACCTAAAA AATTTTCATC CATCACATTG AATCTTTAGA CACATACATA AAACATTAAA    16768
                                                                  
.......... .......... .......... .......... .......... ..........      188


TGTAGATAAA AAATAATTAC ACAGTTTGGT TGAAAATCGC GAGATGAATT TTTTAAGCCT    16708
                                                                  
.......... .......... .......... .......... .......... ..........      188


AGTTAGTCCA TGATTAGCCT TAAGTGCTAC AGTAACCCAC ATGTGCTAAT AATAGATTAA    16648
                           ||||| |||||   || || |||||||  |   ||||| 
.......... .......... ....GGCTAC AGTAA---AC ATTTGCTAAT GACGAATTAA      221


TTATACTTAA TAGATTCGTC TTGCAGTTTC CTGACGAGTT ATGTAATTTG TTTTTTTTAT    16588
|||  ||||| |||||||||| | |||||||  | | |||  |  |||||| ||  |||| |||| 
TTAGGCTTAA TAGATTCGTC TCGCAGTTTA CAGGCGAAAT CTGTAATCTG -TTTTGTTAT      280


TAGTTTTTAA AAACCCCTCC CGACATCCTT CCGACATATC CGATGTGACC TAAAAAATTT    16528
||||                                                              
TAGTC..... .......... .......... .......... .......... ..........      285


TCATCTTCAA TCTAAACATG CCCTAAGTGA AATGCAATAA TGTGTTGTAG AACTTTTATA    16468
                                                        || |||| | 
.......... .......... .......... .......... .......... TACGTTTA-A      294


GGCTATCACA CATGTGGTAG GGCGAGACCA TCATTACATT CGAAGAAGAA ATATATTCCG    16408
  || ||| |  |||||                                                 
TACT-TCA-A -ATGTG.... .......... .......... .......... ..........      307


CAATCCACAA TTGGGATAAA ATAGCAAATC ATCGAAAAGG GCCTGACCAA TAAGAATCAG    16348
                                                                  
.......... .......... .......... .......... .......... ..........      307


GTCAAGGGTT CATACAACTG TCATCAGCTA TGCAGAGCCA AAAAAAAAAC ATATCATTGG    16288
                                                                  
.......... .......... .......... .......... .......... ..........      307


GGTTTGCTAT TAGATCAATC AATTGCTTAT GCAGTTTCCA ATAAAAAAAA TGCTTATGCA    16228
                                                                  
.......... .......... .......... .......... .......... ..........      307


AATTTCTCCC ATATACAACT AAAGTTACAT GAGCACATTC CTCCTGAAAC GTAATACTGA    16168
                                                                  
.......... .......... .......... .......... .......... ..........      307


AAGCATACTT TTGATTTGAA TGGTTGAATC TACAAGCTAT ACGGTTTGTT TCCAGAATCT    16108
                                                                  
.......... .......... .......... .......... .......... ..........      307


GATCGATCTA TCATTTCCAC AAATAACAAA AACTGGTTCA ACTGGGGAGT GGTCGAGCCA    16048
                                                                  
.......... .......... .......... .......... .......... ..........      307


TCTGGGAGCA CCAGTGCTGC CAGAGGGCAA TCTTGCAACC TTTTCTGCAG TAAGTGCATC    15988
                                                                  
.......... .......... .......... .......... .......... ..........      307


CCAGACGACA ACCTGAAGAG TGACGTATCA TAGTTAAGCT TGCTGAAATA CAAATATATA    15928
                                                                  
.......... .......... .......... .......... .......... ..........      307


TACTGTTCTC AATTTGGAAT TTACCTCATT GTTTTGTTCA TCAACTGATA GAACAAATTC    15868
                                                          |  || | 
.......... .......... .......... .......... .......... .TCCGTATAC      316


TTCGGTTTCA TTGAAGACAG CCTGGATAGT AAGAACAGTT ATTATCATAT TTATTGTCTA    15808
|||                                                               
TTC....... .......... .......... .......... .......... ..........      319


TCATAGCAAG GTTAGGTATG TTGTTATCCT AAGCTGCAAG CTCAAACCAG CCTATTTTCA    15748
                                                                  
.......... .......... .......... .......... .......... ..........      319


AATTAAAGAA TTGCAATATT TTGTTTCCTA AAATTTTGGG TAAAAATAAT ATATATGGCA    15688
                                             ||||||  | || | ||||| 
.......... .......... .......... .......... .AAAAATTTT AT-TTTGGCA      337


CACGAGTAAA TTTAAATCAG GAAAAAATAA TAATCTTATA GAAACACAGA GAAACTAACC    15628
|||||                                        ||||||||   ||||| | | 
CACGAACT.. .......... .......... .......... .AAACACAGC CAAACTCAAC      364


TGACAACGAA ATTGTCTGCG AATGGCTCCT GCATATTGCT TCACAAGTCG TCCAGTGCCA    15568
                                                                  
.......... .......... .......... .......... .......... ..........      364


ACTTCCCATA ACTTGACACA AGAATCTTTC CCACAAGATA GGACATACCT GAAAGAACGT    15508
                                                                  
.......... .......... .......... .......... .......... ..........      364


AGTAAACTTC ATAACAGATA ACCAGAATAC AGTGTGCAGT TTTATGAAAG AAATCCATGA    15448
                                                                  
.......... .......... .......... .......... .......... ..........      364


ACTATCTAAG CATATACTTC GGGTAGTCAA AGTTCACTAC ATCAATTTTT TAGATCAATC    15388
                                                                  
.......... .......... .......... .......... .......... ..........      364


TTATATGCAA GTGCATTCAC GCTGCATATA ACCACATAAA CACTAGGCCT TTCAGAAGAA    15328
                                                                  
.......... .......... .......... .......... .......... ..........      364


GTCTAAAAAG TGTTTATAGG CAAGTTAGTT GTTTAGTGGT GAAATAGTAG GGTAAAGGAG    15268
                                                                  
.......... .......... .......... .......... .......... ..........      364


AAAGAGTTAT TCGTGTTATA AAGTTACGAC ACGTCTGAAA CACAGGAAAT TATCCAGGAC    15208
                                                  |||| ||| ||| |  
.......... .......... .......... .......... .....AAAAT TATTCAGCA-      378


ATGTTAT    15201
|||||||
ATGTTAT      385





********************************************************************************
EST sequence  138 -strand (File: 24287802-)

     1  AAAGACGAGA GGTACATCCT ATCCAGTGGG AAGGATTCGT GTATAAAGTT ATGGGAAGTT
    61  GGCACCGGAA GACTTGTGAA GCAATATCCA GGTGTTGTTA ATACACAATT CCGGTGTCAG
   121  GCTGTCTTCA ACGAAACCGA GGAGTTTGTA CTATCAACCG ACGAGCAAAA CAACGAGGTT
   181  GTCGTCTGGG ACGCCCTTAC TTCTGAAAGG GTGGCAAGAT TGCCGTCTGG CCACACCGGC
   241  GCCCCTAGGT GGCTGGAGCA CTCCCCTGTA GAGCCAGTGT TTGTTACATG CGGAAACGAT
   301  CGATCCGTCA GATTCTGGAA ATAAACGGTG TAGATTCAAT TCAACCCTGG CATTTAAATC
   361  ATGAAGTTTG TTGTATCATG AGTACTTCAG GGTAAAAGAA AGGAATACTT GTAATTGTAG
   421  TGGCTGTACT TATACATGCT GTTGATAC

Predicted gene structure (within gDNA segment 15024 to 17054):

 Exon  1  15024  15034 (  11 n);  cDNA      1     11 (  11 n); score: 0.818
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s:    0), Pa: 0.933 (s: 0.84)
 Exon  2  15520  15628 ( 109 n);  cDNA     12    120 ( 109 n); score: 0.807
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 0.78), Pa: 0.995 (s: 0.82)
 Exon  3  15847  15903 (  57 n);  cDNA    121    177 (  57 n); score: 0.825
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 0.80), Pa: 0.993 (s: 0.86)
 Exon  4  15976  16159 ( 184 n);  cDNA    178    359 ( 182 n); score: 0.777

MATCH	21326110+	24287802-	0.794	361	0.806	C
PGS_21326110+_24287802-	(15024  15034,15520  15628,15847  15903,15976  16159)

Alignment (genomic DNA sequence = upper lines):

AGAGATGAGA GGTAAGCGAG CTACCAGCAT GTCTAAGGTG CTCTTCCCTC AAGATAAAAT    15083
| ||| |||| |                                                      
AAAGACGAGA G......... .......... .......... .......... ..........       11


CCAGTCATTG TTTGGTTTGA AGAACAGAGA GAAAGGCATA TGCTGTATGA TTCAAGACAG    15143
                                                                  
.......... .......... .......... .......... .......... ..........       11


TAACTACTTC AAACCCTGTT TGGAATGTGG GAATCTTGTA GTGATTCTGA ATGATTTATA    15203
                                                                  
.......... .......... .......... .......... .......... ..........       11


ACATGTCCTG GATAATTTCC TGTGTTTCAG ACGTGTCGTA ACTTTATAAC ACGAATAACT    15263
                                                                  
.......... .......... .......... .......... .......... ..........       11


CTTTCTCCTT TACCCTACTA TTTCACCACT AAACAACTAA CTTGCCTATA AACACTTTTT    15323
                                                                  
.......... .......... .......... .......... .......... ..........       11


AGACTTCTTC TGAAAGGCCT AGTGTTTATG TGGTTATATG CAGCGTGAAT GCACTTGCAT    15383
                                                                  
.......... .......... .......... .......... .......... ..........       11


ATAAGATTGA TCTAAAAAAT TGATGTAGTG AACTTTGACT ACCCGAAGTA TATGCTTAGA    15443
                                                                  
.......... .......... .......... .......... .......... ..........       11


TAGTTCATGG ATTTCTTTCA TAAAACTGCA CACTGTATTC TGGTTATCTG TTATGAAGTT    15503
                                                                  
.......... .......... .......... .......... .......... ..........       11


TACTACGTTC TTTCAGGTAT GTCCTATCTT GTGGGAAAGA TTCTTGTGTC AAGTTATGGG    15563
                 |||   |||||||   ||||||| || ||| ||| |  |||||||||| 
.......... ......GTAC ATCCTATCCA GTGGGAAGGA TTCGTGTATA AAGTTATGGG       55


AAGTTGGCAC TGGACGACTT GTGAAGCAAT ATGCAGGAGC CATTCGCAGA CAATTTCGTT    15623
||||||||||  ||| ||||| |||||||||| || |||| |    ||   | | ||||| || | 
AAGTTGGCAC CGGAAGACTT GTGAAGCAAT ATCCAGGTGT TGTTAATACA CAATTCCGGT      115


GTCAGGTTAG TTTCTCTGTG TTTCTATAAG ATTATTATTT TTTCCTGATT TAAATTTACT    15683
|||||                                                             
GTCAG..... .......... .......... .......... .......... ..........      120


CGTGTGCCAT ATATATTATT TTTACCCAAA ATTTTAGGAA ACAAAATATT GCAATTCTTT    15743
                                                                  
.......... .......... .......... .......... .......... ..........      120


AATTTGAAAA TAGGCTGGTT TGAGCTTGCA GCTTAGGATA ACAACATACC TAACCTTGCT    15803
                                                                  
.......... .......... .......... .......... .......... ..........      120


ATGATAGACA ATAAATATGA TAATAACTGT TCTTACTATC CAGGCTGTCT TCAATGAAAC    15863
                                               ||||||| |||| ||||| 
.......... .......... .......... .......... ...GCTGTCT TCAACGAAAC      137


CGAAGAATTT GTTCTATCAG TTGATGAACA AAACAATGAG GTAAATTCCA AATTGAGAAC    15923
||| || ||| || ||||||    || || || |||||| |||                       
CGAGGAGTTT GTACTATCAA CCGACGAGCA AAACAACGAG .......... ..........      177


AGTATATATA TTTGTATTTC AGCAAGCTTA ACTATGATAC GTCACTCTTC AGGTTGTCGT    15983
                                                         |||||||| 
.......... .......... .......... .......... .......... ..GTTGTCGT      185


CTGGGATGCA CTTACTGCAG AAAAGGTTGC AAGATTGCCC TCTGGCAGCA CTGGTGCTCC    16043
|||||| ||  |||||| | | ||| ||| || |||||||||  ||||||  || | || || || 
CTGGGACGCC CTTACTTCTG AAAGGGTGGC AAGATTGCCG TCTGGCCACA CCGGCGCCCC      245


CAGATGGCTC GACCACTCCC CAGTTGAACC AGTTTTTGTT ATTTGTGGAA ATGATAGATC    16103
 || |||||  || ||||||| | || || || ||| |||||| |  || |||| | ||| |||| 
TAGGTGGCTG GAGCACTCCC CTGTAGAGCC AGTGTTTGTT ACATGCGGAA ACGATCGATC      305


GATCAGATTC TGGAAACAAA CCGTATAGCT TGTAGATTCA ACCATTCAAA TCAAAA    16159
  |||||||| |||||| ||| | || ||| | |  | ||||| ||| |   |  | ||| 
CGTCAGATTC TGGAAATAAA CGGTGTAGAT T-CA-ATTCA ACCCTGGCAT TTAAAT      359





********************************************************************************
EST sequence  137 -strand (File: 24293407-)

     1  AAGACGAGAG GTACATCCTA TCCAGTGGGA AGGATTCGTG TATAAAGTTA TGGGAAGTTG
    61  GCACCGGAAG ACTTGTGAAG CAATATCCAG GTGTTGTTAA TACACAATTC CGGTGTCAGG
   121  CTGTCTTCAA CGAAACCGAG GAGTTTGTAC TATCAACCGA CGAGCAAAAC AACGAGGTTG
   181  TCGTCTGGGA CGCCCTTACT TCTGAAAGGG TGGCAAGATT GCCGTCTGGC CACACCGGCG
   241  CCCCTAGGTG GCTGGAGCAC TCCCCTGTAG AGCCAGTGTT TGTTACATGC GGAAACGATC
   301  GATCCGTCAG ATTCTGGAAA TAAACGGTGT AGATTCAATT CAACCCTGGC ATTTAAATCA
   361  TGAAGTTTGT TGTATCATGA GTACTTCAGG GTAAAAGAAA GGAATACTTG TAATTGTAGT
   421  GGCTGTACTT ATACATGCTG TTGATAC

Predicted gene structure (within gDNA segment 15029 to 17054):

 Exon  1  15029  15034 (   6 n);  cDNA      5     10 (   6 n); score: 0.833
  Intron  1  15035  15519 ( 485 n); Pd: 0.794 (s:    0), Pa: 0.933 (s: 0.84)
 Exon  2  15520  15628 ( 109 n);  cDNA     11    119 ( 109 n); score: 0.807
  Intron  2  15629  15846 ( 218 n); Pd: 1.000 (s: 0.78), Pa: 0.995 (s: 0.82)
 Exon  3  15847  15903 (  57 n);  cDNA    120    176 (  57 n); score: 0.825
  Intron  3  15904  15975 (  72 n); Pd: 0.991 (s: 0.80), Pa: 0.993 (s: 0.86)
 Exon  4  15976  16159 ( 184 n);  cDNA    177    358 ( 182 n); score: 0.777

MATCH	21326110+	24293407-	0.794	356	0.796	C
PGS_21326110+_24293407-	(15029  15034,15520  15628,15847  15903,15976  16159)

Alignment (genomic DNA sequence = upper lines):

TGAGAGGTAA GCGAGCTACC AGCATGTCTA AGGTGCTCTT CCCTCAAGAT AAAATCCAGT    15088
 |||||                                                            
CGAGAG.... .......... .......... .......... .......... ..........       10


CATTGTTTGG TTTGAAGAAC AGAGAGAAAG GCATATGCTG TATGATTCAA GACAGTAACT    15148
                                                                  
.......... .......... .......... .......... .......... ..........       10


ACTTCAAACC CTGTTTGGAA TGTGGGAATC TTGTAGTGAT TCTGAATGAT TTATAACATG    15208
                                                                  
.......... .......... .......... .......... .......... ..........       10


TCCTGGATAA TTTCCTGTGT TTCAGACGTG TCGTAACTTT ATAACACGAA TAACTCTTTC    15268
                                                                  
.......... .......... .......... .......... .......... ..........       10


TCCTTTACCC TACTATTTCA CCACTAAACA ACTAACTTGC CTATAAACAC TTTTTAGACT    15328
                                                                  
.......... .......... .......... .......... .......... ..........       10


TCTTCTGAAA GGCCTAGTGT TTATGTGGTT ATATGCAGCG TGAATGCACT TGCATATAAG    15388
                                                                  
.......... .......... .......... .......... .......... ..........       10


ATTGATCTAA AAAATTGATG TAGTGAACTT TGACTACCCG AAGTATATGC TTAGATAGTT    15448
                                                                  
.......... .......... .......... .......... .......... ..........       10


CATGGATTTC TTTCATAAAA CTGCACACTG TATTCTGGTT ATCTGTTATG AAGTTTACTA    15508
                                                                  
.......... .......... .......... .......... .......... ..........       10


CGTTCTTTCA GGTATGTCCT ATCTTGTGGG AAAGATTCTT GTGTCAAGTT ATGGGAAGTT    15568
            |||  |||| |||  ||||| || ||||| | || | ||||| |||||||||| 
.......... .GTACATCCT ATCCAGTGGG AAGGATTCGT GTATAAAGTT ATGGGAAGTT       59


GGCACTGGAC GACTTGTGAA GCAATATGCA GGAGCCATTC GCAGACAATT TCGTTGTCAG    15628
||||| |||  |||||||||| ||||||| || || |   ||    | ||||||  || |||||| 
GGCACCGGAA GACTTGTGAA GCAATATCCA GGTGTTGTTA ATACACAATT CCGGTGTCAG      119


GTTAGTTTCT CTGTGTTTCT ATAAGATTAT TATTTTTTCC TGATTTAAAT TTACTCGTGT    15688
                                                                  
.......... .......... .......... .......... .......... ..........      119


GCCATATATA TTATTTTTAC CCAAAATTTT AGGAAACAAA ATATTGCAAT TCTTTAATTT    15748
                                                                  
.......... .......... .......... .......... .......... ..........      119


GAAAATAGGC TGGTTTGAGC TTGCAGCTTA GGATAACAAC ATACCTAACC TTGCTATGAT    15808
                                                                  
.......... .......... .......... .......... .......... ..........      119


AGACAATAAA TATGATAATA ACTGTTCTTA CTATCCAGGC TGTCTTCAAT GAAACCGAAG    15868
                                         || |||||||||  |||||||| | 
.......... .......... .......... ........GC TGTCTTCAAC GAAACCGAGG      141


AATTTGTTCT ATCAGTTGAT GAACAAAACA ATGAGGTAAA TTCCAAATTG AGAACAGTAT    15928
| ||||| || ||||   ||  || ||||||| | |||                            
AGTTTGTACT ATCAACCGAC GAGCAAAACA ACGAG..... .......... ..........      176


ATATATTTGT ATTTCAGCAA GCTTAACTAT GATACGTCAC TCTTCAGGTT GTCGTCTGGG    15988
                                                   ||| |||||||||| 
.......... .......... .......... .......... .......GTT GTCGTCTGGG      189


ATGCACTTAC TGCAGAAAAG GTTGCAAGAT TGCCCTCTGG CAGCACTGGT GCTCCCAGAT    16048
| || ||||| | | |||| | || ||||||| |||| ||||| |  ||| ||  || || || | 
ACGCCCTTAC TTCTGAAAGG GTGGCAAGAT TGCCGTCTGG CCACACCGGC GCCCCTAGGT      249


GGCTCGACCA CTCCCCAGTT GAACCAGTTT TTGTTATTTG TGGAAATGAT AGATCGATCA    16108
|||| || || |||||| ||  || ||||| | ||||||  ||  ||||| |||  ||||  ||| 
GGCTGGAGCA CTCCCCTGTA GAGCCAGTGT TTGTTACATG CGGAAACGAT CGATCCGTCA      309


GATTCTGGAA ACAAACCGTA TAGCTTGTAG ATTCAACCAT TCAAATCAAA A    16159
|||||||||| | |||| ||  ||| ||  |  |||||||| |    | | |||  
GATTCTGGAA ATAAACGGTG TAGATT-CA- ATTCAACCCT GGCATTTAAA T      358





********************************************************************************
EST sequence   35 +strand (File: 13586921+)

     1  GAAAGATTCT TGTGTCAAGT TATGGGAAGT TGGCACTGGA CGACTTGTGA AGCAATATGC
    61  AGGAGCCATT CGCAGACAAT TTCGTTGTCA GGCTGTCTTC AATGAAACCG AAGAATTTGT
   121  TCTATCAGTT GATGAACAAA ACAATGAGGT TGTCGTCTGG GATGCACTTA CTGCAGAAAA
   181  GGTTGCAAGA TTGCCCTCTG GCAGCACTGG TGCTCCCAGA TGGCTCGACC ACTCCCCAGT
   241  TGAACCAGTT TTTGTTATTT GTGGAAATGA TAGATCGATC AGATTCTGGA AACAAACCGT
   301  ATAGCTTGTA GATTCAACCA TTCAAATCAA AAGTATGCTT TCAGTATTAC GTTTCAGGAG
   361  GAATGTGCTC ATGTAACTTT AGTTGTATAT GGGAGAAATT TGCATAAGCA TTTTTTTTAT
   421  TGGAAACTGC ATAAGCAATT GATTGATATA ATA

Predicted gene structure (within gDNA segment 15238 to 16609):

 Exon  1  15538  15628 (  91 n);  cDNA      1     91 (  91 n); score: 1.000
  Intron  1  15629  15846 ( 218 n); Pd: 1.000 (s: 1.00), Pa: 0.995 (s: 1.00)
 Exon  2  15847  15903 (  57 n);  cDNA     92    148 (  57 n); score: 1.000
  Intron  2  15904  15975 (  72 n); Pd: 0.991 (s: 1.00), Pa: 0.993 (s: 1.00)
 Exon  3  15976  16280 ( 305 n);  cDNA    149    453 ( 305 n); score: 0.997

MATCH	21326110+	13586921+	0.998	453	1.000	C
PGS_21326110+_13586921+	(15538  15628,15847  15903,15976  16280)

Alignment (genomic DNA sequence = upper lines):

GAAAGATTCT TGTGTCAAGT TATGGGAAGT TGGCACTGGA CGACTTGTGA AGCAATATGC    15597
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GAAAGATTCT TGTGTCAAGT TATGGGAAGT TGGCACTGGA CGACTTGTGA AGCAATATGC       60


AGGAGCCATT CGCAGACAAT TTCGTTGTCA GGTTAGTTTC TCTGTGTTTC TATAAGATTA    15657
|||||||||| |||||||||| |||||||||| |                                
AGGAGCCATT CGCAGACAAT TTCGTTGTCA G......... .......... ..........       91


TTATTTTTTC CTGATTTAAA TTTACTCGTG TGCCATATAT ATTATTTTTA CCCAAAATTT    15717
                                                                  
.......... .......... .......... .......... .......... ..........       91


TAGGAAACAA AATATTGCAA TTCTTTAATT TGAAAATAGG CTGGTTTGAG CTTGCAGCTT    15777
                                                                  
.......... .......... .......... .......... .......... ..........       91


AGGATAACAA CATACCTAAC CTTGCTATGA TAGACAATAA ATATGATAAT AACTGTTCTT    15837
                                                                  
.......... .......... .......... .......... .......... ..........       91


ACTATCCAGG CTGTCTTCAA TGAAACCGAA GAATTTGTTC TATCAGTTGA TGAACAAAAC    15897
         | |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.........G CTGTCTTCAA TGAAACCGAA GAATTTGTTC TATCAGTTGA TGAACAAAAC      142


AATGAGGTAA ATTCCAAATT GAGAACAGTA TATATATTTG TATTTCAGCA AGCTTAACTA    15957
||||||                                                            
AATGAG.... .......... .......... .......... .......... ..........      148


TGATACGTCA CTCTTCAGGT TGTCGTCTGG GATGCACTTA CTGCAGAAAA GGTTGCAAGA    16017
                   || |||||||||| |||||||||| |||||||||| |||||||||| 
.......... ........GT TGTCGTCTGG GATGCACTTA CTGCAGAAAA GGTTGCAAGA      190


TTGCCCTCTG GCAGCACTGG TGCTCCCAGA TGGCTCGACC ACTCCCCAGT TGAACCAGTT    16077
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TTGCCCTCTG GCAGCACTGG TGCTCCCAGA TGGCTCGACC ACTCCCCAGT TGAACCAGTT      250


TTTGTTATTT GTGGAAATGA TAGATCGATC AGATTCTGGA AACAAACCGT ATAGCTTGTA    16137
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TTTGTTATTT GTGGAAATGA TAGATCGATC AGATTCTGGA AACAAACCGT ATAGCTTGTA      310


GATTCAACCA TTCAAATCAA AAGTATGCTT TCAGTATTAC GTTTCAGGAG GAATGTGCTC    16197
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GATTCAACCA TTCAAATCAA AAGTATGCTT TCAGTATTAC GTTTCAGGAG GAATGTGCTC      370


ATGTAACTTT AGTTGTATAT GGGAGAAATT TGCATAAGCA TTTTTTTTAT TGGAAACTGC    16257
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
ATGTAACTTT AGTTGTATAT GGGAGAAATT TGCATAAGCA TTTTTTTTAT TGGAAACTGC      430


ATAAGCAATT GATTGATCTA ATA    16280
|||||||||| ||||||| || |||
ATAAGCAATT GATTGATATA ATA      453





********************************************************************************
EST sequence  101 -strand (File: 5688746-)

     1  GGGAGCAATT CGCAGACAAT TTCGTTGTCA GGCTGTCTTC AATGAAACCG AGGAATTTGT
    61  GCTATCAGTT GATGAACAAA ACAATGAGGT TGTCGTCTGG GATGCACTTA CTGCTGAAAA
   121  GGTTACAAGA TTGCCTTCTG GCAGCACTGG TGCTCCTAGA TGGCTCGACC ATTCCCCAGT
   181  TGAGCCAGTT TTTGTTAGTT GTGGAAACGA TAGATCGATC AAATTCTGGA AACAAACCGT
   241  ATAAGCTTGT AGATTCAACC ACGCAAATCA AAAGAGTATG TTTTCAGTAT TACTGTTTCA
   301  GGAGGAATGT GCTAGTGTAA CTTTAGTTGT ATATGGGAGA AATTTGCATA AGCGATTTTT
   361  TTTTGAAACT GCATAAGCAA TTGTTTGACC TAATAGCAAA TCCCAA

Predicted gene structure (within gDNA segment 15265 to 16683):

 Exon  1  15598  15628 (  31 n);  cDNA      1     31 (  31 n); score: 0.935
  Intron  1  15629  15846 ( 218 n); Pd: 1.000 (s:    0), Pa: 0.995 (s: 0.96)
 Exon  2  15847  15903 (  57 n);  cDNA     32     88 (  57 n); score: 0.965
  Intron  2  15904  15975 (  72 n); Pd: 0.991 (s: 0.96), Pa: 0.993 (s: 0.94)
 Exon  3  15976  16291 ( 316 n);  cDNA     89    406 ( 318 n); score: 0.908

MATCH	21326110+	5688746-	0.917	404	0.995	C
PGS_21326110+_5688746-	(15598  15628,15847  15903,15976  16291)

Alignment (genomic DNA sequence = upper lines):

AGGAGCCATT CGCAGACAAT TTCGTTGTCA GGTTAGTTTC TCTGTGTTTC TATAAGATTA    15657
 ||||| ||| |||||||||| |||||||||| |                                
GGGAGCAATT CGCAGACAAT TTCGTTGTCA G......... .......... ..........       31


TTATTTTTTC CTGATTTAAA TTTACTCGTG TGCCATATAT ATTATTTTTA CCCAAAATTT    15717
                                                                  
.......... .......... .......... .......... .......... ..........       31


TAGGAAACAA AATATTGCAA TTCTTTAATT TGAAAATAGG CTGGTTTGAG CTTGCAGCTT    15777
                                                                  
.......... .......... .......... .......... .......... ..........       31


AGGATAACAA CATACCTAAC CTTGCTATGA TAGACAATAA ATATGATAAT AACTGTTCTT    15837
                                                                  
.......... .......... .......... .......... .......... ..........       31


ACTATCCAGG CTGTCTTCAA TGAAACCGAA GAATTTGTTC TATCAGTTGA TGAACAAAAC    15897
         | |||||||||| |||||||||  |||||||| | |||||||||| |||||||||| 
.........G CTGTCTTCAA TGAAACCGAG GAATTTGTGC TATCAGTTGA TGAACAAAAC       82


AATGAGGTAA ATTCCAAATT GAGAACAGTA TATATATTTG TATTTCAGCA AGCTTAACTA    15957
||||||                                                            
AATGAG.... .......... .......... .......... .......... ..........       88


TGATACGTCA CTCTTCAGGT TGTCGTCTGG GATGCACTTA CTGCAGAAAA GGTTGCAAGA    16017
                   || |||||||||| |||||||||| |||| ||||| |||| ||||| 
.......... ........GT TGTCGTCTGG GATGCACTTA CTGCTGAAAA GGTTACAAGA      130


TTGCCCTCTG GCAGCACTGG TGCTCCCAGA TGGCTCGACC ACTCCCCAGT TGAACCAGTT    16077
||||| |||| |||||||||| |||||| ||| |||||||||| | |||||||| ||| |||||| 
TTGCCTTCTG GCAGCACTGG TGCTCCTAGA TGGCTCGACC ATTCCCCAGT TGAGCCAGTT      190


TTTGTTATTT GTGGAAATGA TAGATCGATC AGATTCTGGA AACAAACCGT AT-AGCTTGT    16136
||||||| || ||||||| || |||||||||| | |||||||| |||||||||| || ||||||| 
TTTGTTAGTT GTGGAAACGA TAGATCGATC AAATTCTGGA AACAAACCGT ATAAGCTTGT      250


AGATTCAACC ATTCAAATC- AAA-AGTATG CTTTCAGTAT TAC-GTTTCA GGAGGAATGT    16193
|||||||||| |  ||||||  ||| ||||||  ||||||||| ||| |||||| |||||||||| 
AGATTCAACC ACGCAAATCA AAAGAGTATG TTTTCAGTAT TACTGTTTCA GGAGGAATGT      310


GCTCATGTAA CTTTAGTTGT ATATGGGAGA AATTTGCATA AGCATTTTTT TTATTGGAAA    16253
|||  ||||| |||||||||| |||||||||| |||||||||| |||  ||||| || || |||| 
GCTAGTGTAA CTTTAGTTGT ATATGGGAGA AATTTGCATA AGCGATTTTT TT-TT-GAAA      368


CTGCATAAGC AATTGATTGA TCTAATAGCA AACCCCAA    16291
|||||||||| ||||| ||||  ||||||||| || |||||
CTGCATAAGC AATTGTTTGA CCTAATAGCA AATCCCAA      406





********************************************************************************
EST sequence  105 -strand (File: 12973578-)

     1  AATTCGCAGA CAATTTCGTT GTCAGGCTGT CTTCAATGAA ACCGAGGAAT TTGTGCTATC
    61  AGTTGATGAA CAAAACAATG AGGTTGTCGT CTGGGATGCA CTTACTGCTG AAAAGGTTAC
   121  AAGATTGCCT TCTGGCAGCA CTGGTGCTCC TAGATGGCTC GACCATTCCC CAGTTGAGCC
   181  AGTTTTTGTT AGTTGTGGAA ACGATAGATC GATCAAATTC TGGAAACAAA CCGTATAAGC
   241  TTGTAGATTC AACCACGCAA ATCAAAAAAA AAAATATTCA GTATTACTGT TTCAGGAGGA
   301  ATGTGCTAGT GTAACTTNAG TTGTATATGG GAGAAATTTG CATAAGCATT TTTTTTTGAA
   361  ACTGCATAAG CAATTGTTTG ACCTAATAGC AAATCCCAAT CAGATGTTTT TTTTGGT

Predicted gene structure (within gDNA segment 15295 to 16773):

 Exon  1  15604  15628 (  25 n);  cDNA      1     25 (  25 n); score: 0.960
  Intron  1  15629  15846 ( 218 n); Pd: 1.000 (s:    0), Pa: 0.995 (s: 0.96)
 Exon  2  15847  15903 (  57 n);  cDNA     26     82 (  57 n); score: 0.965
  Intron  2  15904  15975 (  72 n); Pd: 0.991 (s: 0.96), Pa: 0.993 (s: 0.94)
 Exon  3  15976  16309 ( 334 n);  cDNA     83    417 ( 335 n); score: 0.886

MATCH	21326110+	12973578-	0.898	416	0.998	C
PGS_21326110+_12973578-	(15604  15628,15847  15903,15976  16309)

Alignment (genomic DNA sequence = upper lines):

CATTCGCAGA CAATTTCGTT GTCAGGTTAG TTTCTCTGTG TTTCTATAAG ATTATTATTT    15663
 ||||||||| |||||||||| |||||                                       
AATTCGCAGA CAATTTCGTT GTCAG..... .......... .......... ..........       25


TTTCCTGATT TAAATTTACT CGTGTGCCAT ATATATTATT TTTACCCAAA ATTTTAGGAA    15723
                                                                  
.......... .......... .......... .......... .......... ..........       25


ACAAAATATT GCAATTCTTT AATTTGAAAA TAGGCTGGTT TGAGCTTGCA GCTTAGGATA    15783
                                                                  
.......... .......... .......... .......... .......... ..........       25


ACAACATACC TAACCTTGCT ATGATAGACA ATAAATATGA TAATAACTGT TCTTACTATC    15843
                                                                  
.......... .......... .......... .......... .......... ..........       25


CAGGCTGTCT TCAATGAAAC CGAAGAATTT GTTCTATCAG TTGATGAACA AAACAATGAG    15903
   ||||||| |||||||||| ||| |||||| || ||||||| |||||||||| |||||||||| 
...GCTGTCT TCAATGAAAC CGAGGAATTT GTGCTATCAG TTGATGAACA AAACAATGAG       82


GTAAATTCCA AATTGAGAAC AGTATATATA TTTGTATTTC AGCAAGCTTA ACTATGATAC    15963
                                                                  
.......... .......... .......... .......... .......... ..........       82


GTCACTCTTC AGGTTGTCGT CTGGGATGCA CTTACTGCAG AAAAGGTTGC AAGATTGCCC    16023
             |||||||| |||||||||| |||||||| | |||||||| | |||||||||  
.......... ..GTTGTCGT CTGGGATGCA CTTACTGCTG AAAAGGTTAC AAGATTGCCT      130


TCTGGCAGCA CTGGTGCTCC CAGATGGCTC GACCACTCCC CAGTTGAACC AGTTTTTGTT    16083
|||||||||| ||||||||||  ||||||||| ||||| |||| ||||||| || |||||||||| 
TCTGGCAGCA CTGGTGCTCC TAGATGGCTC GACCATTCCC CAGTTGAGCC AGTTTTTGTT      190


ATTTGTGGAA ATGATAGATC GATCAGATTC TGGAAACAAA CCGTAT-AGC TTGTAGATTC    16142
| |||||||| | |||||||| ||||| |||| |||||||||| |||||| ||| |||||||||| 
AGTTGTGGAA ACGATAGATC GATCAAATTC TGGAAACAAA CCGTATAAGC TTGTAGATTC      250


AACCATTCAA ATC-AAAAGT ATGCT-TTCA GTATTAC-GT TTCAGGAGGA ATGTGCTCAT    16199
|||||  ||| ||| ||||   |   | |||| ||||||| || |||||||||| |||||||  | 
AACCACGCAA ATCAAAAAAA AAAATATTCA GTATTACTGT TTCAGGAGGA ATGTGCTAGT      310


GTAACTTTAG TTGTATATGG GAGAAATTTG CATAAGCATT TTTTTTATTG GAAACTGCAT    16259
||||||| || |||||||||| |||||||||| |||||||| | |||||| ||  |||||||||| 
GTAACTTNAG TTGTATATGG GAGAAATTTG CATAAGCA-T TTTTTT-TT- GAAACTGCAT      367


AAGCAATTGA TTGATCTAAT AGCAAACCCC AATGATATGT TTTTTTTTTG    16309
|||||||||  |||| ||||| |||||| ||| ||| | |||| |||||||    
AAGCAATTGT TTGACCTAAT AGCAAATCCC AATCAGATGT TTTTTTTGGT      417





********************************************************************************
EST sequence   32 -strand (File: 9307163-)

     1  GGAACTAAAC AAAACCTTAG TTTCCAGCGA AATCCAAAAA GTTTTCAAGA TTCCCCGTAA
    61  CATCGAATCT TGTGGCACAT GCATGAAACA CTAAATATAT TACACAGTTT GTCTATAAAT
   121  CATGAGACGA ATCTTTTGAC TTTAGTTAGT TTATGATTGG ACAATATTTA CCACAAGCAA
   181  ACGAAAGTGC TACAGTAGCG AAATCCGAAA TTTTTTCGGA TCAAGAGACC AGGACAAGGA
   241  GCGATGCGTT CTTGGCTGCG GCGCAAACCA GGCAGGCGTC GACGGGGGCC TCGCACGCGC
   301  GGCACAGGCA CAGGTGGCGG CACGGGAGCA GCAGCACGCA CGCCTCGCCG CCGGCGGACG
   361  ACCTGCACTC CTCCACCGGC CCCTGTGGTC CGCGGCCGCC GGAGCAGCCT GGCTCGAAGC
   421  AGCACGACCG CGCGTCCTCG GTCTCCCCAT GACCCTTGCA AGCGCCGCCA GTCGCCACCG
   481  CGCAGGGGGG C

Predicted gene structure (within gDNA segment 17373 to 14904):

 Exon  1  17023  16890 ( 134 n);  cDNA     87    218 ( 132 n); score: 0.761
  Intron  1  16889  16364 ( 526 n); Pd: 0.000 (s: 0.74), Pa: 0.000 (s:    0)
 Exon  2  16363  16341 (  23 n);  cDNA    219    239 (  21 n); score: 0.739

MATCH	21326110-	9307163-	0.761	157	0.320	C
PGS_21326110-_9307163-	(17023  16890,16363  16341)

Alignment (genomic DNA sequence = upper lines):

AAAAATAAAA ACTAATTGCA CAGTTTACCT ATAAATCGCG AGATAAATCT TTTAAACCTA    16964
|| | ||||  | | ||| || ||||||  || |||||||  | |||  ||||| ||| |   || 
AACACTAAAT A-T-ATTACA CAGTTTGTCT ATAAATCATG AGACGAATCT TTTGACTTTA      144


GTTACTCTAT GATTAGACAA TATTTGTCAA ATAAAAACGA AAGTGCTACA GTCTCAAAAA    16904
|||| | ||| |||| ||||| |||||  ||  |   |||||| |||||||||| ||  | |||  
GTTAGTTTAT GATTGGACAA TATTTACCAC AAGCAAACGA AAGTGCTACA GTAGCGAAAT      204


CCAAAAAGTT TTCGAAACTA AACAAGGCCT GACACTTGCA CATCTTTTTT AAAAAATATA    16844
|| |||  || ||||                                                   
CCGAAATTTT TTCG...... .......... .......... .......... ..........      218


AGGCCCTGTT TAGTTCCCAC CTAAAAAATT TTCATCCATC ACATTGAATC TTTAGACACA    16784
                                                                  
.......... .......... .......... .......... .......... ..........      218


TACATAAAAC ATTAAATGTA GATAAAAAAT AATTACACAG TTTGGTTGAA AATCGCGAGA    16724
                                                                  
.......... .......... .......... .......... .......... ..........      218


TGAATTTTTT AAGCCTAGTT AGTCCATGAT TAGCCTTAAG TGCTACAGTA ACCCACATGT    16664
                                                                  
.......... .......... .......... .......... .......... ..........      218


GCTAATAATA GATTAATTAT ACTTAATAGA TTCGTCTTGC AGTTTCCTGA CGAGTTATGT    16604
                                                                  
.......... .......... .......... .......... .......... ..........      218


AATTTGTTTT TTTTATTAGT TTTTAAAAAC CCCTCCCGAC ATCCTTCCGA CATATCCGAT    16544
                                                                  
.......... .......... .......... .......... .......... ..........      218


GTGACCTAAA AAATTTTCAT CTTCAATCTA AACATGCCCT AAGTGAAATG CAATAATGTG    16484
                                                                  
.......... .......... .......... .......... .......... ..........      218


TTGTAGAACT TTTATAGGCT ATCACACATG TGGTAGGGCG AGACCATCAT TACATTCGAA    16424
                                                                  
.......... .......... .......... .......... .......... ..........      218


GAAGAAATAT ATTCCGCAAT CCACAATTGG GATAAAATAG CAAATCATCG AAAAGGGCCT    16364
                                                                  
.......... .......... .......... .......... .......... ..........      218


GACCAATAAG AATCAGGTCA AGG    16341
|| |||  ||  | |||| || |||
GATCAA-GAG -ACCAGGACA AGG      239





********************************************************************************
EST sequence  128 -strand (File: 7218093-)

     1  TTGGCGTGGA CACGTGAGTT GACACCACAG CCTTGGATGT AAACCGAAGT GGTGGCCCAA
    61  ATTCCATCCT TTCACTAAAT TTGAGAAAAA TGAAAGATCA AATGCTAACT CAAAACTCAA
   121  AGTTGAAAGG ACAAAAACCT GTGTAGCATA GCAATTAGGC AAGTATTTAT CAATGAGGCC
   181  TTGTTTAGTT TCAAGACGAA AAGTTTTTGT GTGTCACATC AAATATGTCG GCACATATTT
   241  AAAGTACTAA ACATAGACTA ATAAAAAAAC AAATTACATA ACTTGCCTGG AAAGTGTGAG
   301  ACGAATTTAT TAAACCTAAT TAATCCGGCA TTAGCACATG TGGGCTACTG TAGCAGCTAT
   361  GGCTACTTAT GGGCTAATTA GGCTTAAAAG ATCCATCTCG CGATTTACAA CCAAACTGTG
   421  CAATTAGTTT TCGTTTTCGT CTACATTTAA TGCTCCATAC ATATGTCCAA AGATTTGATG
   481  TGATGGATAA AAAGTTTTTT TGGGTGAAGA ACTAAACAAG GACTAAGTGA AGCAAATCAT
   541  CACCAATCAA GAGAAATAAA CCCTCTTTGA TCGTGCCTCG TGC

Predicted gene structure (within gDNA segment 14999 to 17729):

 Exon  1  14999  15034 (  36 n);  cDNA     97    129 (  33 n); score: 0.583
  Intron  1  15035  15779 ( 745 n); Pd: 0.794 (s:    0), Pa: 0.188 (s:    0)
 Exon  2  15780  15807 (  28 n);  cDNA    130    157 (  28 n); score: 0.607
  Intron  2  15808  15883 (  76 n); Pd: 0.000 (s:    0), Pa: 0.361 (s:    0)
 Exon  3  15884  15903 (  20 n);  cDNA    158    177 (  20 n); score: 0.550
  Intron  3  15904  16505 ( 602 n); Pd: 0.991 (s:    0), Pa: 0.758 (s: 0.73)
 Exon  4  16506  16747 ( 242 n);  cDNA    178    419 ( 242 n); score: 0.769
  Intron  4  16748  17004 ( 257 n); Pd: 0.780 (s: 0.90), Pa: 0.000 (s: 0.80)
 Exon  5  17005  17091 (  87 n);  cDNA    420    500 (  81 n); score: 0.770

MATCH	21326110+	7218093-	0.769	413	0.708	C
PGS_21326110+_7218093-	(14999  15034,15780  15807,15884  15903,16506  16747,17005  17091)

Alignment (genomic DNA sequence = upper lines):

AGAAGCTACT AGCGCAATTT TCACCAGAGA TGAGAGGTAA GCGAGCTACC AGCATGTCTA    15058
|  |  | || | | |||    |||  | ||  ||| ||                           
ATCAAATGCT AACTCAAAAC TCA--A-AGT TGAAAG.... .......... ..........      129


AGGTGCTCTT CCCTCAAGAT AAAATCCAGT CATTGTTTGG TTTGAAGAAC AGAGAGAAAG    15118
                                                                  
.......... .......... .......... .......... .......... ..........      129


GCATATGCTG TATGATTCAA GACAGTAACT ACTTCAAACC CTGTTTGGAA TGTGGGAATC    15178
                                                                  
.......... .......... .......... .......... .......... ..........      129


TTGTAGTGAT TCTGAATGAT TTATAACATG TCCTGGATAA TTTCCTGTGT TTCAGACGTG    15238
                                                                  
.......... .......... .......... .......... .......... ..........      129


TCGTAACTTT ATAACACGAA TAACTCTTTC TCCTTTACCC TACTATTTCA CCACTAAACA    15298
                                                                  
.......... .......... .......... .......... .......... ..........      129


ACTAACTTGC CTATAAACAC TTTTTAGACT TCTTCTGAAA GGCCTAGTGT TTATGTGGTT    15358
                                                                  
.......... .......... .......... .......... .......... ..........      129


ATATGCAGCG TGAATGCACT TGCATATAAG ATTGATCTAA AAAATTGATG TAGTGAACTT    15418
                                                                  
.......... .......... .......... .......... .......... ..........      129


TGACTACCCG AAGTATATGC TTAGATAGTT CATGGATTTC TTTCATAAAA CTGCACACTG    15478
                                                                  
.......... .......... .......... .......... .......... ..........      129


TATTCTGGTT ATCTGTTATG AAGTTTACTA CGTTCTTTCA GGTATGTCCT ATCTTGTGGG    15538
                                                                  
.......... .......... .......... .......... .......... ..........      129


AAAGATTCTT GTGTCAAGTT ATGGGAAGTT GGCACTGGAC GACTTGTGAA GCAATATGCA    15598
                                                                  
.......... .......... .......... .......... .......... ..........      129


GGAGCCATTC GCAGACAATT TCGTTGTCAG GTTAGTTTCT CTGTGTTTCT ATAAGATTAT    15658
                                                                  
.......... .......... .......... .......... .......... ..........      129


TATTTTTTCC TGATTTAAAT TTACTCGTGT GCCATATATA TTATTTTTAC CCAAAATTTT    15718
                                                                  
.......... .......... .......... .......... .......... ..........      129


AGGAAACAAA ATATTGCAAT TCTTTAATTT GAAAATAGGC TGGTTTGAGC TTGCAGCTTA    15778
                                                                  
.......... .......... .......... .......... .......... ..........      129


GGATAACAAC ATACCTAACC TTGCTATGAT AGACAATAAA TATGATAATA ACTGTTCTTA    15838
 || || |||  |   || |  | || || |                                   
.GACAAAAAC CTGTGTAGCA TAGCAATTA. .......... .......... ..........      157


CTATCCAGGC TGTCTTCAAT GAAACCGAAG AATTTGTTCT ATCAGTTGAT GAACAAAACA    15898
                                                    |  | |   | || 
.......... .......... .......... .......... .....GGCAA GTATTTATCA      172


ATGAGGTAAA TTCCAAATTG AGAACAGTAT ATATATTTGT ATTTCAGCAA GCTTAACTAT    15958
|||||                                                             
ATGAG..... .......... .......... .......... .......... ..........      177


GATACGTCAC TCTTCAGGTT GTCGTCTGGG ATGCACTTAC TGCAGAAAAG GTTGCAAGAT    16018
                                                                  
.......... .......... .......... .......... .......... ..........      177


TGCCCTCTGG CAGCACTGGT GCTCCCAGAT GGCTCGACCA CTCCCCAGTT GAACCAGTTT    16078
                                                                  
.......... .......... .......... .......... .......... ..........      177


TTGTTATTTG TGGAAATGAT AGATCGATCA GATTCTGGAA ACAAACCGTA TAGCTTGTAG    16138
                                                                  
.......... .......... .......... .......... .......... ..........      177


ATTCAACCAT TCAAATCAAA AGTATGCTTT CAGTATTACG TTTCAGGAGG AATGTGCTCA    16198
                                                                  
.......... .......... .......... .......... .......... ..........      177


TGTAACTTTA GTTGTATATG GGAGAAATTT GCATAAGCAT TTTTTTTATT GGAAACTGCA    16258
                                                                  
.......... .......... .......... .......... .......... ..........      177


TAAGCAATTG ATTGATCTAA TAGCAAACCC CAATGATATG TTTTTTTTTT GGCTCTGCAT    16318
                                                                  
.......... .......... .......... .......... .......... ..........      177


AGCTGATGAC AGTTGTATGA ACCCTTGACC TGATTCTTAT TGGTCAGGCC CTTTTCGATG    16378
                                                                  
.......... .......... .......... .......... .......... ..........      177


ATTTGCTATT TTATCCCAAT TGTGGATTGC GGAATATATT TCTTCTTCGA ATGTAATGAT    16438
                                                                  
.......... .......... .......... .......... .......... ..........      177


GGTCTCGCCC TACCACATGT GTGATAGCCT ATAAAAGTTC TACAACACAT TATTGCATTT    16498
                                                                  
.......... .......... .......... .......... .......... ..........      177


CACTTAGGGC ATGTTTAGAT TGAAGATGAA AA-TTTTT-T AGGTCACATC GGATATGTCG    16556
       | |  ||||||| | | |||| ||| || ||||| |   ||||||||   |||||||| 
.......GCC TTGTTTAGTT TCAAGACGAA AAGTTTTTGT GTGTCACATC AAATATGTCG      230


GAAGGATGTC GGGAGGGGTT TTTAAAAACT AATAAAAAAA ACAAATTACA TAACTCGTCA    16616
| |  || |     ||   |     | | ||| ||||||||||  ||||||||| ||||| | |  
GCA-CATATT TAAAGTACTA AACATAGACT AATAAAAAAA -CAAATTACA TAACTTGCCT      288


GGAAACTGCA AGACGAATCT ATTAAGTATA ATTAATCTAT TATTAGCACA TGTGGGTTAC    16676
||||| ||   |||||||| | |||||   || |||||||     ||||||||| |||||| ||| 
GGAAAGTGTG AGACGAATTT ATTAAACCTA ATTAATCCGG CATTAGCACA TGTGGGCTAC      348


TGTAGCACTT AAGGCTAATC ATGGACTAAC TAGGCTTAAA AAATTCATCT CGCGATTTTC    16736
|||||||  | | ||||| |  |||| ||||  |||||||||| | || ||||| |||||||| | 
TGTAGCAGCT ATGGCTACTT ATGGGCTAAT TAGGCTTAAA AGATCCATCT CGCGATTTAC      408


AACCAAACTG TGTAATTATT TTTTATCTAC ATTTAATGTT TTATGTATGT GTCTAAAGAT    16796
|||||||||| |                                                      
AACCAAACTG T......... .......... .......... .......... ..........      419


TCAATGTGAT GGATGAAAAT TTTTTAGGTG GGAACTAAAC AGGGCCTTAT ATTTTTTAAA    16856
                                                                  
.......... .......... .......... .......... .......... ..........      419


AAAGATGTGC AAGTGTCAGG CCTTGTTTAG TTTCGAAAAC TTTTTGGTTT TTGAGACTGT    16916
                                                                  
.......... .......... .......... .......... .......... ..........      419


AGCACTTTCG TTTTTATTTG ACAAATATTG TCTAATCATA GAGTAACTAG GTTTAAAAGA    16976
                                                                  
.......... .......... .......... .......... .......... ..........      419


TTTATCTCGC GATTTATAGG TAAACTGTGC AATTAGTTTT TATTTTTGTA TATATTTAAT    17036
                              || ||||||||||   |||| ||  || ||||||| 
.......... .......... ........GC AATTAGTTTT CGTTTTCGTC TACATTTAAT      451


GCTTCATGCA TGTGTCGTAA TATTTGATGT GTTGAGAAAT TTTGAAAAGT TTTTG    17091
||| ||| || | ||||  ||  ||||||||| | || |  |    | |||||| |||| 
GCTCCATACA TATGTCCAAA GATTTGATGT GATG-G--A- --TAAAAAGT TTTTT      500





********************************************************************************
EST sequence   36 -strand (File: 13586922-)

     1  TCTGCCATAT ACAACTAAAG TTACATGAGC ACATTCCTCC TGAAACGTAA TACTGAAAGC
    61  ATACTTTTGA TTGGAATGGT TGAATCTACA AGCTATACGG TTAGTTTCCA CAATCTGATC
   121  GATCTATCAT TTCCACAAAT AACAAAAACT GGCTCAAC

Predicted gene structure (within gDNA segment 16544 to 15742):

 Exon  1  16223  16066 ( 158 n);  cDNA      1    158 ( 158 n); score: 0.968

MATCH	21326110-	13586922-	0.968	158	1.000	C
PGS_21326110-_13586922-	(16223  16066)

Alignment (genomic DNA sequence = upper lines):

TCTCCCATAT ACAACTAAAG TTACATGAGC ACATTCCTCC TGAAACGTAA TACTGAAAGC    16164
||| |||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
TCTGCCATAT ACAACTAAAG TTACATGAGC ACATTCCTCC TGAAACGTAA TACTGAAAGC       60


ATACTTTTGA TTTGAATGGT TGAATCTACA AGCTATACGG TTTGTTTCCA GAATCTGATC    16104
|||||||||| || ||||||| |||||||||| |||||||||| || |||||||  ||||||||| 
ATACTTTTGA TTGGAATGGT TGAATCTACA AGCTATACGG TTAGTTTCCA CAATCTGATC      120


GATCTATCAT TTCCACAAAT AACAAAAACT GGTTCAAC    16066
|||||||||| |||||||||| |||||||||| || |||||
GATCTATCAT TTCCACAAAT AACAAAAACT GGCTCAAC      158





********************************************************************************
EST sequence   26 +strand (File: 27548386+)

     1  GGACGAGACA AGGGGAAGAG TTGATGGTGT GTAAATTCAG TTCTTCCAGA GGGTGTGTTT
    61  AGTTCACGAA AGAAAATTTT TGGATGTCAT ATTGGACGTT TGACCGAATA TCGGAAGTGG
   121  TTTTCGGACA CGAATGAAAA AACTAATTTC ATAACTCGCC TGTAAACCGC GAGACGAATT
   181  TATTAAGCCT AATTAATCCT TCATTAGTAC ATGTGGATTA CTATAGTACT TATGACTAAT
   241  CATGGACTAA NTAGACTTAA AAGATTCNNC TCACAATTTC CATACAAACT GTGCAATTAG
   301  TTTTATTTTT ATCTATACTT AATGCTCTTT GCATATGTTC ATATATTCAA TGTGACATTT
   361  TAGAAAAAGA AATTGGGGAA CTAAACAAGG CCTGAACTCA GGCAGGTCAG AAATTAATAA
   421  CACAAGTACT CCCTCCGTCC TTAAAAAAAC AAATATAAAA CTGAAACATG ATACATCCTA
   481  ATACAATGAA ACTGGACATA TGTATGTTTG GAATGTGTTC CATCTAGTAC TAGTTTAGTT
   541  TTTTATAGGA CGAAGAGAGT ACAAAACAAG GTGAAGAGGA GTTTGGGTCA TCATTAAATC
   601  AAATTAACAC AGGTTCAATG ATGTTTCAGA AGATTGGTTG CAGCTCTTTT ACATTTACAG
   661  ACGACTGAGT ACAGGNAGGC TTATNCACTG NGACAGNTCA TTCAGAGAAC AGNCAAAAGG
   721  ATTTGGNCTT CCTCGGGGTG NCCGAAATGG CAAAATCCAT TCTGAATTTC CCTGCTCGGG
   781  NTTTCAAGGT TCAGCTGCTC CCAAANGTCA AAATTAGGTT TGGTGGGGAC ATTCCCTTGN
   841  NTTTTANNCC TGG

Predicted gene structure (within gDNA segment 15216 to 20066):

 Exon  1  16539  16747 ( 209 n);  cDNA     86    292 ( 207 n); score: 0.766
  Intron  1  16748  17004 ( 257 n); Pd: 0.780 (s: 0.80), Pa: 0.000 (s: 0.78)
 Exon  2  17005  17066 (  62 n);  cDNA    293    353 (  61 n); score: 0.774

MATCH	21326110+	27548386+	0.768	271	0.318	C
PGS_21326110+_27548386+	(16539  16747,17005  17066)

Alignment (genomic DNA sequence = upper lines):

GTCACATCGG ATATGTCGGA AGGATGTCGG GAGGGGTTTT TAAAAACTAA TAAAAAAAAC    16598
|||| || || |  | | |    | || ||||  || ||||||    | || || | ||||| || 
GTCATATTGG ACGT-TTGAC CGAATATCGG AAGTGGTTTT CGGACACGAA TGAAAAA-AC      143


AAATTACATA ACTCGTCAGG AAACTGCAAG ACGAATCTAT TAAGTATAAT TAATCTATTA    16658
 |||| |||| ||||| | |  |||| || || |||||| ||| ||||  |||| |||||  | | 
TAATTTCATA ACTCGCCTGT AAACCGCGAG ACGAATTTAT TAAGCCTAAT TAATCCTTCA      203


TTAGCACATG TGGGTTACTG TAGCACTTAA GGCTAATCAT GGACTAACTA GGCTTAAAAA    16718
|||| ||||| ||| |||||  ||| |||||  | |||||||| ||||||| || | |||||||  
TTAGTACATG TGGATTACTA TAGTACTTAT GACTAATCAT GGACTAANTA GACTTAAAAG      263


ATTCATCTCG CGATTTTCAA CCAAACTGTG TAATTATTTT TTATCTACAT TTAATGTTTT    16778
||||  |||  | |||| ||   ||||||||                                   
ATTCNNCTCA CAATTTCCAT ACAAACTGT. .......... .......... ..........      292


ATGTATGTGT CTAAAGATTC AATGTGATGG ATGAAAATTT TTTAGGTGGG AACTAAACAG    16838
                                                                  
.......... .......... .......... .......... .......... ..........      292


GGCCTTATAT TTTTTAAAAA AGATGTGCAA GTGTCAGGCC TTGTTTAGTT TCGAAAACTT    16898
                                                                  
.......... .......... .......... .......... .......... ..........      292


TTTGGTTTTT GAGACTGTAG CACTTTCGTT TTTATTTGAC AAATATTGTC TAATCATAGA    16958
                                                                  
.......... .......... .......... .......... .......... ..........      292


GTAACTAGGT TTAAAAGATT TATCTCGCGA TTTATAGGTA AACTGTGCAA TTAGTTTTTA    17018
                                                  |||| |||| ||||| 
.......... .......... .......... .......... ......GCAA TTAG-TTTTA      305


TTTTTGTATA TATTTAATGC TTCATGCATG TGTCGTAATA TTTGATGT    17066
||||| | || || ||||||| |   |||||  |||    ||| ||  ||||
TTTTTATCTA TACTTAATGC TCTTTGCATA TGTTCATATA TTCAATGT      353





********************************************************************************
EST sequence  132 +strand (File: 18065753+)

     1  GCACGAGGGA TTAGTTCACC CCGAAATCCG AAAAGTTTTC AAGATTCCCC GTCAAATCGA
    61  ATCTTGCGGC ATATGCATGA AACACTAAAT ATAGAGGAAA ACAAAAACTA ATTACACAGA
   121  TTGTCTGTAA ATCGCGAGAT GAATCTTTTG ATTCTAGTTA GTTCATGATT GAACAATATT
   181  TGTCAAATAA AAACGAAAAT GCTACAGTAG CGAAATCGAA ATTTTTTCGG AACTAAACAA
   241  GGCCTAAACA GGTCCTAAAT ATAATGTTCA GACAATCCCC TTAGTAAATA ATTATCTGAA
   301  AAAATATAGT TACTTATTTG TCATAGAATG TCCACTCTTC TGTTTTCTAC ATGAGGATTT
   361  GACAGATCTA AAATAGCTGC TAGGCAGCTT GTAGAACTTG TTTGTGATGA AGAGAACCCT
   421  TCAATTTGTT ATTGCGTACT TACAGGAGTG CTGCTGCACA ACCAACGTTG CTTATTCCGG
   481  TGGTACTTGT GATGATGTAT AACAGATGGA ATGGGATATT AGTTCCGGAT TATGGTTTCA
   541  TGCAACTGCA GTTAATACCA ATGCTTGTTG GGTTTTT

Predicted gene structure (within gDNA segment 17927 to 14909):

 Exon  1  17104  16878 ( 227 n);  cDNA     16    241 ( 226 n); score: 0.802
  Intron  1  16877  16585 ( 293 n); Pd: 0.000 (s: 0.80), Pa: 0.795 (s: 0.51)
 Exon  2  16584  16544 (  41 n);  cDNA    242    281 (  40 n); score: 0.512
  Intron  2  16543  15668 ( 876 n); Pd: 0.886 (s: 0.51), Pa: 0.477 (s: 0.64)
 Exon  3  15667  15618 (  50 n);  cDNA    282    328 (  47 n); score: 0.640

MATCH	21326110-	18065753+	0.773	318	0.551	C
PGS_21326110-_18065753+	(17104  16878,16584  16544,15667  15618)

Alignment (genomic DNA sequence = upper lines):

TCACCCCAAA AACCAAAAAC TTTTCAAAAT TTCTCAACAC ATCAAATATT ACGACACATG    17045
||||||| || | || ||||  ||||||| || | | |  ||  ||| ||| ||  || || ||| 
TCACCCCGAA ATCCGAAAAG TTTTCAAGAT TCCCCGTCAA ATCGAATCTT GCGGCATATG       75


CATGAAGCAT TAAATATATA CAAAAATAAA AACTAATTGC ACAGTTTACC TATAAATCGC    16985
|||||| ||  |||||||| |   |||| ||| |||||||| | |||| ||  | | |||||||| 
CATGAAACAC TAAATATAGA GGAAAACAAA AACTAATTAC ACAGATTGTC TGTAAATCGC      135


GAGATAAATC TTTTAAACCT AGTTACTCTA TGATTAGACA ATATTTGTCA AATAAAAACG    16925
||||| |||| |||| |  || ||||| |  | |||||  ||| |||||||||| |||||||||| 
GAGATGAATC TTTTGATTCT AGTTAGTTCA TGATTGAACA ATATTTGTCA AATAAAAACG      195


AAAGTGCTAC AGTCTCAAAA ACCAAAAAGT TTTCGAAACT AAACAAGGCC TGACACTTGC    16865
||| |||||| |||  |  || | | |||  | ||||| |||| |||||||               
AAAATGCTAC AGTAGC-GAA ATCGAAATTT TTTCGGAACT AAACAAG... ..........      241


ACATCTTTTT TAAAAAATAT AAGGCCCTGT TTAGTTCCCA CCTAAAAAAT TTTCATCCAT    16805
                                                                  
.......... .......... .......... .......... .......... ..........      241


CACATTGAAT CTTTAGACAC ATACATAAAA CATTAAATGT AGATAAAAAA TAATTACACA    16745
                                                                  
.......... .......... .......... .......... .......... ..........      241


GTTTGGTTGA AAATCGCGAG ATGAATTTTT TAAGCCTAGT TAGTCCATGA TTAGCCTTAA    16685
                                                                  
.......... .......... .......... .......... .......... ..........      241


GTGCTACAGT AACCCACATG TGCTAATAAT AGATTAATTA TACTTAATAG ATTCGTCTTG    16625
                                                                  
.......... .......... .......... .......... .......... ..........      241


CAGTTTCCTG ACGAGTTATG TAATTTGTTT TTTTTATTAG TTTTTAAAAA CCCCTCCCGA    16565
                                               | || |    |||    | 
.......... .......... .......... .......... GCCTAAACAG GTCCTAAATA      261


CATCCTTCCG ACATATCCGA TGTGACCTAA AAAATTTTCA TCTTCAATCT AAACATGCCC    16505
 |   ||| | ||| ||||   |                                           
TAATGTTCAG ACA-ATCCCC T......... .......... .......... ..........      281


TAAGTGAAAT GCAATAATGT GTTGTAGAAC TTTTATAGGC TATCACACAT GTGGTAGGGC    16445
                                                                  
.......... .......... .......... .......... .......... ..........      281


GAGACCATCA TTACATTCGA AGAAGAAATA TATTCCGCAA TCCACAATTG GGATAAAATA    16385
                                                                  
.......... .......... .......... .......... .......... ..........      281


GCAAATCATC GAAAAGGGCC TGACCAATAA GAATCAGGTC AAGGGTTCAT ACAACTGTCA    16325
                                                                  
.......... .......... .......... .......... .......... ..........      281


TCAGCTATGC AGAGCCAAAA AAAAAACATA TCATTGGGGT TTGCTATTAG ATCAATCAAT    16265
                                                                  
.......... .......... .......... .......... .......... ..........      281


TGCTTATGCA GTTTCCAATA AAAAAAATGC TTATGCAAAT TTCTCCCATA TACAACTAAA    16205
                                                                  
.......... .......... .......... .......... .......... ..........      281


GTTACATGAG CACATTCCTC CTGAAACGTA ATACTGAAAG CATACTTTTG ATTTGAATGG    16145
                                                                  
.......... .......... .......... .......... .......... ..........      281


TTGAATCTAC AAGCTATACG GTTTGTTTCC AGAATCTGAT CGATCTATCA TTTCCACAAA    16085
                                                                  
.......... .......... .......... .......... .......... ..........      281


TAACAAAAAC TGGTTCAACT GGGGAGTGGT CGAGCCATCT GGGAGCACCA GTGCTGCCAG    16025
                                                                  
.......... .......... .......... .......... .......... ..........      281


AGGGCAATCT TGCAACCTTT TCTGCAGTAA GTGCATCCCA GACGACAACC TGAAGAGTGA    15965
                                                                  
.......... .......... .......... .......... .......... ..........      281


CGTATCATAG TTAAGCTTGC TGAAATACAA ATATATATAC TGTTCTCAAT TTGGAATTTA    15905
                                                                  
.......... .......... .......... .......... .......... ..........      281


CCTCATTGTT TTGTTCATCA ACTGATAGAA CAAATTCTTC GGTTTCATTG AAGACAGCCT    15845
                                                                  
.......... .......... .......... .......... .......... ..........      281


GGATAGTAAG AACAGTTATT ATCATATTTA TTGTCTATCA TAGCAAGGTT AGGTATGTTG    15785
                                                                  
.......... .......... .......... .......... .......... ..........      281


TTATCCTAAG CTGCAAGCTC AAACCAGCCT ATTTTCAAAT TAAAGAATTG CAATATTTTG    15725
                                                                  
.......... .......... .......... .......... .......... ..........      281


TTTCCTAAAA TTTTGGGTAA AAATAATATA TATGGCACAC GAGTAAATTT AAATCAGGAA    15665
                                                               |  
.......... .......... .......... .......... .......... .......TAG      284


AAAATAATAA TCTTATAGAA ACACAGAGAA ACTAACCTGA CAACGAA    15618
 ||||||| | ||| | | || | | | ||   ||| |  ||  ||  |||
TAAATAATTA TCTGA-A-AA A-ATATAGTT ACTTATTTGT CATAGAA      328





********************************************************************************
EST sequence  120 +strand (File: 25805124+)

     1  TTTTTTTTTT TTTTTTTTTT TAAAACAAGA GTTTCGACTA GATTGCTACT CTTAATAAAT
    61  TCGAGTAGTT CACACCTCGC GCAGGAATCT CTTAATGTAT GAATCAGTTC AGTTCCCACC
   121  GAATTCAGTA AATAAATGCC ACATTACATA GGCCTCAATT GTTTCCAAAC CCAACATTTT
   181  CAGACCGCAA AACAGAACCG CTACAAGGTT CTGTACAAGT TTATCTTGCA CCATATATGA
   241  ACGAGGATGC TCTTCAGCCC ACACTACAAT CTTCACTCTT CTGTACAGTG TACATGCGCC
   301  CAGTTCCTTC CACATATCTT ACCATTTAGG GCCCGTTTAG TTCCCCAAAA ATATCGCATC
   361  GAATCTTTAG ACACATGCAT GAAGCATTAA ATATAGATNA AAAGAAAAAC TAATTGCACA
   421  GTTATGGGGA AATAGCGAGA CGAATCTTTT AAGCCTAATT AGTCCGTGAT TAGCCATTAA
   481  GTGCTACAGT AACCCACATG TGCTAATGAC GGCTTAATTA GTCTCAAAAG ATTCGTCTCG
   541  CGGTTTCCAG GCGAGTTCTA AAATTAGTTT TTTCATTTGT GTCCGAAAAC CCTTCNCGAC
   601  ATCCGGTTGT CTCGCCTCTG GCTTA

Predicted gene structure (within gDNA segment 19197 to 15763):

 Exon  1  18875  18858 (  18 n);  cDNA    339    356 (  18 n); score: 0.722
  Intron  1  18857  17066 (1792 n); Pd: 0.904 (s:    0), Pa: 0.000 (s: 0.84)
 Exon  2  17065  17000 (  66 n);  cDNA    357    422 (  66 n); score: 0.879
  Intron  2  16999  16744 ( 256 n); Pd: 0.000 (s: 0.92), Pa: 0.088 (s: 0.82)
 Exon  3  16743  16544 ( 200 n);  cDNA    423    619 ( 197 n); score: 0.770
  Intron  3  16543  16478 (  66 n); Pd: 0.886 (s: 0.64), Pa: 0.593 (s:    0)
 Exon  4  16477  16472 (   6 n);  cDNA    620    625 (   6 n); score: 0.500
 PPA                              cDNA     21      1

MATCH	21326110-	25805124+	0.797	290	0.464	C
PGS_21326110-_25805124+	(18875  18858,17065  17000,16743  16544,16477  16472)

Alignment (genomic DNA sequence = upper lines):

AGTACTCCAT AACTATCTGT AAGTTGAGAA TCGCATTTGC ATCAAGCCCA TGTTAAATGA    18816
||| | |||  || ||||                                                
AGTTCCCCAA AAATATCG.. .......... .......... .......... ..........      356


CTCAAGAAGT AGAGAAATCT CCCAATGATA GTTATTTCTT AATGTTAATA AAATGGATAC    18756
                                                                  
.......... .......... .......... .......... .......... ..........      356


TATCAGGCTA TTTGATTGTA CCCATAGGTA GTCCTCTCCT TGGTAGCTTC CAAAGTAGCG    18696
                                                                  
.......... .......... .......... .......... .......... ..........      356


GACAACATTT GGATGGCTAC ACTGCTGCAG CATCTCAATT TCTCCCCGTA TGTCTTCATA    18636
                                                                  
.......... .......... .......... .......... .......... ..........      356


TCCTTCTTCC TGAAAACCAA AGATACATAC TTATATTTTG GAAAAATGCA ACGACTCGGA    18576
                                                                  
.......... .......... .......... .......... .......... ..........      356


AAACAGACAG CAACCACATT TATGAGATTC TCTCACAATT GAGCCCATGC AAACAAAATG    18516
                                                                  
.......... .......... .......... .......... .......... ..........      356


CTCACAACAA AAGCAATATG GTTGCCAAAT ATGAAATATG TCTCGGGTGG CCTTTCAGAA    18456
                                                                  
.......... .......... .......... .......... .......... ..........      356


TATTCACAGA ACTTTGTAAT AGAAAATTAG AAACTAACCC CTTCTGTTAG TGAGATAATC    18396
                                                                  
.......... .......... .......... .......... .......... ..........      356


TTGACAGCCA CAAGCTCCTG CGTTCTGAGA TCCCTTGCTT TGTACACTGC ACCATATGAG    18336
                                                                  
.......... .......... .......... .......... .......... ..........      356


CCTTTCCCTG CATTCCCAAT TGAATTTTGC ATTTCGCAAA ACAGCTCAAA GCTTCAGCCA    18276
                                                                  
.......... .......... .......... .......... .......... ..........      356


TTCTACAAGT AGACATACAG AACTAATGAA ACAATAATTC CAGAGCAAGA GGCGCACCAA    18216
                                                                  
.......... .......... .......... .......... .......... ..........      356


GCTCATGGAG CAGCTCGTAC TTGGTGGAAG GATCCTCTCT GGTAACACTG TCTGGCGCCG    18156
                                                                  
.......... .......... .......... .......... .......... ..........      356


AGCTCACTGA TGGCTTCCGC CTTGAATGCT GCTGCTGTTG TTGCTGCATC AGAGGCGACG    18096
                                                                  
.......... .......... .......... .......... .......... ..........      356


GTTGCCGGAG CTCCTCTGTC TGCTCCACCG CTGGACTCCA GAAAGAGGAC CCGAAACCCC    18036
                                                                  
.......... .......... .......... .......... .......... ..........      356


CGCCGCCGCC AGAAGCAGAT TCATAGGAAC TGGAACCCCC GCTGGTGTGG CGAATGAAGG    17976
                                                                  
.......... .......... .......... .......... .......... ..........      356


TGCCAGAGAA CGACCCGCGG GGGCTCGACG GGCTCCCTGG TCGGCGGATG AATGTGCCGG    17916
                                                                  
.......... .......... .......... .......... .......... ..........      356


AGACCGAGTC CCGGGGGCTC GACGGGGTGC TAGTCCGGCG GATGAATGTG CCAGAGACGG    17856
                                                                  
.......... .......... .......... .......... .......... ..........      356


ATTCGTGAGG GCTGGACGAG CCCCCGGAGC GACGGATGAA TGTGCCTGAG GCGGACCCTC    17796
                                                                  
.......... .......... .......... .......... .......... ..........      356


GAGGGCTGGA GGAGGTCCCC CCCGAGCGTG CGGTGGAGTG GACGACGAAG GTAGAGTATG    17736
                                                                  
.......... .......... .......... .......... .......... ..........      356


GGTCGTCATC GGTAGCGCGG GGGCTGGAGC GCCGCAGATC CAGGAACGGA GATCGAGCGG    17676
                                                                  
.......... .......... .......... .......... .......... ..........      356


AGGCCGGGGC GCCGCTCTTG AAGACCACCG TAGCGGAGAG GGAAGCATCG TCGGGGTCGG    17616
                                                                  
.......... .......... .......... .......... .......... ..........      356


AGGAGTAGGC GTCCTCGTCT TCGTCAAAGG AGGGGCCGCC GAAGTCCTTG GGGAGCCGCT    17556
                                                                  
.......... .......... .......... .......... .......... ..........      356


GGAGAAGCGG AGGCAGCGAG GAGGGGTCTT CCTCCTCGTC TTCCTCCGCC CGCGTGGACG    17496
                                                                  
.......... .......... .......... .......... .......... ..........      356


GGCCCCTGCC GCGCCTGCTG CCGCGGGCGT CGTCCTCGTC GTCATCGCCG TGGACGACGA    17436
                                                                  
.......... .......... .......... .......... .......... ..........      356


AGGTTGAGTA GACGTCGTTT CTCTTGGGAC GCGACCACGG CGAGCGCGGG GAGAAAGCCA    17376
                                                                  
.......... .......... .......... .......... .......... ..........      356


TGGCGTGCCA CGCGAGGTGG GAGGAGACGG TGAAGGTGCT CGTCGGGAAT GGCAAATGGG    17316
                                                                  
.......... .......... .......... .......... .......... ..........      356


GAAAATTGTT TAGTTGGAGC CAGTTCACTC GAATCTGGCA AATATGGGTC GGGCTCGGAT    17256
                                                                  
.......... .......... .......... .......... .......... ..........      356


GGGCCATCCC ATTCTAGGCC CACGTGACAT AGAGAATCCG GTCAAATTCT TCCTTCCCGC    17196
                                                                  
.......... .......... .......... .......... .......... ..........      356


AGTCCCGCTA GGCCCACACG ACCACACCCA GTCACCCGCA GCCACAGGCC GCAGAGAGCT    17136
                                                                  
.......... .......... .......... .......... .......... ..........      356


TCCTCGAAAG GAGCTTCTCT TTTTTCTCCA CTCACCCCAA AAACCAAAAA CTTTTCAAAA    17076
                                                                  
.......... .......... .......... .......... .......... ..........      356


TTTCTCAACA CATCAAATAT TACGACACAT GCATGAAGCA TTAAATATAT ACAAAAATAA    17016
           |||| ||| | |  ||||||| |||||||||| |||||||||  |  |||| || 
.......... CATCGAATCT TTAGACACAT GCATGAAGCA TTAAATATAG ATNAAAAGAA      406


AAACTAATTG CACAGTTTAC CTATAAATCG CGAGATAAAT CTTTTAAACC TAGTTACTCT    16956
|||||||||| ||||||                                                 
AAACTAATTG CACAGT.... .......... .......... .......... ..........      422


ATGATTAGAC AATATTTGTC AAATAAAAAC GAAAGTGCTA CAGTCTCAAA AACCAAAAAG    16896
                                                                  
.......... .......... .......... .......... .......... ..........      422


TTTTCGAAAC TAAACAAGGC CTGACACTTG CACATCTTTT TTAAAAAATA TAAGGCCCTG    16836
                                                                  
.......... .......... .......... .......... .......... ..........      422


TTTAGTTCCC ACCTAAAAAA TTTTCATCCA TCACATTGAA TCTTTAGACA CATACATAAA    16776
                                                                  
.......... .......... .......... .......... .......... ..........      422


ACATTAAATG TAGATAAAAA ATAATTACAC AGTTTGGTTG AAAATCGCGA GATGAATTTT    16716
                                   | |||  |  |||| |||| || |||| || 
.......... .......... .......... ..TATGG--G GAAATAGCGA GACGAATCTT      448


TTAAGCCTAG TTAGTCCATG ATTAGCC-TT AAGTGCTACA GTAACCCACA TGTGCTAATA    16657
|||||||||  ||||||| || ||||||| || |||||||||| |||||||||| |||||||||  
TTAAGCCTAA TTAGTCCGTG ATTAGCCATT AAGTGCTACA GTAACCCACA TGTGCTAATG      508


ATAGATTAAT TATACTTAAT AGATTCGTCT TGCAGTTTCC TGACGAGTTA TGTAATTTGT    16597
|  | ||||| ||  || ||  ||||||||||  || ||||||  | ||||||  |  |||| |  
ACGGCTTAAT TAGTCTCAAA AGATTCGTCT CGCGGTTTCC AGGCGAGTTC TAAAATTAG-      567


TTTTTTTATT AGTTTTTAAA AACCCCTCCC GACATCCTTC CGACATATCC GATGTGACCT    16537
|||||| |||  || |   || ||||| || | |||||||     | | |  ||   |        
TTTTTTCATT TGTGTCCGAA AACCCTTCNC GACATCCGGT TGTC-TCGCC TCT.......      619


AAAAAATTTT CATCTTCAAT CTAAACATGC CCTAAGTGAA ATGCAATAAT GTGTTGTAGA    16477
                                                                  
.......... .......... .......... .......... .......... .........G      620


ACTTT    16472
 ||| 
GCTTA      625





********************************************************************************
EST sequence  117 -strand (File: 12622939-)

     1  TTTTTTTTTT TTTTTCTTGT AAGTTACGGG TCCTTAAGTT GGTTATGCAA GATGGAGGAG
    61  GAATAACAGG GAAGGTAAGT ACCCAGGTAA CTACCCAACT ACCCAACGGT ATTTAGTTGT
   121  ACGGCCAATT TTTTTTTTAA AGTATACGGA CACATATTTA AAGTATTAAA TATAGATTAA
   181  TAACAAAATA AATTACAGAT TCCGCCTGTA AGCTAANAGA CGAATCTATT AAGCCTAATT
   241  AATCTGTCAT TAGCAAATGT TTACTGTAGC ACCATATTGT CAAATCATGA CGTAATTAAA
   301  CTCAAAAAAT TTGACTCGCA ATTTACATGC AAACTGTGTA ATTGGTTTTT TTACTCGTCC
   361  ACATTTAATG CTATATACAT GTGTCTAAAT ATTTGATGTG ACNAAATTTC TGAAAGTTCG
   421  AGGAGAACTA AACATATCCA ATTT

Predicted gene structure (within gDNA segment 15237 to 17587):

 Exon  1  15884  15903 (  20 n);  cDNA    158    177 (  20 n); score: 0.550
  Intron  1  15904  16585 ( 682 n); Pd: 0.991 (s:    0), Pa: 0.000 (s: 0.72)
 Exon  2  16586  16685 ( 100 n);  cDNA    178    273 (  96 n); score: 0.770
  Intron  2  16686  16940 ( 255 n); Pd: 0.000 (s: 0.82), Pa: 0.000 (s: 0.74)
 Exon  3  16941  17066 ( 126 n);  cDNA    274    399 ( 126 n); score: 0.762
 PPA                              cDNA     15      1

MATCH	21326110+	12622939-	0.765	246	0.554	C
PGS_21326110+_12622939-	(15884  15903,16586  16685,16941  17066)

Alignment (genomic DNA sequence = upper lines):

TTGATGAACA AAACAATGAG GTAAATTCCA AATTGAGAAC AGTATATATA TTTGTATTTC    15943
|| | | |   ||| |  ||                                              
TTAAAGTATT AAATATAGAT .......... .......... .......... ..........      177


AGCAAGCTTA ACTATGATAC GTCACTCTTC AGGTTGTCGT CTGGGATGCA CTTACTGCAG    16003
                                                                  
.......... .......... .......... .......... .......... ..........      177


AAAAGGTTGC AAGATTGCCC TCTGGCAGCA CTGGTGCTCC CAGATGGCTC GACCACTCCC    16063
                                                                  
.......... .......... .......... .......... .......... ..........      177


CAGTTGAACC AGTTTTTGTT ATTTGTGGAA ATGATAGATC GATCAGATTC TGGAAACAAA    16123
                                                                  
.......... .......... .......... .......... .......... ..........      177


CCGTATAGCT TGTAGATTCA ACCATTCAAA TCAAAAGTAT GCTTTCAGTA TTACGTTTCA    16183
                                                                  
.......... .......... .......... .......... .......... ..........      177


GGAGGAATGT GCTCATGTAA CTTTAGTTGT ATATGGGAGA AATTTGCATA AGCATTTTTT    16243
                                                                  
.......... .......... .......... .......... .......... ..........      177


TTATTGGAAA CTGCATAAGC AATTGATTGA TCTAATAGCA AACCCCAATG ATATGTTTTT    16303
                                                                  
.......... .......... .......... .......... .......... ..........      177


TTTTTGGCTC TGCATAGCTG ATGACAGTTG TATGAACCCT TGACCTGATT CTTATTGGTC    16363
                                                                  
.......... .......... .......... .......... .......... ..........      177


AGGCCCTTTT CGATGATTTG CTATTTTATC CCAATTGTGG ATTGCGGAAT ATATTTCTTC    16423
                                                                  
.......... .......... .......... .......... .......... ..........      177


TTCGAATGTA ATGATGGTCT CGCCCTACCA CATGTGTGAT AGCCTATAAA AGTTCTACAA    16483
                                                                  
.......... .......... .......... .......... .......... ..........      177


CACATTATTG CATTTCACTT AGGGCATGTT TAGATTGAAG ATGAAAATTT TTTAGGTCAC    16543
                                                                  
.......... .......... .......... .......... .......... ..........      177


ATCGGATATG TCGGAAGGAT GTCGGGAGGG GTTTTTAAAA ACTAATAAAA AAAACAAATT    16603
                                              |||| ||  |||| ||||| 
.......... .......... .......... .......... ..TAAT-AAC AAAATAAATT      194


ACATAACTCG TCAGGAAACT GCAAGACGAA TCTATTAAGT ATAATTAATC TATTATTAGC    16663
||| |   ||  | | || ||    ||||||| |||||||||   ||||||||| | | |||||| 
ACAGATTCCG CCTGTAAGCT AANAGACGAA TCTATTAAGC CTAATTAATC TGTCATTAGC      254


ACATGTGGGT TACTGTAGCA CTTAAGGCTA ATCATGGACT AACTAGGCTT AAAAAATTCA    16723
| ||||   | |||||||||| |                                           
AAATGT---T TACTGTAGCA CC........ .......... .......... ..........      273


TCTCGCGATT TTCAACCAAA CTGTGTAATT ATTTTTTATC TACATTTAAT GTTTTATGTA    16783
                                                                  
.......... .......... .......... .......... .......... ..........      273


TGTGTCTAAA GATTCAATGT GATGGATGAA AATTTTTTAG GTGGGAACTA AACAGGGCCT    16843
                                                                  
.......... .......... .......... .......... .......... ..........      273


TATATTTTTT AAAAAAGATG TGCAAGTGTC AGGCCTTGTT TAGTTTCGAA AACTTTTTGG    16903
                                                                  
.......... .......... .......... .......... .......... ..........      273


TTTTTGAGAC TGTAGCACTT TCGTTTTTAT TTGACAAATA TTGTCTAATC ATAGAGTAAC    16963
                                        ||| ||||| |||| ||   ||||  
.......... .......... .......... .......ATA TTGTCAAATC ATGACGTAAT      296


TAGGTTTAAA AGATTTATCT CGCGATTTAT AGGTAAACTG TGCAATTAGT TTTTATTTTT    17023
||   | ||| | ||||  || ||| |||||  | | |||||| || |||| || |||| |  |  
TAAACTCAAA AAATTTGACT CGCAATTTAC ATGCAAACTG TGTAATTGGT TTTTTTACTC      356


GTATATATTT AATGCTTCAT GCATGTGTCG TAATATTTGA TGT    17066
||  | |||| ||||||  ||  ||||||||   ||||||||| |||
GTCCACATTT AATGCTATAT ACATGTGTCT AAATATTTGA TGT      399





********************************************************************************
EST sequence  116 +strand (File: 15856972+)

     1  GTGAATCCTT TGCCTTATAG TCACATTTGG AAGTTAGAGG AATGCTTATA TGGTGAGTTT
    61  CCAGAGCTTC TGTTGGAGAT TGAGATCCTG CTATGGAAAC GAATGAGATC GATGGGCTAG
   121  GATTCGAGGA TAAGTTTTAG TGGCTTTGAG ATATGGCACA TGCATTGTAA TATGGGTGAA
   181  TTGTCTGTAT GACGTTTAAT CTGAGATCAC TGGATCTCTT GTTAGGGCTT TAGGTGGTGT
   241  TTGGATCCAC GGGACTTAAC TTTAGTCTCT GTATTTAGAC CCTAATTTAG TCTATTAAAT
   301  ATAGACTACT TACCAAACTA ATTACATAAA TGAAAGCTAA TTTGCGAGAT AAATTTTTTA
   361  AGCCTAATTA ATCTATATTT AGAGAATGTT TACTGTAGCA TCACATAGGC TAATCATGGA
   421  TTAATTAGGC TCAATAGATT CGTCTGGATT AATTAGGCTT AATAGATTCG TCTTGTGAAT
   481  TAGTCCCAGA TTATGGATGT GTTAAAAAAA AAAAAAAAAA AAA

Predicted gene structure (within gDNA segment 18776 to 16080):

 Exon  1  17037  16939 (  99 n);  cDNA    293    391 (  99 n); score: 0.717
  Intron  1  16938  16680 ( 259 n); Pd: 0.000 (s: 0.82), Pa: 0.000 (s: 0.76)
 Exon  2  16679  16626 (  54 n);  cDNA    392    446 (  55 n); score: 0.759
 PPA                              cDNA    504    523

MATCH	21326110-	15856972+	0.732	153	0.293	C
PGS_21326110-_15856972+	(17037  16939,16679  16626)

Alignment (genomic DNA sequence = upper lines):

CATTAAATAT ATACAAAAAT AAAAACTAAT TGCACAGTTT ACCTATAAAT CGCGAGATAA    16978
 ||||||||| | || |       |||||||| | || |  |  |    ||| |  ||||||||| 
TATTAAATAT AGACTACTTA CCAAACTAAT TACATAAATG AAAGCTAATT TGCGAGATAA      352


ATCTTTTAAA CCTAGTTACT CTATGATTAG ACAATATTTG TCAAATAAAA ACGAAAGTGC    16918
|| ||||||  |||| ||| | ||||  |||| | ||| |||                        
ATTTTTTAAG CCTAATTAAT CTATATTTAG AGAATGTTT. .......... ..........      391


TACAGTCTCA AAAACCAAAA AGTTTTCGAA ACTAAACAAG GCCTGACACT TGCACATCTT    16858
                                                                  
.......... .......... .......... .......... .......... ..........      391


TTTTAAAAAA TATAAGGCCC TGTTTAGTTC CCACCTAAAA AATTTTCATC CATCACATTG    16798
                                                                  
.......... .......... .......... .......... .......... ..........      391


AATCTTTAGA CACATACATA AAACATTAAA TGTAGATAAA AAATAATTAC ACAGTTTGGT    16738
                                                                  
.......... .......... .......... .......... .......... ..........      391


TGAAAATCGC GAGATGAATT TTTTAAGCCT AGTTAGTCCA TGATTAGCCT TAAGTGCTAC    16678
                                                               || 
.......... .......... .......... .......... .......... ........AC      393


AGTAAC-CCA CATGTGCTAA TAATAGATTA ATTATACTTA ATAGATTCGT CTT    16626
 ||| |  || |||  ||||| | || ||||| ||||  || | |||||||||| || 
TGTAGCATCA CATAGGCTAA TCATGGATTA ATTAGGCTCA ATAGATTCGT CTG      446





********************************************************************************
EST sequence  115 -strand (File: 15856082-)

     1  TTTTTTTTTT TTTTTTTTTT AACTAAGACC CTATTTAGAT GGGACTAAAA CTTTTAAGTC
    61  CTTATCACAT CGGATGTTGG ATATTAATTA CAAATATTAA ACGTAGACTA TTAATATAAC
   121  ACATCCATAA TCTTGGACTA ATTCACAAGA CGAATCTATT AAGCCTAATT AATCCAGACG
   181  AATCTATGAG CCTAATTAAT CCATGATTAG CCTATGTGAT GCTACAGTAA ACATTCTCTA
   241  AATATAGATT AATTAGGCTT AAAAAATTTA TCTCGCAAAT TAGCTTTCAT TTATGTAATT
   301  AGTTTGGTAA GTCAGTCTAT ATTTAATAGA CTAAATTAGG GTCTAAATAC AGAGACTAAA
   361  GTTAAGTCCC TGGATCCAAA CACCACCTAA AGCCCTAACA AGAGATCCAT GATCTCAGAT
   421  TAAACGTCAT ACAGACAATT CACCCATATT ACAAGTGGAT GGGCATATCT CAAAGGCATA
   481  AAATTATCTC GAATCTAGCC

Predicted gene structure (within gDNA segment 15595 to 18181):

 Exon  1  15775  15846 (  72 n);  cDNA    110    177 (  68 n); score: 0.625
  Intron  1  15847  16628 ( 782 n); Pd: 0.000 (s: 0.58), Pa: 0.000 (s: 0.73)
 Exon  2  16629  16679 (  51 n);  cDNA    178    228 (  51 n); score: 0.745
  Intron  2  16680  16938 ( 259 n); Pd: 0.000 (s: 0.73), Pa: 0.000 (s: 0.82)
 Exon  3  16939  17036 (  98 n);  cDNA    229    327 (  99 n); score: 0.724
 PPA                              cDNA     20      1

MATCH	21326110+	15856082-	0.697	221	0.442	C
PGS_21326110+_15856082-	(15775  15846,16629  16679,16939  17036)

Alignment (genomic DNA sequence = upper lines):

CTTAGGATAA CAACATACCT AACCTTGCTA TGATAGACAA TAAATATGAT AATAACTGTT    15834
 |||  |||| | |||| | | || ||||    | ||  ||||  |   ||  | | |||   |  
ATTAATATAA C-ACATCCAT AATCTTGGAC TAATTCACAA GACGAAT-CT ATTAAGCCTA      167


CTTACTATCC AGGCTGTCTT CAATGAAACC GAAGAATTTG TTCTATCAGT TGATGAACAA    15894
 |||  |||| ||                                                     
ATTA--ATCC AG........ .......... .......... .......... ..........      177


AACAATGAGG TAAATTCCAA ATTGAGAACA GTATATATAT TTGTATTTCA GCAAGCTTAA    15954
                                                                  
.......... .......... .......... .......... .......... ..........      177


CTATGATACG TCACTCTTCA GGTTGTCGTC TGGGATGCAC TTACTGCAGA AAAGGTTGCA    16014
                                                                  
.......... .......... .......... .......... .......... ..........      177


AGATTGCCCT CTGGCAGCAC TGGTGCTCCC AGATGGCTCG ACCACTCCCC AGTTGAACCA    16074
                                                                  
.......... .......... .......... .......... .......... ..........      177


GTTTTTGTTA TTTGTGGAAA TGATAGATCG ATCAGATTCT GGAAACAAAC CGTATAGCTT    16134
                                                                  
.......... .......... .......... .......... .......... ..........      177


GTAGATTCAA CCATTCAAAT CAAAAGTATG CTTTCAGTAT TACGTTTCAG GAGGAATGTG    16194
                                                                  
.......... .......... .......... .......... .......... ..........      177


CTCATGTAAC TTTAGTTGTA TATGGGAGAA ATTTGCATAA GCATTTTTTT TATTGGAAAC    16254
                                                                  
.......... .......... .......... .......... .......... ..........      177


TGCATAAGCA ATTGATTGAT CTAATAGCAA ACCCCAATGA TATGTTTTTT TTTTGGCTCT    16314
                                                                  
.......... .......... .......... .......... .......... ..........      177


GCATAGCTGA TGACAGTTGT ATGAACCCTT GACCTGATTC TTATTGGTCA GGCCCTTTTC    16374
                                                                  
.......... .......... .......... .......... .......... ..........      177


GATGATTTGC TATTTTATCC CAATTGTGGA TTGCGGAATA TATTTCTTCT TCGAATGTAA    16434
                                                                  
.......... .......... .......... .......... .......... ..........      177


TGATGGTCTC GCCCTACCAC ATGTGTGATA GCCTATAAAA GTTCTACAAC ACATTATTGC    16494
                                                                  
.......... .......... .......... .......... .......... ..........      177


ATTTCACTTA GGGCATGTTT AGATTGAAGA TGAAAATTTT TTAGGTCACA TCGGATATGT    16554
                                                                  
.......... .......... .......... .......... .......... ..........      177


CGGAAGGATG TCGGGAGGGG TTTTTAAAAA CTAATAAAAA AAACAAATTA CATAACTCGT    16614
                                                                  
.......... .......... .......... .......... .......... ..........      177


CAGGAAACTG CAAGACGAAT CTATTAAGTA TAATTAATCT ATTATTAGCA CATGTG-GGT    16673
               |||||| ||| | ||   |||||||||  || ||||||   |||||  |  
.......... ....ACGAAT CTA-TGAGCC TAATTAATCC ATGATTAGCC TATGTGATGC      222


TACTGTAGCA CTTAAGGCTA ATCATGGACT AACTAGGCTT AAAAAATTCA TCTCGCGATT    16733
||| ||                                                            
TACAGT.... .......... .......... .......... .......... ..........      228


TTCAACCAAA CTGTGTAATT ATTTTTTATC TACATTTAAT GTTTTATGTA TGTGTCTAAA    16793
                                                                  
.......... .......... .......... .......... .......... ..........      228


GATTCAATGT GATGGATGAA AATTTTTTAG GTGGGAACTA AACAGGGCCT TATATTTTTT    16853
                                                                  
.......... .......... .......... .......... .......... ..........      228


AAAAAAGATG TGCAAGTGTC AGGCCTTGTT TAGTTTCGAA AACTTTTTGG TTTTTGAGAC    16913
                                                                  
.......... .......... .......... .......... .......... ..........      228


TGTAGCACTT TCGTTTTTAT TTGACAAATA TTGTCTAATC ATAGAGTAAC TAGGTTTAAA    16973
                           ||| | || |||||   ||||| |||  |||| ||||| 
.......... .......... .....AAACA TTCTCTAAAT ATAGATTAAT TAGGCTTAAA      263


AGATTTATCT CGCGATTTAT AGGTAAACTG TGCAATTAGT TT-TTATTTT TGTATATATT    17032
| |||||||| ||| | |||     | |  |  || ||||||| ||  ||  |   || |||||| 
AAATTTATCT CGCAAATTAG CTTTCATTTA TGTAATTAGT TTGGTAAGTC AGTCTATATT      323


TAAT    17036
||||
TAAT      327





********************************************************************************
EST sequence   40 -strand (File: 13152848-)

     1  TAAATTGTCT TGCAGTTTCC TGACGAGCTA TGTAATTTGT TTTTTTATTA GTTTCTAAAA
    61  ACCCCTCCCG ACATCCTTCC GACACATCCG ATGTGACACC CAAAAAATTT TCGTTCCCAA
   121  TCTAAACAGG CCCTTATTTC AAATTCTAGC ATAGATGGGG CGGCATACTC TAATTATTAC
   181  ATCAACACAG TTGCCTGAAA GTCCTCCGCC TACGTTTGGA GAGTTGCTTA AACATCCTCC
   241  TCAAGACAGA CTGGATTGAT AGGCCTGCCA CCCTTGGATG CGATACTGCC TCGCGGTCTC
   301  TGCAGGGTTA CTCGCCTTTA TAATCCCTCT TCCGACTATA ATTATATCAC TGCCTCTATC
   361  GTTTATGACA GAAAAGGGAG TGTTATATTG TTGCCCAAGG CCATCTCCTC CAGCAGCCAT
   421  CTGAACTCCA GGAGTGGCAT GGATAAACGC TGGGCTCGAC GGTGCTGGTG ACCAAGATGC
   481  AGGATTTACT GATATAAATC CTATTACAAA GTCAGGATGT TGCTCAGCGA TCTTTACAGC
   541  CGCAGCAGTG TAGTCTCCAT AAG

Predicted gene structure (within gDNA segment 16965 to 13909):

 Exon  1  16637  16502 ( 136 n);  cDNA      1    136 ( 136 n); score: 0.875
  Intron  1  16501  13926 (2576 n); Pd: 0.000 (s: 0.77), Pa: 0.668 (s:    0)
 Exon  2  13925  13909 (  17 n);  cDNA    137    152 (  16 n); score: 0.588

MATCH	21326110-	13152848-	0.875	153	0.272	C
PGS_21326110-_13152848-	(16637  16502,13925  13909)

Alignment (genomic DNA sequence = upper lines):

TAGATTCGTC TTGCAGTTTC CTGACGAGTT ATGTAATTTG TTTTTTTTAT TAGTTTTTAA    16578
|| ||| ||| |||||||||| |||||||| | ||||||||||  ||||||||| |||||| ||| 
TAAATT-GTC TTGCAGTTTC CTGACGAGCT ATGTAATTTG -TTTTTTTAT TAGTTTCTAA       58


AAACCCCTCC CGACATCCTT CCGACATATC CGATGTG--A CCTAAAAAAT TTTCATCTTC    16520
|||||||||| |||||||||| |||||| ||| |||||||  | || ||||||| |||| |   | 
AAACCCCTCC CGACATCCTT CCGACACATC CGATGTGACA CCCAAAAAAT TTTCGTTCCC      118


AATCTAAACA TGCCCTAAGT GAAATGCAAT AATGTGTTGT AGAACTTTTA TAGGCTATCA    16460
||||||||||  ||||| |                                               
AATCTAAACA GGCCCTTA.. .......... .......... .......... ..........      136


CACATGTGGT AGGGCGAGAC CATCATTACA TTCGAAGAAG AAATATATTC CGCAATCCAC    16400
                                                                  
.......... .......... .......... .......... .......... ..........      136


AATTGGGATA AAATAGCAAA TCATCGAAAA GGGCCTGACC AATAAGAATC AGGTCAAGGG    16340
                                                                  
.......... .......... .......... .......... .......... ..........      136


TTCATACAAC TGTCATCAGC TATGCAGAGC CAAAAAAAAA ACATATCATT GGGGTTTGCT    16280
                                                                  
.......... .......... .......... .......... .......... ..........      136


ATTAGATCAA TCAATTGCTT ATGCAGTTTC CAATAAAAAA AATGCTTATG CAAATTTCTC    16220
                                                                  
.......... .......... .......... .......... .......... ..........      136


CCATATACAA CTAAAGTTAC ATGAGCACAT TCCTCCTGAA ACGTAATACT GAAAGCATAC    16160
                                                                  
.......... .......... .......... .......... .......... ..........      136


TTTTGATTTG AATGGTTGAA TCTACAAGCT ATACGGTTTG TTTCCAGAAT CTGATCGATC    16100
                                                                  
.......... .......... .......... .......... .......... ..........      136


TATCATTTCC ACAAATAACA AAAACTGGTT CAACTGGGGA GTGGTCGAGC CATCTGGGAG    16040
                                                                  
.......... .......... .......... .......... .......... ..........      136


CACCAGTGCT GCCAGAGGGC AATCTTGCAA CCTTTTCTGC AGTAAGTGCA TCCCAGACGA    15980
                                                                  
.......... .......... .......... .......... .......... ..........      136


CAACCTGAAG AGTGACGTAT CATAGTTAAG CTTGCTGAAA TACAAATATA TATACTGTTC    15920
                                                                  
.......... .......... .......... .......... .......... ..........      136


TCAATTTGGA ATTTACCTCA TTGTTTTGTT CATCAACTGA TAGAACAAAT TCTTCGGTTT    15860
                                                                  
.......... .......... .......... .......... .......... ..........      136


CATTGAAGAC AGCCTGGATA GTAAGAACAG TTATTATCAT ATTTATTGTC TATCATAGCA    15800
                                                                  
.......... .......... .......... .......... .......... ..........      136


AGGTTAGGTA TGTTGTTATC CTAAGCTGCA AGCTCAAACC AGCCTATTTT CAAATTAAAG    15740
                                                                  
.......... .......... .......... .......... .......... ..........      136


AATTGCAATA TTTTGTTTCC TAAAATTTTG GGTAAAAATA ATATATATGG CACACGAGTA    15680
                                                                  
.......... .......... .......... .......... .......... ..........      136


AATTTAAATC AGGAAAAAAT AATAATCTTA TAGAAACACA GAGAAACTAA CCTGACAACG    15620
                                                                  
.......... .......... .......... .......... .......... ..........      136


AAATTGTCTG CGAATGGCTC CTGCATATTG CTTCACAAGT CGTCCAGTGC CAACTTCCCA    15560
                                                                  
.......... .......... .......... .......... .......... ..........      136


TAACTTGACA CAAGAATCTT TCCCACAAGA TAGGACATAC CTGAAAGAAC GTAGTAAACT    15500
                                                                  
.......... .......... .......... .......... .......... ..........      136


TCATAACAGA TAACCAGAAT ACAGTGTGCA GTTTTATGAA AGAAATCCAT GAACTATCTA    15440
                                                                  
.......... .......... .......... .......... .......... ..........      136


AGCATATACT TCGGGTAGTC AAAGTTCACT ACATCAATTT TTTAGATCAA TCTTATATGC    15380
                                                                  
.......... .......... .......... .......... .......... ..........      136


AAGTGCATTC ACGCTGCATA TAACCACATA AACACTAGGC CTTTCAGAAG AAGTCTAAAA    15320
                                                                  
.......... .......... .......... .......... .......... ..........      136


AGTGTTTATA GGCAAGTTAG TTGTTTAGTG GTGAAATAGT AGGGTAAAGG AGAAAGAGTT    15260
                                                                  
.......... .......... .......... .......... .......... ..........      136


ATTCGTGTTA TAAAGTTACG ACACGTCTGA AACACAGGAA ATTATCCAGG ACATGTTATA    15200
                                                                  
.......... .......... .......... .......... .......... ..........      136


AATCATTCAG AATCACTACA AGATTCCCAC ATTCCAAACA GGGTTTGAAG TAGTTACTGT    15140
                                                                  
.......... .......... .......... .......... .......... ..........      136


CTTGAATCAT ACAGCATATG CCTTTCTCTC TGTTCTTCAA ACCAAACAAT GACTGGATTT    15080
                                                                  
.......... .......... .......... .......... .......... ..........      136


TATCTTGAGG GAAGAGCACC TTAGACATGC TGGTAGCTCG CTTACCTCTC ATCTCTGGTG    15020
                                                                  
.......... .......... .......... .......... .......... ..........      136


AAAATTGCGC TAGTAGCTTC TGCAGATCCA TGTGCTCCAA TAATAGGTCG AACACATTCA    14960
                                                                  
.......... .......... .......... .......... .......... ..........      136


GCAGATACTC CATCCCAAAT GCGCAGAGAA CCATCTTTAG AAGCAGTCAC ATACAAGCTC    14900
                                                                  
.......... .......... .......... .......... .......... ..........      136


CCAGTACAGG AGTAGCGTAC CTGGCAGCAA CATCAGTAAG CATGGCTGGC GGAGAACTTT    14840
                                                                  
.......... .......... .......... .......... .......... ..........      136


GATGAGAATA TAACCAATGC AATCTAATGC TTGTGAATCA GAAGGAAAGA GAAAAGCTAC    14780
                                                                  
.......... .......... .......... .......... .......... ..........      136


CTGGTTAATG GGAGAACTAG AATCCTGTGC ATTTGCTGAT AAGTAGCATG TAAAAGTATT    14720
                                                                  
.......... .......... .......... .......... .......... ..........      136


TATATCATAT AAATGAGCAA CTGGGTGATC AGTCCCTGCA AATAATTTTA TCAGTGTCAC    14660
                                                                  
.......... .......... .......... .......... .......... ..........      136


TTGCTTCCAA ATATATGAAA ATGAGTTTTT TTAAAAAAAA TACATATTTG AATGTTAATA    14600
                                                                  
.......... .......... .......... .......... .......... ..........      136


TTTGACTATA TGTAAGAAGA AAATTCCATA CGATATGCTT GCAGTATTTT TCAAATGCCC    14540
                                                                  
.......... .......... .......... .......... .......... ..........      136


ACGAGACAGA AACTGTTGAT CCAGGAACGA AATCCAAATT CTTAAGCCCA AATATCAAAT    14480
                                                                  
.......... .......... .......... .......... .......... ..........      136


TGTTTTGGTG AAATGATTAA ATTACTTTAC AGATAACAAC TGAAAACATG TTAACAACTT    14420
                                                                  
.......... .......... .......... .......... .......... ..........      136


ATAATGCATA AAAATCAGAG CATATCAAAC TGATATCAGA CATCAAGAAT CAGTTAATCA    14360
                                                                  
.......... .......... .......... .......... .......... ..........      136


CAGCAGAACT AGAAATCAAA TTTAAATTTA GTGAAAAGAT CATAGTACCT GCTAAAAGGT    14300
                                                                  
.......... .......... .......... .......... .......... ..........      136


AATCCCCACA AGGATGAAAA CATACAGATC TAACATTATG AGTATCCTGC CAAGCATTAA    14240
                                                                  
.......... .......... .......... .......... .......... ..........      136


CAAATGAGCC TGGTTAAATG CAATGAACAC ACCATTTTAC ATGATATATA GAGAGATTGG    14180
                                                                  
.......... .......... .......... .......... .......... ..........      136


ATTGCTAGAA TTTACAACCT GAATAACTCT GAACGCTTTC CTCGCATTGG TCTTTGAGAA    14120
                                                                  
.......... .......... .......... .......... .......... ..........      136


GTCAAAAAAT CTGTTGAGCA AAATTTTTTC ATGTACAAAA CAATAACACA GATAGCAATT    14060
                                                                  
.......... .......... .......... .......... .......... ..........      136


AATACCGCAA AAAATTCCTA AAAAATCATG CTTAATCCTA GTATGAGCAC TTCAAATAGA    14000
                                                                  
.......... .......... .......... .......... .......... ..........      136


CAATTTAACA GCACGGAGTG TAGACATCAA GGATAAGCAT ACTTTATTGT ATTGTCTTTT    13940
                                                                  
.......... .......... .......... .......... .......... ..........      136


GCAGCTGATA TCAGTATTGG ACTCTCAGGA T    13909
               | |    | ||| || | |
.......... ....TTTCAA ATTCT-AGCA T      152





********************************************************************************
EST sequence   52 -strand (File: 6859196-)

     1  CCTAGTTACT CCATGATTAG CCTTAAGTGC TACAGTAACC CACATATGCT AATGACAGAT
    61  TAATTATGCT TAATAAATTT GTCTTGCAGT TTCCTGACGA GCTATGTAAT TTATTTTTTT
   121  ATTAGTTTCT AAAAATCCCT CCCGACATCC TTCCCACACA TTCGATGTGA CACCCAAAAA
   181  ATTTTCAGCC CCAATCTAAA CAGGCCAAGC ATGCTGATCG TCGTCATGGC GCTCCGCCGG
   241  CGGCGTCAGC GTCAGCAGCA GCAGGCGGTT TACACGCGTA GATTTTTGTG CATGTTCGGC
   301  CAGTGTATGG CTGGCCACGA GGCACGGAAG GCGTGCCGCC GGGGATCAAG GCTCCATAGC
   361  TCCCCTCCCC TAGCCCTCTC CCTGCGGCCA CGTGGACAAC GTCCATGGTA GAGACGACGA
   421  GGAACGCCAT CAGGAACACC ATGCAAAGCT GCTGCCTCCC CATCTTCTCG ATCTCTTCCT
   481  GATCGATTTC CTCCTCGTGC

Predicted gene structure (within gDNA segment 17051 to 14660):

 Exon  1  16710  16506 ( 205 n);  cDNA      1    206 ( 206 n); score: 0.883

MATCH	21326110-	6859196-	0.883	205	0.410	C
PGS_21326110-_6859196-	(16710  16506)

Alignment (genomic DNA sequence = upper lines):

CCTAGTTAGT CCATGATTAG CCTTAAGTGC TACAGTAACC CACATGTGCT AATAATAGAT    16651
|||||||| | |||||||||| |||||||||| |||||||||| ||||| |||| ||| | |||| 
CCTAGTTACT CCATGATTAG CCTTAAGTGC TACAGTAACC CACATATGCT AATGACAGAT       60


TAATTATACT TAATAGATTC GTCTTGCAGT TTCCTGACGA GTTATGTAAT TTGTTTTTTT    16591
||||||| || ||||| |||  |||||||||| |||||||||| | |||||||| ||  |||||| 
TAATTATGCT TAATAAATTT GTCTTGCAGT TTCCTGACGA GCTATGTAAT TT-ATTTTTT      119


TATTAGTTTT TAAAAACCCC TCCCGACATC CTTCCGACAT ATCCGATGTG --ACCTAAAA    16533
|||||||||  |||||| ||| |||||||||| ||||| |||  || |||||||   ||| |||| 
TATTAGTTTC TAAAAATCCC TCCCGACATC CTTCCCACAC ATTCGATGTG ACACCCAAAA      179


AATTTTCATC TTCAATCTAA ACATGCC    16506
|||||||| |   |||||||| ||| |||
AATTTTCAGC CCCAATCTAA ACAGGCC      206





********************************************************************************
EST sequence   59 -strand (File: 9855330-)

     1  AGGCTTACGA ACATCCCACT TACATCTCCA TCACGGGTAC ATGCACACAC AGCGCCTCCG
    61  CCCAATTACA GTTTGGATCT TATTAAATTA TTATATAGAC TCATACTAAC CTGATTACTA
   121  CTAGTGATTA TGTAGAGCCT AGACTAGAGG CGCCTTGTTG TTCAAAGGAA ATTATTATTC
   181  TTAGGCCCTG TTTAGTTCCC CACCAAAAAT TTTTTCATCC ATCCCATCGA ATCTTTGGAC
   241  ACATGCATGG AACATTAAAT GTAGATAAAA AAATAAACTA ATTACACAGT TTAGTTGAGA
   301  ATCGCGAGAC GAATCTTTTA AGCCTAGTTA CTCCATGATT AGCCTTAAGT GCTACAGTAA
   361  CCCACATATG CTAATGACAG ATTAATTATG CTTAATAAAT TTGTCTTGCA GTTTCCTGAC
   421  GAGCTATGTA ATTTATTTTT TTATTAGTTT CTAAAAATCC CTCCCGACAT CCTTCCCACA
   481  CATTCGATGT GACACCCAAA AAATTTTCAG CCCCAATCTA AACAGGCCAA GCATGCTGAT
   541  CGTCGTCATG GCGCTCCGCC GGCGGCGTCA GCGTCAGCAG CAGCAGGCGG TTTA

Predicted gene structure (within gDNA segment 18058 to 15800):

 Exon  1  16843  16511 ( 333 n);  cDNA    183    523 ( 341 n); score: 0.850

MATCH	21326110-	9855330-	0.850	333	0.561	C
PGS_21326110-_9855330-	(16843  16511)

Alignment (genomic DNA sequence = upper lines):

AGGCCCTGTT TAGTT-CCCA CCTAAAAAAT TTTCATCCAT CACATTGAAT CTTTAGACAC    16785
|||||||||| ||||| |||| || ||||  | |||||||||| | ||| |||| |||| ||||| 
AGGCCCTGTT TAGTTCCCCA CCAAAAATTT TTTCATCCAT CCCATCGAAT CTTTGGACAC      242


ATACATAAAA CATTAAATGT AGAT----AA A-AAA-TAAT TACACAGTTT GGTTGAAAAT    16731
|| |||  || |||||||||| ||||    || | ||| |||| ||||||||||  ||||| ||| 
ATGCATGGAA CATTAAATGT AGATAAAAAA ATAAACTAAT TACACAGTTT AGTTGAGAAT      302


CGCGAGATGA ATTTTTTAAG CCTAGTTAGT CCATGATTAG CCTTAAGTGC TACAGTAACC    16671
||||||| || || ||||||| |||||||| | |||||||||| |||||||||| |||||||||| 
CGCGAGACGA ATCTTTTAAG CCTAGTTACT CCATGATTAG CCTTAAGTGC TACAGTAACC      362


CACATGTGCT AATAATAGAT TAATTATACT TAATAGATTC GTCTTGCAGT TTCCTGACGA    16611
||||| |||| ||| | |||| ||||||| || ||||| |||  |||||||||| |||||||||| 
CACATATGCT AATGACAGAT TAATTATGCT TAATAAATTT GTCTTGCAGT TTCCTGACGA      422


GTTATGTAAT TTGTTTTTTT TATTAGTTTT TAAAAACCCC TCCCGACATC CTTCCGACAT    16551
| |||||||| ||  |||||| |||||||||  |||||| ||| |||||||||| ||||| |||  
GCTATGTAAT TT-ATTTTTT TATTAGTTTC TAAAAATCCC TCCCGACATC CTTCCCACAC      481


ATCCGATGTG --ACCTAAAA AATTTTCATC TTCAATCTAA AC    16511
|| |||||||   ||| |||| |||||||| |   |||||||| ||
ATTCGATGTG ACACCCAAAA AATTTTCAGC CCCAATCTAA AC      523





********************************************************************************
EST sequence  119 +strand (File: 4714617+)

     1  CATGTAAATA TGGGCCTGTT TAGTTTTCAA ACAAAATTTT TCACGCTGTC ACATCGAATG
    61  TTTGGACACA TGCATAGTGT TAAATGTAGA AAAAAAAACC AATTACATAG TTCGACAGGA
   121  AATTGCGAGA TGAATCTTTT AAGCTTAATT GCGCCAGGAT TTGATAATGT GGTGCTACAA
   181  TAAACATTTG TTGATGACGG ATTAATTAGG CTTGATAAAT TCGTCTCGAA GTTTTCTGGC
   241  AGAATCTGTA ATTTGTTTTG TTATTAGACT ACGTTTAATA CTTTAAATGT GTGTCCGTAT
   301  ATCCGATGTG ACATGTAGGG GCAAATTTTT TTGCCAACTA AACAGGCCCT ATATATGCCA
   361  TCAATTTGAA TATGAACAGA AAATTTTCTA AGCATATATA CATAAATATT GTATGCCAAA
   421  AAAAAAAAAA AAAAAAAAA

Predicted gene structure (within gDNA segment 18136 to 15930):

 Exon  1  16853  16544 ( 310 n);  cDNA      1    307 ( 307 n); score: 0.661
 PPA                              cDNA    418    439

MATCH	21326110-	4714617+	0.661	310	0.706	C
PGS_21326110-_4714617+	(16853  16544)

Alignment (genomic DNA sequence = upper lines):

AAAAAATATA AGGCCCTGTT TAGTTCCCAC CTAAAAAATT TTCATCCATC ACATTGAATC    16794
 |   | |||  || |||||| |||||  ||    ||||  || |    |  || |||| ||||  
CATGTAAATA TGGGCCTGTT TAGTTTTCAA ACAAAATTTT TCACGCTGTC ACATCGAATG       60


TTTAGACACA TACATAAAAC ATTAAATGTA GATAAAAA-A -TAATTACAC AGTTTGGTTG    16736
||| |||||| | |||  |    ||||||||| || ||||| |   |||||||  |||| |   | 
TTTGGACACA TGCAT--AGT GTTAAATGTA GAAAAAAAAA CCAATTACAT AGTTCGACAG      118


AAAATCGCGA GATGAATTTT TTAAGCCTAG TTAGTCCATG ATTAGCCTTA AGTGCTACAG    16676
 |||| |||| ||||||| || |||||| ||  ||   ||| | ||| |  | |  ||| | |   
GAAATTGCGA GATGAATCTT TTAAGCTTAA TTGCGCCAGG ATTTG-ATAA TGTGGTGCTA      177


TAACCCACAT GTGCTAATAA TAGATTAATT ATACTTAATA GATTCGTCTT GCAGTTTCCT    16616
 ||   ||||  || | || |   |||||||| |  ||| |||  ||||||||  | ||||| || 
CAATAAACAT TTGTTGATGA CGGATTAATT AGGCTTGATA AATTCGTCTC GAAGTTTTCT      237


GACGAGTTAT GTAATTTGTT TTTTTTATTA GTTTTTAAAA ACCCCTCCCG ACATCCTTCC    16556
| |    | | |||||||| | ||| |||||| |  |       |   ||     |  |   ||| 
GGCAGAATCT GTAATTTG-T TTTGTTATTA GACTACGTTT AATACTTTAA ATGTGTGTCC      296


GACATATCCG AT    16544
|  ||||||| ||
G-TATATCCG AT      307





********************************************************************************
EST sequence  109 +strand (File: 20553288+)

     1  CCTGTTTAGT TCCCCATCCA AAAATTTTTC ATCCATCTCA TCGAATCTTT GGACACATGC
    61  ATGGAATATT AAATGTAGAT AAAAAAATGA ACTGATTACG CAGTTTAGTT GAGAATCGCT
   121  AGACGAATCT TTTAAGCCTA GTTACTCCAT GATTAGCCTT AAGTGCTACA GTAACCCACA
   181  TATGCTAATG ACAGATTAAT TATGCTTAAT AAATTTGTCT TGCAGTTTCC TGACGAGCTA
   241  TGTAATTTGT TTTTTTATTA GATTCTAAAA ACCCCTCCCG ACATCTTTCC GACATATCCG
   301  ATGTGACACG CAGAAAATTT TCGATCCCAA TCTAAACAGG CCCTGAATAC AGTGA

Predicted gene structure (within gDNA segment 17139 to 15994):

 Exon  1  16839  16544 ( 296 n);  cDNA      1    302 ( 302 n); score: 0.858

MATCH	21326110-	20553288+	0.858	296	0.834	C
PGS_21326110-_20553288+	(16839  16544)

Alignment (genomic DNA sequence = upper lines):

CCTGTTTAGT T-CCCACCTA AAAAATTTTC ATCCATCACA TTGAATCTTT AGACACATAC    16781
|||||||||| | |||| | | |||| ||||| ||||||| || | ||||||||  ||||||| | 
CCTGTTTAGT TCCCCATCCA AAAATTTTTC ATCCATCTCA TCGAATCTTT GGACACATGC       60


ATAAAACATT AAATGTAGAT -AAAAAAT-- A---ATTACA CAGTTTGGTT GAAAATCGCG    16727
||  || ||| ||||||||||  |||||||   |   |||||  |||||| ||| || ||||||  
ATGGAATATT AAATGTAGAT AAAAAAATGA ACTGATTACG CAGTTTAGTT GAGAATCGCT      120


AGATGAATTT TTTAAGCCTA GTTAGTCCAT GATTAGCCTT AAGTGCTACA GTAACCCACA    16667
||| |||| | |||||||||| |||| ||||| |||||||||| |||||||||| |||||||||| 
AGACGAATCT TTTAAGCCTA GTTACTCCAT GATTAGCCTT AAGTGCTACA GTAACCCACA      180


TGTGCTAATA ATAGATTAAT TATACTTAAT AGATTCGTCT TGCAGTTTCC TGACGAGTTA    16607
| |||||||  | |||||||| ||| |||||| | ||| |||| |||||||||| ||||||| || 
TATGCTAATG ACAGATTAAT TATGCTTAAT AAATTTGTCT TGCAGTTTCC TGACGAGCTA      240


TGTAATTTGT TTTTTTTATT AGTTTTTAAA AACCCCTCCC GACATCCTTC CGACATATCC    16547
|||||||||  |||||||||| || || |||| |||||||||| |||||| ||| |||||||||| 
TGTAATTTG- TTTTTTTATT AGATTCTAAA AACCCCTCCC GACATCTTTC CGACATATCC      299


GAT    16544
|||
GAT      302





********************************************************************************
EST sequence   22 -strand (File: 16578696-)

     1  TTTTTTTTTT TTTTTTTAAA TATGGACGAA AAAAACCAAT TACACAGTTT GCATGTAAAT
    61  TGCGAGACGA ATCTTTTGAG CCTAATTACG TCTTGATTTG ACAATGTGGT GCTACAGTAA
   121  ACATTTGCTA ATGACGAATT AATTAGGCTT AATAGATTCG TCTCGCAGTT TACAGGCGAA
   181  ATCTGTAATC TGTTTGGTTA TTAGTCTACG TTTAATACTT CAAATGTGTC CGTATACTTC
   241  AAAAATTTTA TTTGGGCACA CGAACTAAAC ACAGCCAAAC TCAACAAAAT TATTCAGCAA
   301  TGTTATCTCT ACAAGAAATG ATGCAGCATT TGGCAGTGCT AAATTCGGCT TGAATCCCTC
   361  CCAAATATGA ACCTCCGAGT CCAGTCGGAT ACCACCAGCA TCCGTGTGCG CCAACTCACT
   421  TGTTGCTTGC ATATACAGAG TACCAGAGCC ACTGAGTGCT ATGGCCATGG AAACCCAGTC
   481  GCCTGGGAGC TCTGCAGCAG CTTGTCTCCA CCCAAGGTGT GCAAATTGCC AAGATGCTTG
   541  TACGGAATGG GCGGAAATTG TGCCGTCTGA TCCTGTTCCT GTCATGCGCA ACGGACTT

Predicted gene structure (within gDNA segment 17243 to 14152):

 Exon  1  16762  16582 ( 181 n);  cDNA     29    207 ( 179 n); score: 0.746
  Intron  1  16581  16478 ( 104 n); Pd: 0.000 (s: 0.76), Pa: 0.593 (s:    0)
 Exon  2  16477  16467 (  11 n);  cDNA    208    218 (  11 n); score: 0.636
  Intron  2  16466  16232 ( 235 n); Pd: 0.000 (s:    0), Pa: 0.000 (s: 0.58)
 Exon  3  16231  16178 (  54 n);  cDNA    219    270 (  52 n); score: 0.611
  Intron  3  16177  15984 ( 194 n); Pd: 0.741 (s: 0.60), Pa: 0.000 (s:    0)
 Exon  4  15983  15969 (  15 n);  cDNA    271    286 (  16 n); score: 0.600
  Intron  4  15968  15223 ( 746 n); Pd: 0.861 (s:    0), Pa: 0.033 (s:    0)
 Exon  5  15222  15203 (  20 n);  cDNA    287    304 (  18 n); score: 0.800
  Intron  5  15202  14433 ( 770 n); Pd: 0.000 (s:    0), Pa: 0.000 (s:    0)
 Exon  6  14432  14413 (  20 n);  cDNA    305    324 (  20 n); score: 0.650
  Intron  6  14412  14189 ( 224 n); Pd: 0.000 (s:    0), Pa: 0.569 (s:    0)
 Exon  7  14188  14152 (  37 n);  cDNA    325    359 (  35 n); score: 0.622
 PPA                              cDNA     17      1

MATCH	21326110-	16578696-	0.715	338	0.565	C
PGS_21326110-_16578696-	(16762  16582,16477  16467,16231  16178,15983  15969,15222  15203,14432  14413,14188  14152)

Alignment (genomic DNA sequence = upper lines):

ATAAAAAATA ATTACACAGT TTGGTTGAAA ATCGCGAGAT GAATTTTTTA AGCCTAGTTA    16703
| |||||  | |||||||||| |||  || || || ||||||  |||| ||||  |||||| ||| 
AAAAAAACCA ATTACACAGT TTGCATGTAA ATTGCGAGAC GAATCTTTTG AGCCTAATTA       88


GTCCATGATT AG-C-CTTAA GTGCTACAGT AACCCACATG TGCTAATAAT AGATTAATTA    16645
   | |||||  | |  |    |||||||||| ||   ||||  ||||||| |    |||||||| 
CGTCTTGATT TGACAATGTG GTGCTACAGT AA---ACATT TGCTAATGAC GAATTAATTA      145


TACTTAATAG ATTCGTCTTG CAGTTTCCTG ACGAGTTATG TAATTTGTTT TTTTTATTAG    16585
  |||||||| |||||||| | |||||| | |  |||  | || |||| || || |  ||||||| 
GGCTTAATAG ATTCGTCTCG CAGTTTACAG GCGAAATCTG TAATCTG-TT TGGTTATTAG      204


TTTTTAAAAA CCCCTCCCGA CATCCTTCCG ACATATCCGA TGTGACCTAA AAAATTTTCA    16525
| |                                                               
TCT....... .......... .......... .......... .......... ..........      207


TCTTCAATCT AAACATGCCC TAAGTGAAAT GCAATAATGT GTTGTAGAAC TTTTATAGGC    16465
                                                   |   ||| |||    
.......... .......... .......... .......... .......ACG TTTAATAC..      218


TATCACACAT GTGGTAGGGC GAGACCATCA TTACATTCGA AGAAGAAATA TATTCCGCAA    16405
                                                                  
.......... .......... .......... .......... .......... ..........      218


TCCACAATTG GGATAAAATA GCAAATCATC GAAAAGGGCC TGACCAATAA GAATCAGGTC    16345
                                                                  
.......... .......... .......... .......... .......... ..........      218


AAGGGTTCAT ACAACTGTCA TCAGCTATGC AGAGCCAAAA AAAAAACATA TCATTGGGGT    16285
                                                                  
.......... .......... .......... .......... .......... ..........      218


TTGCTATTAG ATCAATCAAT TGCTTATGCA GTTTCCAATA AAAAAAATGC TTATGCAAAT    16225
                                                          | ||||| 
.......... .......... .......... .......... .......... ...TTCAAAT      225


TTCTCCCATA TACAACTAAA GTTACATGAG CACATTCCTC CTGAAACGTA ATACTGAAAG    16165
 | | || || |||  | |||  ||  ||  |   ||  |    || ||||               
GTGT-CCGTA TACTTCAAAA ATTTTATTTG GGCACACGAA CT-AAAC... ..........      270


CATACTTTTG ATTTGAATGG TTGAATCTAC AAGCTATACG GTTTGTTTCC AGAATCTGAT    16105
                                                                  
.......... .......... .......... .......... .......... ..........      270


CGATCTATCA TTTCCACAAA TAACAAAAAC TGGTTCAACT GGGGAGTGGT CGAGCCATCT    16045
                                                                  
.......... .......... .......... .......... .......... ..........      270


GGGAGCACCA GTGCTGCCAG AGGGCAATCT TGCAACCTTT TCTGCAGTAA GTGCATCCCA    15985
                                                                  
.......... .......... .......... .......... .......... ..........      270


GAC-GACAAC CTGAAGAGTG ACGTATCATA GTTAAGCTTG CTGAAATACA AATATATATA    15926
 || | |||  || || |                                                
.ACAGCCAAA CTCAACA... .......... .......... .......... ..........      286


CTGTTCTCAA TTTGGAATTT ACCTCATTGT TTTGTTCATC AACTGATAGA ACAAATTCTT    15866
                                                                  
.......... .......... .......... .......... .......... ..........      286


CGGTTTCATT GAAGACAGCC TGGATAGTAA GAACAGTTAT TATCATATTT ATTGTCTATC    15806
                                                                  
.......... .......... .......... .......... .......... ..........      286


ATAGCAAGGT TAGGTATGTT GTTATCCTAA GCTGCAAGCT CAAACCAGCC TATTTTCAAA    15746
                                                                  
.......... .......... .......... .......... .......... ..........      286


TTAAAGAATT GCAATATTTT GTTTCCTAAA ATTTTGGGTA AAAATAATAT ATATGGCACA    15686
                                                                  
.......... .......... .......... .......... .......... ..........      286


CGAGTAAATT TAAATCAGGA AAAAATAATA ATCTTATAGA AACACAGAGA AACTAACCTG    15626
                                                                  
.......... .......... .......... .......... .......... ..........      286


ACAACGAAAT TGTCTGCGAA TGGCTCCTGC ATATTGCTTC ACAAGTCGTC CAGTGCCAAC    15566
                                                                  
.......... .......... .......... .......... .......... ..........      286


TTCCCATAAC TTGACACAAG AATCTTTCCC ACAAGATAGG ACATACCTGA AAGAACGTAG    15506
                                                                  
.......... .......... .......... .......... .......... ..........      286


TAAACTTCAT AACAGATAAC CAGAATACAG TGTGCAGTTT TATGAAAGAA ATCCATGAAC    15446
                                                                  
.......... .......... .......... .......... .......... ..........      286


TATCTAAGCA TATACTTCGG GTAGTCAAAG TTCACTACAT CAATTTTTTA GATCAATCTT    15386
                                                                  
.......... .......... .......... .......... .......... ..........      286


ATATGCAAGT GCATTCACGC TGCATATAAC CACATAAACA CTAGGCCTTT CAGAAGAAGT    15326
                                                                  
.......... .......... .......... .......... .......... ..........      286


CTAAAAAGTG TTTATAGGCA AGTTAGTTGT TTAGTGGTGA AATAGTAGGG TAAAGGAGAA    15266
                                                                  
.......... .......... .......... .......... .......... ..........      286


AGAGTTATTC GTGTTATAAA GTTACGACAC GTCTGAAACA CAGGAAATTA TCCAGGACAT    15206
                                                |||||| | ||| | || 
.......... .......... .......... .......... ...-AAATTA TTCAGCA-AT      301


GTTATAAATC ATTCAGAATC ACTACAAGAT TCCCACATTC CAAACAGGGT TTGAAGTAGT    15146
|||                                                               
GTT....... .......... .......... .......... .......... ..........      304


TACTGTCTTG AATCATACAG CATATGCCTT TCTCTCTGTT CTTCAAACCA AACAATGACT    15086
                                                                  
.......... .......... .......... .......... .......... ..........      304


GGATTTTATC TTGAGGGAAG AGCACCTTAG ACATGCTGGT AGCTCGCTTA CCTCTCATCT    15026
                                                                  
.......... .......... .......... .......... .......... ..........      304


CTGGTGAAAA TTGCGCTAGT AGCTTCTGCA GATCCATGTG CTCCAATAAT AGGTCGAACA    14966
                                                                  
.......... .......... .......... .......... .......... ..........      304


CATTCAGCAG ATACTCCATC CCAAATGCGC AGAGAACCAT CTTTAGAAGC AGTCACATAC    14906
                                                                  
.......... .......... .......... .......... .......... ..........      304


AAGCTCCCAG TACAGGAGTA GCGTACCTGG CAGCAACATC AGTAAGCATG GCTGGCGGAG    14846
                                                                  
.......... .......... .......... .......... .......... ..........      304


AACTTTGATG AGAATATAAC CAATGCAATC TAATGCTTGT GAATCAGAAG GAAAGAGAAA    14786
                                                                  
.......... .......... .......... .......... .......... ..........      304


AGCTACCTGG TTAATGGGAG AACTAGAATC CTGTGCATTT GCTGATAAGT AGCATGTAAA    14726
                                                                  
.......... .......... .......... .......... .......... ..........      304


AGTATTTATA TCATATAAAT GAGCAACTGG GTGATCAGTC CCTGCAAATA ATTTTATCAG    14666
                                                                  
.......... .......... .......... .......... .......... ..........      304


TGTCACTTGC TTCCAAATAT ATGAAAATGA GTTTTTTTAA AAAAAATACA TATTTGAATG    14606
                                                                  
.......... .......... .......... .......... .......... ..........      304


TTAATATTTG ACTATATGTA AGAAGAAAAT TCCATACGAT ATGCTTGCAG TATTTTTCAA    14546
                                                                  
.......... .......... .......... .......... .......... ..........      304


ATGCCCACGA GACAGAAACT GTTGATCCAG GAACGAAATC CAAATTCTTA AGCCCAAATA    14486
                                                                  
.......... .......... .......... .......... .......... ..........      304


TCAAATTGTT TTGGTGAAAT GATTAAATTA CTTTACAGAT AACAACTGAA AACATGTTAA    14426
                                                          || |  | 
.......... .......... .......... .......... .......... ...ATCTCTA      311


CAACTTATAA TGCATAAAAA TCAGAGCATA TCAAACTGAT ATCAGACATC AAGAATCAGT    14366
|||   || | |||                                                    
CAAGAAATGA TGC....... .......... .......... .......... ..........      324


TAATCACAGC AGAACTAGAA ATCAAATTTA AATTTAGTGA AAAGATCATA GTACCTGCTA    14306
                                                                  
.......... .......... .......... .......... .......... ..........      324


AAAGGTAATC CCCACAAGGA TGAAAACATA CAGATCTAAC ATTATGAGTA TCCTGCCAAG    14246
                                                                  
.......... .......... .......... .......... .......... ..........      324


CATTAACAAA TGAGCCTGGT TAAATGCAAT GAACACACCA TTTTACATGA TATATAGAGA    14186
                                                              ||  
.......... .......... .......... .......... .......... .......AGC      327


GATTGG-ATT GCTAGAATTT ACAACCTGAA TAACT    14152
  |||| | | |||| || ||  |  | |||| |  ||
ATTTGGCAGT GCTA-AA-TT -CGGCTTGAA TCCCT      359





********************************************************************************
EST sequence  121 +strand (File: 25805794+)

     1  TTTTTTTTTT TTTTTTTTTT TCTTCGATTA ACGGTAATTT CTAGACCTTG GGAGCGAACG
    61  TGGTAGCTCC TTTTTCTATT ACTTTATTAA GGTAATAAAT TGATACCTAT GAGTATTCAA
   121  GTGTCAAGAA CATTGGCTGA TGGAATGATT GATATAGTCA TTTGGTCACC ATTATCAAAC
   181  AGTAAAGCAA TGTAAGGTGT AAGCATAACT CACTGCACTA ACTGAAGGCC TATTTAGATC
   241  TCACCTCGAA ATTTTACACC CTATCACATC GAGCGTTTGA ACACATGCAT AAAGTATTAA
   301  ATATAGGCTA AAACTAATTG CACATATTGC GACTATTTTA CGAGACGAAT TTTTTAAGCC
   361  TAATTGCTCC ATGATTTGAT AATGTGGTGC TACAGTAAAC ATTTGCTAAT GATGGATTAA
   421  TTGGGCTTAA TAAATTTGTC TCACGGTTTA CTTACGGATT CTGTAATTAT TTTTTTATTA
   481  GGGCCCGAAC ACCCACATGC GATACCCTAT AATATCCGAT GTGACACAGT AAAACTTTAC
   541  ACCCCCCCTT GTCTCGTCCT CTGGCTACCT A

Predicted gene structure (within gDNA segment 18861 to 16004):

 Exon  1  18861  18858 (   4 n);  cDNA    220    223 (   4 n); score: 0.750
  Intron  1  18857  16846 (2012 n); Pd: 0.904 (s:    0), Pa: 0.000 (s: 0.73)
 Exon  2  16845  16586 ( 260 n);  cDNA    224    480 ( 257 n); score: 0.715
 PPA                              cDNA     24      1

MATCH	21326110-	25805794+	0.715	264	0.462	C
PGS_21326110-_25805794+	(18861  18858,16845  16586)

Alignment (genomic DNA sequence = upper lines):

ATCTGTAAGT TGAGAATCGC ATTTGCATCA AGCCCATGTT AAATGACTCA AGAAGTAGAG    18802
| ||                                                              
AACT...... .......... .......... .......... .......... ..........      223


AAATCTCCCA ATGATAGTTA TTTCTTAATG TTAATAAAAT GGATACTATC AGGCTATTTG    18742
                                                                  
.......... .......... .......... .......... .......... ..........      223


ATTGTACCCA TAGGTAGTCC TCTCCTTGGT AGCTTCCAAA GTAGCGGACA ACATTTGGAT    18682
                                                                  
.......... .......... .......... .......... .......... ..........      223


GGCTACACTG CTGCAGCATC TCAATTTCTC CCCGTATGTC TTCATATCCT TCTTCCTGAA    18622
                                                                  
.......... .......... .......... .......... .......... ..........      223


AACCAAAGAT ACATACTTAT ATTTTGGAAA AATGCAACGA CTCGGAAAAC AGACAGCAAC    18562
                                                                  
.......... .......... .......... .......... .......... ..........      223


CACATTTATG AGATTCTCTC ACAATTGAGC CCATGCAAAC AAAATGCTCA CAACAAAAGC    18502
                                                                  
.......... .......... .......... .......... .......... ..........      223


AATATGGTTG CCAAATATGA AATATGTCTC GGGTGGCCTT TCAGAATATT CACAGAACTT    18442
                                                                  
.......... .......... .......... .......... .......... ..........      223


TGTAATAGAA AATTAGAAAC TAACCCCTTC TGTTAGTGAG ATAATCTTGA CAGCCACAAG    18382
                                                                  
.......... .......... .......... .......... .......... ..........      223


CTCCTGCGTT CTGAGATCCC TTGCTTTGTA CACTGCACCA TATGAGCCTT TCCCTGCATT    18322
                                                                  
.......... .......... .......... .......... .......... ..........      223


CCCAATTGAA TTTTGCATTT CGCAAAACAG CTCAAAGCTT CAGCCATTCT ACAAGTAGAC    18262
                                                                  
.......... .......... .......... .......... .......... ..........      223


ATACAGAACT AATGAAACAA TAATTCCAGA GCAAGAGGCG CACCAAGCTC ATGGAGCAGC    18202
                                                                  
.......... .......... .......... .......... .......... ..........      223


TCGTACTTGG TGGAAGGATC CTCTCTGGTA ACACTGTCTG GCGCCGAGCT CACTGATGGC    18142
                                                                  
.......... .......... .......... .......... .......... ..........      223


TTCCGCCTTG AATGCTGCTG CTGTTGTTGC TGCATCAGAG GCGACGGTTG CCGGAGCTCC    18082
                                                                  
.......... .......... .......... .......... .......... ..........      223


TCTGTCTGCT CCACCGCTGG ACTCCAGAAA GAGGACCCGA AACCCCCGCC GCCGCCAGAA    18022
                                                                  
.......... .......... .......... .......... .......... ..........      223


GCAGATTCAT AGGAACTGGA ACCCCCGCTG GTGTGGCGAA TGAAGGTGCC AGAGAACGAC    17962
                                                                  
.......... .......... .......... .......... .......... ..........      223


CCGCGGGGGC TCGACGGGCT CCCTGGTCGG CGGATGAATG TGCCGGAGAC CGAGTCCCGG    17902
                                                                  
.......... .......... .......... .......... .......... ..........      223


GGGCTCGACG GGGTGCTAGT CCGGCGGATG AATGTGCCAG AGACGGATTC GTGAGGGCTG    17842
                                                                  
.......... .......... .......... .......... .......... ..........      223


GACGAGCCCC CGGAGCGACG GATGAATGTG CCTGAGGCGG ACCCTCGAGG GCTGGAGGAG    17782
                                                                  
.......... .......... .......... .......... .......... ..........      223


GTCCCCCCCG AGCGTGCGGT GGAGTGGACG ACGAAGGTAG AGTATGGGTC GTCATCGGTA    17722
                                                                  
.......... .......... .......... .......... .......... ..........      223


GCGCGGGGGC TGGAGCGCCG CAGATCCAGG AACGGAGATC GAGCGGAGGC CGGGGCGCCG    17662
                                                                  
.......... .......... .......... .......... .......... ..........      223


CTCTTGAAGA CCACCGTAGC GGAGAGGGAA GCATCGTCGG GGTCGGAGGA GTAGGCGTCC    17602
                                                                  
.......... .......... .......... .......... .......... ..........      223


TCGTCTTCGT CAAAGGAGGG GCCGCCGAAG TCCTTGGGGA GCCGCTGGAG AAGCGGAGGC    17542
                                                                  
.......... .......... .......... .......... .......... ..........      223


AGCGAGGAGG GGTCTTCCTC CTCGTCTTCC TCCGCCCGCG TGGACGGGCC CCTGCCGCGC    17482
                                                                  
.......... .......... .......... .......... .......... ..........      223


CTGCTGCCGC GGGCGTCGTC CTCGTCGTCA TCGCCGTGGA CGACGAAGGT TGAGTAGACG    17422
                                                                  
.......... .......... .......... .......... .......... ..........      223


TCGTTTCTCT TGGGACGCGA CCACGGCGAG CGCGGGGAGA AAGCCATGGC GTGCCACGCG    17362
                                                                  
.......... .......... .......... .......... .......... ..........      223


AGGTGGGAGG AGACGGTGAA GGTGCTCGTC GGGAATGGCA AATGGGGAAA ATTGTTTAGT    17302
                                                                  
.......... .......... .......... .......... .......... ..........      223


TGGAGCCAGT TCACTCGAAT CTGGCAAATA TGGGTCGGGC TCGGATGGGC CATCCCATTC    17242
                                                                  
.......... .......... .......... .......... .......... ..........      223


TAGGCCCACG TGACATAGAG AATCCGGTCA AATTCTTCCT TCCCGCAGTC CCGCTAGGCC    17182
                                                                  
.......... .......... .......... .......... .......... ..........      223


CACACGACCA CACCCAGTCA CCCGCAGCCA CAGGCCGCAG AGAGCTTCCT CGAAAGGAGC    17122
                                                                  
.......... .......... .......... .......... .......... ..........      223


TTCTCTTTTT TCTCCACTCA CCCCAAAAAC CAAAAACTTT TCAAAATTTC TCAACACATC    17062
                                                                  
.......... .......... .......... .......... .......... ..........      223


AAATATTACG ACACATGCAT GAAGCATTAA ATATATACAA AAATAAAAAC TAATTGCACA    17002
                                                                  
.......... .......... .......... .......... .......... ..........      223


GTTTACCTAT AAATCGCGAG ATAAATCTTT TAAACCTAGT TACTCTATGA TTAGACAATA    16942
                                                                  
.......... .......... .......... .......... .......... ..........      223


TTTGTCAAAT AAAAACGAAA GTGCTACAGT CTCAAAAACC AAAAAGTTTT CGAAACTAAA    16882
                                                                  
.......... .......... .......... .......... .......... ..........      223


CAAGGCCTGA CACTTGCACA TCTTTTTTAA AAAATATAAG GCCCTGTTTA GTTCCCACCT    16822
                                        ||| | ||| |||| | || ||||| 
.......... .......... .......... ......GAAG G-CCTATTTA GATCTCACCT      246


AAAAAATTTT CATCC-ATCA CATTGAATCT TTAGACACAT ACATAAAACA TTAAATGTAG    16763
  ||| |||  || || |||| ||| ||   | ||  ||||||  ||||||  | |||||| ||| 
CGAAATTTTA CACCCTATCA CATCGAGCGT TTGAACACAT GCATAAAGTA TTAAATATAG      306


ATAAAAAATA ATTACACAGT TTGGTTGAAA ATCGCGAGAT GAATTTTTTA AGCCTAGTTA    16703
   |||| || ||| ||||   |||     |   |  |||||  |||||||||| |||||| ||  
GCTAAAACTA ATTGCACATA TTGCGACTAT TTTACGAGAC GAATTTTTTA AGCCTAATTG      366


GTCCATGA-T T-AGCCTTAA GTGCTACAGT AACCCACATG TGCTAATAAT AGATTAATTA    16645
 ||||||| | | |   |    |||||||||| ||   ||||  ||||||| ||  ||||||||  
CTCCATGATT TGATAATGTG GTGCTACAGT AA---ACATT TGCTAATGAT GGATTAATTG      423


TACTTAATAG ATTCGTCTTG CAGTTTCCTG ACGAGTTATG TAATTTGTTT TTTTTATTA    16586
  |||||||  ||| ||||   | |||| ||  |||  || || ||| ||  || |||||||||
GGCTTAATAA ATTTGTCTCA CGGTTTACTT ACGGATTCTG TAA-TT-ATT TTTTTATTA      480





********************************************************************************
EST sequence  114 +strand (File: 18388584+)

     1  CCCGGTGATG TGAACGCTGG NCATCCGGAG GACCGCGAGT TGGAGGAGCC GAGGTGTTCG
    61  ACCCCGACAC GGTTCGAGGC GAACGGTGGA GTTCACGCGG CACTTCGAGC TCCTGCCGTT
   121  CGGTCGGGCG GCGGATCTGC CCCGGCATCG CCATGCCGCC GCCAACGTGG AGTTCACGCT
   181  GGCCAACCTG CTGCACTGCT TCGACTGGGC GCTGCCGGTG GGGATGGCGC CGGAGGAGCT
   241  GAGCATGGAG GAGTCCGGCG GCCTCGGGCT CCACAGGAAG GCGCCCCTCG TGCTCGTGCC
   301  CNCTAGATAC ATACAACTAT AGGAGTACCA ATTAAATGGA ATTTAGCTAG TAGCCAAGCC
   361  GCGACTTCGG CCTTGTTTAG TTCCTAAATT ATTTTTTTTC CNAAAACGTC ACCTCCNATC
   421  TTTAGATATA TATATAAAAT ATTANACTAT ATATAAAATA AAAAATTAAT TGCACAGTTT
   481  GTATGAAAAT CACGAGACGA ATCTTTTGAA CCTAACTAGT CCATGATTAG CCATAAGTGT
   541  TACAGTAACC CATATGTACT AATGATGGAT TAATTATGCT TAATAATTTC ATCTCGCGGT
   601  TCTTCAGGCG AGTTATGAAA TTAGTTTTCA AAAAAAAAAA A

Predicted gene structure (within gDNA segment 19641 to 15919):

 Exon  1  17066  17001 (  66 n);  cDNA    411    477 (  67 n); score: 0.697
  Intron  1  17000  16744 ( 257 n); Pd: 0.000 (s: 0.73), Pa: 0.088 (s: 0.82)
 Exon  2  16743  16597 ( 147 n);  cDNA    478    625 ( 148 n); score: 0.810
  Intron  2  16596  16254 ( 343 n); Pd: 0.000 (s: 0.73), Pa: 0.071 (s:    0)
 Exon  3  16253  16238 (  16 n);  cDNA    626    641 (  16 n); score: 0.875

MATCH	21326110-	18388584+	0.775	229	0.357	C
PGS_21326110-_18388584+	(17066  17001,16743  16597,16253  16238)

Alignment (genomic DNA sequence = upper lines):

ACATCAAATA TTACGACACA TGCATGAAGC ATTAAA-TAT ATACAAAAAT AAAAACTAAT    17008
|| ||  ||  ||  || | | |  || ||   |||| | ||| ||| ||||   ||||| |||| 
ACCTCCNATC TTTAGATATA TATATAAAAT ATTANACTAT ATATAAAATA AAAAATTAAT      470


TGCACAGTTT ACCTATAAAT CGCGAGATAA ATCTTTTAAA CCTAGTTACT CTATGATTAG    16948
|||||||                                                           
TGCACAG... .......... .......... .......... .......... ..........      477


ACAATATTTG TCAAATAAAA ACGAAAGTGC TACAGTCTCA AAAACCAAAA AGTTTTCGAA    16888
                                                                  
.......... .......... .......... .......... .......... ..........      477


ACTAAACAAG GCCTGACACT TGCACATCTT TTTTAAAAAA TATAAGGCCC TGTTTAGTTC    16828
                                                                  
.......... .......... .......... .......... .......... ..........      477


CCACCTAAAA AATTTTCATC CATCACATTG AATCTTTAGA CACATACATA AAACATTAAA    16768
                                                                  
.......... .......... .......... .......... .......... ..........      477


TGTAGATAAA AAATAATTAC ACAGTTTGGT TGAAAATCGC GAGATGAATT TTTTAAGCCT    16708
                          ||||   |||||||| | |||| ||||  |||| | ||| 
.......... .......... ....TTTGTA TGAAAATCAC GAGACGAATC TTTTGAACCT      513


AGTTAGTCCA TGATTAGCCT TAAGTGCTAC AGTAACCCAC ATGTGCTAAT AATAGATTAA    16648
|  ||||||| |||||||||  |||||| ||| |||||||||  |||| |||||  || |||||| 
AACTAGTCCA TGATTAGCCA TAAGTGTTAC AGTAACCCAT ATGTACTAAT GATGGATTAA      573


TTATACTTAA TAGATTCGTC TTGCAGTT-T CCTGACGAGT TATGTAATTT GTTTTTTTTA    16589
|||| ||||| ||  ||| || | || ||| |  | | ||||| |||| ||||  ||         
TTATGCTTAA TAATTTCATC TCGCGGTTCT TCAGGCGAGT TATGAAATTA GT........      625


TTAGTTTTTA AAAACCCCTC CCGACATCCT TCCGACATAT CCGATGTGAC CTAAAAAATT    16529
                                                                  
.......... .......... .......... .......... .......... ..........      625


TTCATCTTCA ATCTAAACAT GCCCTAAGTG AAATGCAATA ATGTGTTGTA GAACTTTTAT    16469
                                                                  
.......... .......... .......... .......... .......... ..........      625


AGGCTATCAC ACATGTGGTA GGGCGAGACC ATCATTACAT TCGAAGAAGA AATATATTCC    16409
                                                                  
.......... .......... .......... .......... .......... ..........      625


GCAATCCACA ATTGGGATAA AATAGCAAAT CATCGAAAAG GGCCTGACCA ATAAGAATCA    16349
                                                                  
.......... .......... .......... .......... .......... ..........      625


GGTCAAGGGT TCATACAACT GTCATCAGCT ATGCAGAGCC AAAAAAAAAA CATATCATTG    16289
                                                                  
.......... .......... .......... .......... .......... ..........      625


GGGTTTGCTA TTAGATCAAT CAATTGCTTA TGCAGTTTCC AATAAAAAAA A    16238
                                      ||||  || ||||||| |
.......... .......... .......... .....TTTCA AAAAAAAAAA A      641





********************************************************************************
EST sequence   41 -strand (File: 6674009-)

     1  GGCACAGAAT AGTTCAATAA TTTGCCTTCA TCTCAAGACT CCAGGCTTAC GAACATCCCA
    61  CTTACATCTC CATCACGGGT ACATGCACAC ACAGCGCCTC CGCCCAATTA CAGTTTGGAT
   121  CTTATTAAAT TATTATATAG ACTCATACTA ACCTGATTAC TACTAGTGAT TATGTAGAGC
   181  CTAGACTAGA GGCGCCTTGT TGTTCAAAGG AAATTATTAT TCTTAGGCCC TGTTTAGTTC
   241  CCCACCAAAA ATTTTTTCAT CCATCCCATC GAATCTTTGG ACACATGCAT GGAACATTAA
   301  ATGTAGATAA AAAAATAAAC TAATTACACA GTTTAGTTGA GAATCGCGAG ACGAATCTTT
   361  TAAGCCTAGT TACTCCATGA TTAGCCTTAA GTGCTACAGT AACCCACATA TGCTAATGAC
   421  AGATTAATTA TGCTTAATAA ATTTGTCTTG CA

Predicted gene structure (within gDNA segment 18268 to 16151):

 Exon  1  16843  16623 ( 221 n);  cDNA    225    452 ( 228 n); score: 0.846

MATCH	21326110-	6674009-	0.846	221	0.489	C
PGS_21326110-_6674009-	(16843  16623)

Alignment (genomic DNA sequence = upper lines):

AGGCCCTGTT TAGTTCC-CA CCTAAAAAAT TTTCATCCAT CACATTGAAT CTTTAGACAC    16785
|||||||||| ||||||| || || ||||  | |||||||||| | ||| |||| |||| ||||| 
AGGCCCTGTT TAGTTCCCCA CCAAAAATTT TTTCATCCAT CCCATCGAAT CTTTGGACAC      284


ATACATAAAA CATTAAATGT AGAT----AA A-AAA-TAAT TACACAGTTT GGTTGAAAAT    16731
|| |||  || |||||||||| ||||    || | ||| |||| ||||||||||  ||||| ||| 
ATGCATGGAA CATTAAATGT AGATAAAAAA ATAAACTAAT TACACAGTTT AGTTGAGAAT      344


CGCGAGATGA ATTTTTTAAG CCTAGTTAGT CCATGATTAG CCTTAAGTGC TACAGTAACC    16671
||||||| || || ||||||| |||||||| | |||||||||| |||||||||| |||||||||| 
CGCGAGACGA ATCTTTTAAG CCTAGTTACT CCATGATTAG CCTTAAGTGC TACAGTAACC      404


CACATGTGCT AATAATAGAT TAATTATACT TAATAGATTC GTCTTGCA    16623
||||| |||| ||| | |||| ||||||| || ||||| |||  ||||||||
CACATATGCT AATGACAGAT TAATTATGCT TAATAAATTT GTCTTGCA      452





********************************************************************************
EST sequence  131 +strand (File: 12775389+)

     1  GCTGTCTGGA CTTAGGCTTT GTTTACTTCC ACCCCAAAAC CTAAATTTTT TCAAGATTCC
    61  CAGTCACATC GAATCTTTAG ACGCATACAT GGAGTATTAA ATATAGATGA AAATAAAAAC
   121  TAATTGCACA GTTTAGTCGA AATGTACGAG ACAAATCTTT TGAGCCTAGT TAGTCCATAG
   181  TTGGACAATA ATTACCATAA ACAAACGAAA GTGCTACAGT GTCACGAAAA TTTTCTCTTC
   241  ACCAACTAAA CACGGCCTTA GCTTGTCAGT TGTTAGTGTA AATTTACGTC TACCTTTAGT
   301  TGAGAGCTCT TATGCAAATG GTTGGATGGT AAAAGAAATG TCGTCACACA GCATTGTTGA
   361  TTAGCTTACA GATTTCTGGG GAGCTGACAC CTGGTGTTCC TTTCTTATCT GGTAATGATA
   421  AATTGATAAC TATACAACAT ACAGTTCACT TGTTTTTTTT GGGTTTCTTT GTCTTTTCTT
   481  TCCTTATTAT CTTCATACTG GAATCCACAT TCCTACTAAC TAATAATTGA ACTTCAAGGT
   541  TTCATGGCAC AAGTCTTCTA AAATTGCAGA TCTCCTAGAA GGGATAGTCA ACTGAAATGC
   601  CCTAGTATTT TAAGTCTGAA CTTTTGCAAA CAAATT

Predicted gene structure (within gDNA segment 17867 to 14290):

 Exon  1  17100  16825 ( 276 n);  cDNA     32    305 ( 274 n); score: 0.703
  Intron  1  16824  16467 ( 358 n); Pd: 0.000 (s: 0.54), Pa: 0.878 (s:    0)
 Exon  2  16466  16447 (  20 n);  cDNA    306    325 (  20 n); score: 0.650
  Intron  2  16446  14799 (1648 n); Pd: 0.000 (s:    0), Pa: 0.704 (s:    0)
 Exon  3  14798  14785 (  14 n);  cDNA    326    339 (  14 n); score: 0.714

MATCH	21326110-	12775389+	0.703	310	0.487	C
PGS_21326110-_12775389+	(17100  16825,16466  16447,14798  14785)

Alignment (genomic DNA sequence = upper lines):

CCCAAAAACC AAAAACTTTT CAAAATTTCT CAACACATCA AATATTACGA CACATGCATG    17041
||| ||||||  |||  |||| ||| ||| |     ||||||  ||| ||  || | ||| |||| 
CCCCAAAACC TAAATTTTTT CAAGATTCCC AGTCACATCG AATCTTTAGA CGCATACATG       91


AAGCATTAAA TATATACAAA AATAAAAACT AATTGCACAG TTTACCTATA AATCG-CGAG    16982
 || |||||| |||| |  || |||||||||| |||||||||| ||||  |  | |||   |||| 
GAGTATTAAA TATAGATGAA AATAAAAACT AATTGCACAG TTTA-GTCGA AATGTACGAG      150


ATAAATCTTT TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA    16922
| |||||||| | | |||||| || || ||   || |||||||  ||  || |  | |||||||| 
ACAAATCTTT TGAGCCTAGT TAGTCCATAG TTGGACAATA ATTACCATAA ACAAACGAAA      210


GTGCTACAGT CTCAAAAACC AAAAAGTTTT C-GAAACTAA ACAAGGCCTG ACACTTGCAC    16863
||||||||||  |||  ||   |     | || |   |||||| ||| |||||  |  ||||  | 
GTGCTACAGT GTCACGAA-A ATTTTCTCTT CACCAACTAA ACACGGCCTT A-GCTTG-TC      267


ATCTTTTTTA AAAAATATAA GGCCCTGTTT AGTTCCCACC TAAAAAATTT TCATCCATCA    16803
|  | ||      |||| ||  | |    ||| ||||   |                         
AGTTGTTAGT GTAAATTTAC GTCTACCTTT AGTTGAGA.. .......... ..........      305


CATTGAATCT TTAGACACAT ACATAAAACA TTAAATGTAG ATAAAAAATA ATTACACAGT    16743
                                                                  
.......... .......... .......... .......... .......... ..........      305


TTGGTTGAAA ATCGCGAGAT GAATTTTTTA AGCCTAGTTA GTCCATGATT AGCCTTAAGT    16683
                                                                  
.......... .......... .......... .......... .......... ..........      305


GCTACAGTAA CCCACATGTG CTAATAATAG ATTAATTATA CTTAATAGAT TCGTCTTGCA    16623
                                                                  
.......... .......... .......... .......... .......... ..........      305


GTTTCCTGAC GAGTTATGTA ATTTGTTTTT TTTATTAGTT TTTAAAAACC CCTCCCGACA    16563
                                                                  
.......... .......... .......... .......... .......... ..........      305


TCCTTCCGAC ATATCCGATG TGACCTAAAA AATTTTCATC TTCAATCTAA ACATGCCCTA    16503
                                                                  
.......... .......... .......... .......... .......... ..........      305


AGTGAAATGC AATAATGTGT TGTAGAACTT TTATAGGCTA TCACACATGT GGTAGGGCGA    16443
                                       |||  | |  ||  | ||| ||     
.......... .......... .......... ......GCTC TTATGCAAAT GGTTGG....      325


GACCATCATT ACATTCGAAG AAGAAATATA TTCCGCAATC CACAATTGGG ATAAAATAGC    16383
                                                                  
.......... .......... .......... .......... .......... ..........      325


AAATCATCGA AAAGGGCCTG ACCAATAAGA ATCAGGTCAA GGGTTCATAC AACTGTCATC    16323
                                                                  
.......... .......... .......... .......... .......... ..........      325


AGCTATGCAG AGCCAAAAAA AAAACATATC ATTGGGGTTT GCTATTAGAT CAATCAATTG    16263
                                                                  
.......... .......... .......... .......... .......... ..........      325


CTTATGCAGT TTCCAATAAA AAAAATGCTT ATGCAAATTT CTCCCATATA CAACTAAAGT    16203
                                                                  
.......... .......... .......... .......... .......... ..........      325


TACATGAGCA CATTCCTCCT GAAACGTAAT ACTGAAAGCA TACTTTTGAT TTGAATGGTT    16143
                                                                  
.......... .......... .......... .......... .......... ..........      325


GAATCTACAA GCTATACGGT TTGTTTCCAG AATCTGATCG ATCTATCATT TCCACAAATA    16083
                                                                  
.......... .......... .......... .......... .......... ..........      325


ACAAAAACTG GTTCAACTGG GGAGTGGTCG AGCCATCTGG GAGCACCAGT GCTGCCAGAG    16023
                                                                  
.......... .......... .......... .......... .......... ..........      325


GGCAATCTTG CAACCTTTTC TGCAGTAAGT GCATCCCAGA CGACAACCTG AAGAGTGACG    15963
                                                                  
.......... .......... .......... .......... .......... ..........      325


TATCATAGTT AAGCTTGCTG AAATACAAAT ATATATACTG TTCTCAATTT GGAATTTACC    15903
                                                                  
.......... .......... .......... .......... .......... ..........      325


TCATTGTTTT GTTCATCAAC TGATAGAACA AATTCTTCGG TTTCATTGAA GACAGCCTGG    15843
                                                                  
.......... .......... .......... .......... .......... ..........      325


ATAGTAAGAA CAGTTATTAT CATATTTATT GTCTATCATA GCAAGGTTAG GTATGTTGTT    15783
                                                                  
.......... .......... .......... .......... .......... ..........      325


ATCCTAAGCT GCAAGCTCAA ACCAGCCTAT TTTCAAATTA AAGAATTGCA ATATTTTGTT    15723
                                                                  
.......... .......... .......... .......... .......... ..........      325


TCCTAAAATT TTGGGTAAAA ATAATATATA TGGCACACGA GTAAATTTAA ATCAGGAAAA    15663
                                                                  
.......... .......... .......... .......... .......... ..........      325


AATAATAATC TTATAGAAAC ACAGAGAAAC TAACCTGACA ACGAAATTGT CTGCGAATGG    15603
                                                                  
.......... .......... .......... .......... .......... ..........      325


CTCCTGCATA TTGCTTCACA AGTCGTCCAG TGCCAACTTC CCATAACTTG ACACAAGAAT    15543
                                                                  
.......... .......... .......... .......... .......... ..........      325


CTTTCCCACA AGATAGGACA TACCTGAAAG AACGTAGTAA ACTTCATAAC AGATAACCAG    15483
                                                                  
.......... .......... .......... .......... .......... ..........      325


AATACAGTGT GCAGTTTTAT GAAAGAAATC CATGAACTAT CTAAGCATAT ACTTCGGGTA    15423
                                                                  
.......... .......... .......... .......... .......... ..........      325


GTCAAAGTTC ACTACATCAA TTTTTTAGAT CAATCTTATA TGCAAGTGCA TTCACGCTGC    15363
                                                                  
.......... .......... .......... .......... .......... ..........      325


ATATAACCAC ATAAACACTA GGCCTTTCAG AAGAAGTCTA AAAAGTGTTT ATAGGCAAGT    15303
                                                                  
.......... .......... .......... .......... .......... ..........      325


TAGTTGTTTA GTGGTGAAAT AGTAGGGTAA AGGAGAAAGA GTTATTCGTG TTATAAAGTT    15243
                                                                  
.......... .......... .......... .......... .......... ..........      325


ACGACACGTC TGAAACACAG GAAATTATCC AGGACATGTT ATAAATCATT CAGAATCACT    15183
                                                                  
.......... .......... .......... .......... .......... ..........      325


ACAAGATTCC CACATTCCAA ACAGGGTTTG AAGTAGTTAC TGTCTTGAAT CATACAGCAT    15123
                                                                  
.......... .......... .......... .......... .......... ..........      325


ATGCCTTTCT CTCTGTTCTT CAAACCAAAC AATGACTGGA TTTTATCTTG AGGGAAGAGC    15063
                                                                  
.......... .......... .......... .......... .......... ..........      325


ACCTTAGACA TGCTGGTAGC TCGCTTACCT CTCATCTCTG GTGAAAATTG CGCTAGTAGC    15003
                                                                  
.......... .......... .......... .......... .......... ..........      325


TTCTGCAGAT CCATGTGCTC CAATAATAGG TCGAACACAT TCAGCAGATA CTCCATCCCA    14943
                                                                  
.......... .......... .......... .......... .......... ..........      325


AATGCGCAGA GAACCATCTT TAGAAGCAGT CACATACAAG CTCCCAGTAC AGGAGTAGCG    14883
                                                                  
.......... .......... .......... .......... .......... ..........      325


TACCTGGCAG CAACATCAGT AAGCATGGCT GGCGGAGAAC TTTGATGAGA ATATAACCAA    14823
                                                                  
.......... .......... .......... .......... .......... ..........      325


TGCAATCTAA TGCTTGTGAA TCAGAAGGAA AGAGAAAA    14785
                          | || | | ||||| 
.......... .......... ....ATGGTA AAAGAAAT      339





********************************************************************************
EST sequence  130 +strand (File: 7219249+)

     1  GCATTAAATA TAGACGAAAA CAAAAACTAA TCATACAGTT TGACTGTAAA TCACGAGACG
    61  AATCTTTTGA CTCTAGTTAG TCTATAATTG GATAATATTT ACCACAAACA AACGAAAGTG
   121  CTACAGTTGC GAAAACTTTT CAGTTTTCGG AACTAAACAA GGCCTGATTC TGCCTTGTTC
   181  CTTTGGCCAA TGCTCACTGT TTATTTATAA TTTGTGCAGA TTCTTTCAAG GCGATCAACG
   241  ATGAAGGCAT GCCCATGTAC CAGAGGCCCT TCATGAAGGG CAAGCTGTAC ATCCACTTCT
   301  CGGTGGATTT CCCGGACTCG TTGAGCCTGG AGCAGTGCAA GGCGCTGGAG GCTGTGCTCC
   361  CACCCAAGCC GGTGTCGCAG TACACTGACA TGGAGCTGGA CGAGTGCGAG GAGACGATGC
   421  CGTATGACGT GAACATCGAG GAGGAGATGC GGAGGCGGCA GCAGCAGCAC CAGGAGGCAT
   481  ACGACGAGGA CGAGGATATG CCGGGCGGTG CGCAGAGGGT GCAGTGCGCC CAGCAGTAGT
   541  TGCCTGCTAT CAGTAGTAGC AGTGATAATG TTTGACGGTG GCGGCAAATT TGTTGTTTCG
   601  CATTGTGCGA CTACTGTTGG GTCAAGTTTT CCCTCGCATT TAATGTCACA ACACTTCGGT
   661  TACAAAAATG CAGTATTCAT CAATCCGTTA GC

Predicted gene structure (within gDNA segment 17338 to 13942):

 Exon  1  17038  16830 ( 209 n);  cDNA      1    205 ( 205 n); score: 0.746
  Intron  1  16829  15877 ( 953 n); Pd: 0.000 (s: 0.60), Pa: 0.884 (s:    0)
 Exon  2  15876  15840 (  37 n);  cDNA    206    243 (  38 n); score: 0.541

MATCH	21326110-	7219249+	0.746	246	0.355	C
PGS_21326110-_7219249+	(17038  16830,15876  15840)

Alignment (genomic DNA sequence = upper lines):

GCATTAAATA TATACAAAAA TAAAAACTAA TTGCACAGTT TACCTATAAA TCGCGAGATA    16979
|||||||||| || || ||||  ||||||||| |   |||||| |  || |||| || |||||   
GCATTAAATA TAGACGAAAA CAAAAACTAA TCATACAGTT TGACTGTAAA TCACGAGACG       60


AATCTTTTAA ACCTAGTTAC TCTATGATTA GACAATATTT GTCAAATAAA AACGAAAGTG    16919
|||||||| |   |||||||  ||||| |||  || |||||||   || | | | |||||||||| 
AATCTTTTGA CTCTAGTTAG TCTATAATTG GATAATATTT ACCACAAACA AACGAAAGTG      120


CTACAGTCTC AAAAACCAAA AAGTTTTCGA AACTAAACAA GGCCTGACAC TTGCACATCT    16859
|||||||  |  |||||      ||||||||  |||||||||| |||||||  |  ||| | | | 
CTACAGTTGC GAAAACTTTT CAGTTTTCGG AACTAAACAA GGCCTGATTC -TGC-CTTGT      178


TTTTTAAAAA ATATAAGGCC CTGTTTAGTT CCCACCTAAA AAATTTTCAT CCATCACATT    16799
|  ||      | ||    |  ||||||| |                                   
TCCTTTGGCC A-AT-GCTCA CTGTTTATT. .......... .......... ..........      205


GAATCTTTAG ACACATACAT AAAACATTAA ATGTAGATAA AAAATAATTA CACAGTTTGG    16739
                                                                  
.......... .......... .......... .......... .......... ..........      205


TTGAAAATCG CGAGATGAAT TTTTTAAGCC TAGTTAGTCC ATGATTAGCC TTAAGTGCTA    16679
                                                                  
.......... .......... .......... .......... .......... ..........      205


CAGTAACCCA CATGTGCTAA TAATAGATTA ATTATACTTA ATAGATTCGT CTTGCAGTTT    16619
                                                                  
.......... .......... .......... .......... .......... ..........      205


CCTGACGAGT TATGTAATTT GTTTTTTTTA TTAGTTTTTA AAAACCCCTC CCGACATCCT    16559
                                                                  
.......... .......... .......... .......... .......... ..........      205


TCCGACATAT CCGATGTGAC CTAAAAAATT TTCATCTTCA ATCTAAACAT GCCCTAAGTG    16499
                                                                  
.......... .......... .......... .......... .......... ..........      205


AAATGCAATA ATGTGTTGTA GAACTTTTAT AGGCTATCAC ACATGTGGTA GGGCGAGACC    16439
                                                                  
.......... .......... .......... .......... .......... ..........      205


ATCATTACAT TCGAAGAAGA AATATATTCC GCAATCCACA ATTGGGATAA AATAGCAAAT    16379
                                                                  
.......... .......... .......... .......... .......... ..........      205


CATCGAAAAG GGCCTGACCA ATAAGAATCA GGTCAAGGGT TCATACAACT GTCATCAGCT    16319
                                                                  
.......... .......... .......... .......... .......... ..........      205


ATGCAGAGCC AAAAAAAAAA CATATCATTG GGGTTTGCTA TTAGATCAAT CAATTGCTTA    16259
                                                                  
.......... .......... .......... .......... .......... ..........      205


TGCAGTTTCC AATAAAAAAA ATGCTTATGC AAATTTCTCC CATATACAAC TAAAGTTACA    16199
                                                                  
.......... .......... .......... .......... .......... ..........      205


TGAGCACATT CCTCCTGAAA CGTAATACTG AAAGCATACT TTTGATTTGA ATGGTTGAAT    16139
                                                                  
.......... .......... .......... .......... .......... ..........      205


CTACAAGCTA TACGGTTTGT TTCCAGAATC TGATCGATCT ATCATTTCCA CAAATAACAA    16079
                                                                  
.......... .......... .......... .......... .......... ..........      205


AAACTGGTTC AACTGGGGAG TGGTCGAGCC ATCTGGGAGC ACCAGTGCTG CCAGAGGGCA    16019
                                                                  
.......... .......... .......... .......... .......... ..........      205


ATCTTGCAAC CTTTTCTGCA GTAAGTGCAT CCCAGACGAC AACCTGAAGA GTGACGTATC    15959
                                                                  
.......... .......... .......... .......... .......... ..........      205


ATAGTTAAGC TTGCTGAAAT ACAAATATAT ATACTGTTCT CAATTTGGAA TTTACCTCAT    15899
                                                                  
.......... .......... .......... .......... .......... ..........      205


TGTTTTGTTC ATCAACTGAT AGAACAAATT CTTCGGTTTC ATTGAAGAC- AGCCTGGATA    15840
                         | || ||  | | | |||  || ||| |  | |   |||  
.......... .......... ..TATAATTT GTGCAGATTC TTTCAAGGCG ATCAACGATG      243





********************************************************************************
EST sequence   87 -strand (File: 11678487-)

     1  TGGGAAATTT AGCAAGTTGA GATAAGGAGT TGTTGGAGGA GGATTTTTAT GCTTNTAGCA
    61  AATTTGGTAG GATAGCATGT TGAAATACCA AGTTGTTGGA GATGCTCTAA GGCATTGTTT
   121  AGTTCCCCAG AAAATTTTGC AAAATTTTTC AGATTCTCTG TCACATCAAA TCTTTAGACG
   181  CATGCATGAA GTATTAAATA TATATGAAAA TAAAAACTAA TTGCACAATT TGGTCGGAAT
   241  TGACGAGACG AATCTTTTGA GTCTAATTAG TATATGATTG GATAATATTT GTCAAATACA
   301  AATGAAAGTG GTACTATTGT TATTTTGTAA AATTTTTTGA AACTAAACAA GGCCTTAACT
   361  TGCCTGGCCC CAAAAAATAT AACAGAGGAT CTTATTAAGC ACCTCAGACC AGTAAAAAAA
   421  CATGTGTTGG CTGCTTTCAA TTAGTAGAAA TATCATATTA TTGGATTCAA TTTTAAACAG
   481  ACATCTTTCC CATGTAGTTG CAGGCTGCAT GAAATCTTCA TAGAAGGAAG CAAGGAAAGC
   541  GAATGAAGTA ACTCGAGGGA ACTATAGACC ACACAAGTTC AAGTCCACTA AATTAAGTTT
   601  TATTTTTGCC TCGTGC

Predicted gene structure (within gDNA segment 18357 to 15269):

 Exon  1  17091  16843 ( 249 n);  cDNA    140    382 ( 243 n); score: 0.747
  Intron  1  16842  16338 ( 505 n); Pd: 0.000 (s: 0.76), Pa: 0.000 (s: 0.62)
 Exon  2  16337  16287 (  51 n);  cDNA    383    431 (  49 n); score: 0.608

MATCH	21326110-	11678487-	0.723	300	0.487	C
PGS_21326110-_11678487-	(17091  16843,16337  16287)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
| |||| ||| ||| | | || |   |||||| |||| ||  | || ||||||| |||| ||||| 
C-AAAATTTT TCAGATTCTC TG-TCACATC AAATCTTTAG ACGCATGCAT GAAGTATTAA      197


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
|||||||  | |||||||||| ||||||||||  |||       || |  |||| |  ||||||| 
ATATATATGA AAATAAAAAC TAATTGCACA ATTTGGTCGG AATTGACGAG ACGAATCTTT      257


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTACAGT    16912
| |  ||| | || | ||||| || || |||| |||||||||| | ||| |||| ||| |||  | 
TGAGTCTAAT TAGTATATGA TTGGATAATA TTTGTCAAAT ACAAATGAAA GTGGTACTAT      317


CTCAAAAACC AAAAAGTTTT CGAAACTAAA CAAGGCCTGA CACTTGCACA TCTTTTTTAA    16852
    |       |||| ||||  ||||||||| |||||||| |  |||||| |  |       || 
TGTTATTTTG TAAAATTTTT TGAAACTAAA CAAGGCCTTA -ACTTGC-C- T-GGCCCCAA      373


AAAATATAAG GCCCTGTTTA GTTCCCACCT AAAAAATTTT CATCCATCAC ATTGAATCTT    16792
|||||||||                                                         
AAAATATAA. .......... .......... .......... .......... ..........      382


TAGACACATA CATAAAACAT TAAATGTAGA TAAAAAATAA TTACACAGTT TGGTTGAAAA    16732
                                                                  
.......... .......... .......... .......... .......... ..........      382


TCGCGAGATG AATTTTTTAA GCCTAGTTAG TCCATGATTA GCCTTAAGTG CTACAGTAAC    16672
                                                                  
.......... .......... .......... .......... .......... ..........      382


CCACATGTGC TAATAATAGA TTAATTATAC TTAATAGATT CGTCTTGCAG TTTCCTGACG    16612
                                                                  
.......... .......... .......... .......... .......... ..........      382


AGTTATGTAA TTTGTTTTTT TTATTAGTTT TTAAAAACCC CTCCCGACAT CCTTCCGACA    16552
                                                                  
.......... .......... .......... .......... .......... ..........      382


TATCCGATGT GACCTAAAAA ATTTTCATCT TCAATCTAAA CATGCCCTAA GTGAAATGCA    16492
                                                                  
.......... .......... .......... .......... .......... ..........      382


ATAATGTGTT GTAGAACTTT TATAGGCTAT CACACATGTG GTAGGGCGAG ACCATCATTA    16432
                                                                  
.......... .......... .......... .......... .......... ..........      382


CATTCGAAGA AGAAATATAT TCCGCAATCC ACAATTGGGA TAAAATAGCA AATCATCGAA    16372
                                                                  
.......... .......... .......... .......... .......... ..........      382


AAGGGCCTGA CCAATAAGAA TCAGGTCAAG GGTTCATACA ACTGTCATCA GCTATGCAGA    16312
                                     || |   |   |  | | ||    |||| 
.......... .......... .......... ....CAGAGG ATCTTATTAA GCACCTCAGA      408


GCCAAAAAAA AAACATATCA TTGGG    16287
 |||  |||| |||||| |   |||| 
-CCAGTAAAA AAACATGT-G TTGGC      431





********************************************************************************
EST sequence  142 +strand (File: 11680489+)

     1  GCACGAGGCT ATGATTGGAC AATAATCATG AGATGAATCT TTTAAGCCTA TTTAATCTAT
    61  GATTGGACAA TAATTGCTAA ATAAAAACGA AAGTGCTATA GTACAAAAAA CCAAAAAGTT
   121  TTCGGAACTA AACAAGGCCA TAGGGTTGCA TTGCCCAACT CCTTGCATGA AATTTGGGTT
   181  CTGATTTTTA CAAACTTTTC TTGAAATTGC AGGGAATCCT GTACTTAGGC ATTCACGCAG
   241  CTTGCCTGAA ACTGGTCGAG GAACAATCCA AAAGGTCTCA TCAATTACAG AGAAACTATC
   301  CCAGATGTCT GTGACCTCGA GAACACGAAG CACTGTGAAG CCTGCTGCCC CGGTGCTGAA
   361  GGCCGGACAT GGTAAGTCGG ACTTTCTTGG GAAGTCTGAC GATATCCCTC CAGCAAAGAG
   421  GCTGACAAGA AAATTGGTCA GCTAAATGAG GATATGTAGA GTGAAAATTC GATCAGCTGC
   481  AGGAGGGGAA T

Predicted gene structure (within gDNA segment 17625 to 14361):

 Exon  1  16981  16863 ( 119 n);  cDNA     33    151 ( 119 n); score: 0.840

MATCH	21326110-	11680489+	0.840	119	0.242	C
PGS_21326110-_11680489+	(16981  16863)

Alignment (genomic DNA sequence = upper lines):

ATAAATCTTT TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA    16922
|| ||||||| ||| |||| | || ||||||| || |||||||  |||  |||| |||||||||| 
ATGAATCTTT TAAGCCTATT TAATCTATGA TTGGACAATA ATTGCTAAAT AAAAACGAAA       92


GTGCTACAGT CTCAAAAACC AAAAAGTTTT CGAAACTAAA CAAGGCCTGA CACTTGCAC    16863
|||||| |||    ||||||| |||||||||| || ||||||| |||||||  |    ||||| 
GTGCTATAGT ACAAAAAACC AAAAAGTTTT CGGAACTAAA CAAGGCCATA GGGTTGCAT      151





********************************************************************************
EST sequence   43 -strand (File: 7553385-)

     1  CCACATCACG CAATTATTGA TTATTATTTC CTTGTAGTAG ACTAACTAAT AATGCATAAT
    61  ACGTAGTACG TACGTGCAGT GTACATGGAC CACACCACCA AGCAATGCAA CATTTGCAAG
   121  ATGCAAACCA TGCAAGAACC AACACGGCAG CGGATGATCC CCAAAGGGTT TTTTTCAACA
   181  AAAAAACACA CAAACCCGTG TACACTAATC TGACGACCTC CGGTGGCGCG TCTCGTAAGG
   241  TAAGGCCTTG TTTACTTCCT AGAAAATTTT GCAAAATTTT TCAGATTCCC CGTCACATCG
   301  AATCTTTAGA CGCATGCATG GAGTATTAAA TATAGACGAA AATAAAAACT AATTGCACAG
   361  TTTGGTCGAA ATTGACGAGA CGAATCTTTT GAGCCTAGTT ACTCCATGAT TAGACAATAT
   421  TTGTTAAATA AAAACGAAAA TGCTACAGTG TCCATTTCCC AAAATTTTTC GGAACTAAAC
   481  AAGGCCTAAA GCTAGAGAAA AGAAAACTGC CATGCCCGTG CACAGGCAGA TTGAGATCGA
   541  GAGACTTTGG TTACAGGGCC AGGATGGACC CGGCCCGGAC CTTGCCGCGC TCCCGTTCCC
   601  GTGGGCCTTC CGCTTCCGCT TCCCTGGCGG GCAGCGCCCC AT

Predicted gene structure (within gDNA segment 19017 to 15799):

 Exon  1  17091  16867 ( 225 n);  cDNA    272    494 ( 223 n); score: 0.804

MATCH	21326110-	7553385-	0.804	225	0.350	C
PGS_21326110-_7553385-	(17091  16867)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
| |||| ||| ||| | || |  |  ||||||  ||| ||  | || ||||||| | || ||||| 
C-AAAATTTT TCAGA-TTCC CCGTCACATC GAATCTTTAG ACGCATGCAT GGAGTATTAA      329


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCG-CGA GATAAATCTT    16973
||||| || | |||||||||| |||||||||| ||||   |   |||| | ||| ||  |||||| 
ATATAGACGA AAATAAAAAC TAATTGCACA GTTT-GGTCG AAATTGACGA GACGAATCTT      388


TTAAACCTAG TTACTCTATG ATTAGACAAT ATTTGTCAAA TAAAAACGAA AGTGCTACAG    16913
|| | ||||| |||||| ||| |||||||||| |||||| ||| |||||||||| | |||||||| 
TTGAGCCTAG TTACTCCATG ATTAGACAAT ATTTGTTAAA TAAAAACGAA AATGCTACAG      448


TCTCAAAAAC CAAAAAGTTT TCGAAACTAA ACAAGGCCTG ACACTT    16867
| || |   | | |||| ||| ||| |||||| |||||||||  |  || 
TGTCCATTTC CCAAAATTTT TCGGAACTAA ACAAGGCCTA AAGCTA      494





********************************************************************************
EST sequence   90 -strand (File: 13587489-)

     1  AATTTTCTGT CACATCGAAA TCTTGCGGCA TATGCATGAA ACATTAAATA TAGACGAAAA
    61  TAAAAACTAA TCACACAGTT TGACTGTAAA TCGCGAGACG AATCTTTTGA TCCTAGTTAG
   121  TCTATGATTG GACAATATTT ACCACAAACA AACGAAAGTG CTACAGTAGC GAAATCCAAA
   181  ATTTTTTCAC ATCTGAACAA GGCCTCAGTT CAAATCTCAA AAGCAAAGCA AAATCTCAAG
   241  GCCACTAACC TCGGGGCTGG GACCGGCGAC GTGTCGGAGC CACAGAGCAG AGCAGGGGAG
   301  CCGGGGGAAT CCGTAAGAGC CACGGGCGTC TTCCTCCTTT CCGGCCTCCG GGATAGGGCG
   361  CGCTGGCATG TGGCGCGCCT CCCGAGCGTG GGCTCAGGTT CCGCTCCAAG AAAGTCGGGC
   421  GGAACTTGGC CCTCCTCGCC GACGCGGATC GGTGTCAACT CCTCTTCTGT CTGGAT

Predicted gene structure (within gDNA segment 17607 to 15067):

 Exon  1  17078  16867 ( 212 n);  cDNA      1    210 ( 210 n); score: 0.802
  Intron  1  16866  16384 ( 483 n); Pd: 0.000 (s: 0.74), Pa: 0.162 (s:    0)
 Exon  2  16383  16368 (  16 n);  cDNA    211    224 (  14 n); score: 0.812

MATCH	21326110-	13587489-	0.802	228	0.479	C
PGS_21326110-_13587489-	(17078  16867,16383  16368)

Alignment (genomic DNA sequence = upper lines):

AAATTTCTCA ACACATC-AA ATATTACGAC ACATGCATGA AGCATTAAAT ATATACAAAA    17020
|| |||||    |||||| || || || || | | |||||||| | |||||||| ||| || ||| 
AATTTTCT-G TCACATCGAA ATCTTGCGGC ATATGCATGA AACATTAAAT ATAGACGAAA       59


ATAAAAACTA ATTGCACAGT TTACCTATAA ATCGCGAGAT AAATCTTTTA AACCTAGTTA    16960
|||||||||| ||  |||||| ||  || ||| |||||||||   ||||||||  | |||||||| 
ATAAAAACTA ATCACACAGT TTGACTGTAA ATCGCGAGAC GAATCTTTTG ATCCTAGTTA      119


CTCTATGATT AGACAATATT TGTCAAATAA AAACGAAAGT GCTACAGTCT CAAAAACCAA    16900
 |||||||||  ||||||||| |  || | |  |||||||||| ||||||||   | ||| |||| 
GTCTATGATT GGACAATATT TACCACAAAC AAACGAAAGT GCTACAGTAG CGAAATCCAA      179


AAAGTTTTCG AAACTAAACA AGGCCTGACA CTTGCACATC TTTTTTAAAA AATATAAGGC    16840
||  |||||   | || |||| ||||||  ||  ||                              
AATTTTTTCA CATCTGAACA AGGCCT--CA GTT....... .......... ..........      210


CCTGTTTAGT TCCCACCTAA AAAATTTTCA TCCATCACAT TGAATCTTTA GACACATACA    16780
                                                                  
.......... .......... .......... .......... .......... ..........      210


TAAAACATTA AATGTAGATA AAAAATAATT ACACAGTTTG GTTGAAAATC GCGAGATGAA    16720
                                                                  
.......... .......... .......... .......... .......... ..........      210


TTTTTTAAGC CTAGTTAGTC CATGATTAGC CTTAAGTGCT ACAGTAACCC ACATGTGCTA    16660
                                                                  
.......... .......... .......... .......... .......... ..........      210


ATAATAGATT AATTATACTT AATAGATTCG TCTTGCAGTT TCCTGACGAG TTATGTAATT    16600
                                                                  
.......... .......... .......... .......... .......... ..........      210


TGTTTTTTTT ATTAGTTTTT AAAAACCCCT CCCGACATCC TTCCGACATA TCCGATGTGA    16540
                                                                  
.......... .......... .......... .......... .......... ..........      210


CCTAAAAAAT TTTCATCTTC AATCTAAACA TGCCCTAAGT GAAATGCAAT AATGTGTTGT    16480
                                                                  
.......... .......... .......... .......... .......... ..........      210


AGAACTTTTA TAGGCTATCA CACATGTGGT AGGGCGAGAC CATCATTACA TTCGAAGAAG    16420
                                                                  
.......... .......... .......... .......... .......... ..........      210


AAATATATTC CGCAATCCAC AATTGGGATA AAATAGCAAA TCATCGAAAA GG    16368
                                       |||| || || |||| | 
.......... .......... .......... ......CAAA TC-TC-AAAA GC      224





********************************************************************************
EST sequence   53 -strand (File: 18052346-)

     1  TTAAGCCTAG TTACTCCATG ATTGGACAAT GTTTGTCAAA TAAAAACGAA ATGCTACAGT
    61  AGCCAAAAAC AAAAAATTTT ACGAACTAAA CAAGGCCTAA AACTACAATA CATAACTAAA
   121  ATACATGATG ACAGCTTCAG CAGCCTGTCA GACTAGCAAT GCCAACAGTA CTGCAGCAAC
   181  CTGCAGGCTG CAGCCGGCAG AGTCACAGGG GAACCTGCCT ACACCTGCGC TGCCTCCCGC
   241  TCGCGGTTCC ACTGCTCAAT CTTTGCCCTC CGCTCCTCGC TGCCTTCCCT CCACGGGCTC
   301  TTGCTCCGGC TCCTGGATCG CCCGCGCCGA CGGCGGCTCC CGTCGCTGTC GTGGCTGCGG
   361  TGTCTCTCGC TGCTCCTGCG GCTGCCACTA CCGCTACGGT AGTGGTAGTA ATAGTCATGG
   421  TCATCGTCAC GGTCCCTGGA CCTGGACGAG CTACCGTGGC GGCGGTACGG GCTCGGGCTG
   481  CGGCTGCCGC GGCTATGGCT CCGGTGGGAG CGATGCAGGT GGC

Predicted gene structure (within gDNA segment 17401 to 14449):

 Exon  1  16972  16867 ( 106 n);  cDNA      1    105 ( 105 n); score: 0.849
  Intron  1  16866  16220 ( 647 n); Pd: 0.000 (s: 0.78), Pa: 0.000 (s: 0.67)
 Exon  2  16219  16178 (  42 n);  cDNA    106    144 (  39 n); score: 0.667

MATCH	21326110-	18052346-	0.849	148	0.283	C
PGS_21326110-_18052346-	(16972  16867,16219  16178)

Alignment (genomic DNA sequence = upper lines):

TTAAACCTAG TTACTCTATG ATTAGACAAT ATTTGTCAAA TAAAAACGAA AGTGCTACAG    16913
|||| ||||| |||||| ||| ||| ||||||  ||||||||| |||||||||| | |||||||| 
TTAAGCCTAG TTACTCCATG ATTGGACAAT GTTTGTCAAA TAAAAACGAA A-TGCTACAG       59


TCTCAAAAAC CAAAAAGTTT TCGAAACTAA ACAAGGCCTG ACACTTGCAC ATCTTTTTTA    16853
|  | ||||  |||||| ||| |   |||||| |||||||||  | |||                 
TAGCCAAAAA CAAAAAATTT TACGAACTAA ACAAGGCCTA AAACTA.... ..........      105


AAAAATATAA GGCCCTGTTT AGTTCCCACC TAAAAAATTT TCATCCATCA CATTGAATCT    16793
                                                                  
.......... .......... .......... .......... .......... ..........      105


TTAGACACAT ACATAAAACA TTAAATGTAG ATAAAAAATA ATTACACAGT TTGGTTGAAA    16733
                                                                  
.......... .......... .......... .......... .......... ..........      105


ATCGCGAGAT GAATTTTTTA AGCCTAGTTA GTCCATGATT AGCCTTAAGT GCTACAGTAA    16673
                                                                  
.......... .......... .......... .......... .......... ..........      105


CCCACATGTG CTAATAATAG ATTAATTATA CTTAATAGAT TCGTCTTGCA GTTTCCTGAC    16613
                                                                  
.......... .......... .......... .......... .......... ..........      105


GAGTTATGTA ATTTGTTTTT TTTATTAGTT TTTAAAAACC CCTCCCGACA TCCTTCCGAC    16553
                                                                  
.......... .......... .......... .......... .......... ..........      105


ATATCCGATG TGACCTAAAA AATTTTCATC TTCAATCTAA ACATGCCCTA AGTGAAATGC    16493
                                                                  
.......... .......... .......... .......... .......... ..........      105


AATAATGTGT TGTAGAACTT TTATAGGCTA TCACACATGT GGTAGGGCGA GACCATCATT    16433
                                                                  
.......... .......... .......... .......... .......... ..........      105


ACATTCGAAG AAGAAATATA TTCCGCAATC CACAATTGGG ATAAAATAGC AAATCATCGA    16373
                                                                  
.......... .......... .......... .......... .......... ..........      105


AAAGGGCCTG ACCAATAAGA ATCAGGTCAA GGGTTCATAC AACTGTCATC AGCTATGCAG    16313
                                                                  
.......... .......... .......... .......... .......... ..........      105


AGCCAAAAAA AAAACATATC ATTGGGGTTT GCTATTAGAT CAATCAATTG CTTATGCAGT    16253
                                                                  
.......... .......... .......... .......... .......... ..........      105


TTCCAATAAA AAAAATGCTT ATGCAAATTT CTCCCATATA CAACTAAAGT TACATGAGCA    16193
                                    | ||| |  |||||||   |||||||  | 
.......... .......... .......... ...CAATACA TAACTAAA-A TACATGATGA      131


CATTCCTCCT GAAAC    16178
||  | ||   | | |
CA-GCTTCA- GCAGC      144





********************************************************************************
EST sequence   45 -strand (File: 7554466-)

     1  AACCAAACAG TCAAACATCC AATTAAATTT TTGAGTCTAG TTACTCCATG ATTGGACAAG
    61  GTTTGTCAAA TAAAAACGAA ATTGCTAGTG TCAAAAACAG AAAAAATTTT GGATCTAAAC
   121  AAGGCCTTAC TTAACAAGCA TACAGTCTTC TCCTTGTCCG CACCATTTCA TTTCTCTTAC
   181  ATAAATATAA AAGTCTCATA GATTATTCAT GGGGTGCGTC TACACAACAC CTTGTTGATC
   241  CGAAGGTTCA CTGTCCCCCA TTCTGTTCCA ATCGAAAACA CCAATGGCAT ACGCCCAGCC
   301  GGTTGTCAAA ACCGCAAGAC CAACAGAGGA AGTGAGTACA ACATTCCTTG GCAAGTTGTC
   361  CATAGCTAAT GAAAGCTCCT TGAAATTCTT CATGTCCTTC TCCATATCGC GCAAAAAACG
   421  CTTCTCCAGT TTCTTGTAAT TCCTCCACCT TGGTCGAGCA TTCCTGGTCT CATTCACTGC
   481  TCTCTTGGCT CCTCCACTCT GAGAGGAGTG GGAGGTGAGA AGTCGGGAGC TCGCCGGCGG
   541  CGACACCACG GGGGTCGACG CCCGCTGGAG AACGGACGTG GCAGGGAACC TCAGCTTACG
   601  GGCCAGAACG C

Predicted gene structure (within gDNA segment 17551 to 14154):

 Exon  1  16966  16871 (  96 n);  cDNA     37    130 (  94 n); score: 0.833

MATCH	21326110-	7554466-	0.833	96	0.157	C
PGS_21326110-_7554466-	(16966  16871)

Alignment (genomic DNA sequence = upper lines):

CTAGTTACTC TATGATTAGA CAATATTTGT CAAATAAAAA CGAAAGTGCT ACAGTCTCAA    16907
||||||||||  |||||| || |||  ||||| |||||||||| ||||| ||||   ||| |||| 
CTAGTTACTC CATGATTGGA CAAGGTTTGT CAAATAAAAA CGAAATTGCT --AGTGTCAA       94


AAACCAAAAA GTTTTCGAAA CTAAACAAGG CCTGAC    16871
||||  ||||   ||| | |  |||||||||| ||| ||
AAACAGAAAA AATTTTGGAT CTAAACAAGG CCTTAC      130





********************************************************************************
EST sequence   33 -strand (File: 18066500-)

     1  GGGCCCCCCC TCGAGGCCCC CGCGGATCTC GGCGCCCGAG AGGTCGACGC CGACGCCGAC
    61  GCCGTCACCG TGGCCCGTCG CCTCGCCCAT CCTGCCGTGC CCCGTGCCGT CACAGGGACA
   121  GATCGCTCGG CGCCTGGTAT CGCGCCGCCC GCATTCACAC CGGCACCGCC GGGCCCGCCC
   181  CCGCGCTGCC TGCCTGCGTT CGTCGCCGCC TCGGTTTGAC TGGCAGGCTC GCTGTGCTGT
   241  GCGGCGCCCA ACTGCCGGCG GGCGTCTGGG AGGAGTTGCA GTTGGGAGGA GTTCGCGCTG
   301  GCTGGTCTCG GTCGCGTCGA GTGGCGTGGC CGCGTGGGCG GAGTCGTGGT GCGCGGGGCC
   361  GGGGCGGTAC AACCAAGACA AGTTTGCAGT GCACGCGCCG GGGTTGGACT TTTATATTTG
   421  GGTCTAGTTT TTTTTTAAAA AAACCAAAAC ATTTTCAAGA TTTCTCGTTA AATCGAATCT
   481  TGCGGTATAT ATATAGAGTA TTAAATATAG ATAAAAATAA AAACTAATTA CATAATTTGT
   541  CTGTAAATCG CGAGACGAAT CTTTTAAGTC AAATTACTCT ATGATTGGAT AACTTTTGTC
   601  AAATAAAAAC GAAAATGCTA TAGTGTTATA ATTTAAACAT TTTCCGGATC TAAACAAGGC
   661  TT

Predicted gene structure (within gDNA segment 19888 to 16382):

 Exon  1  17097  16874 ( 224 n);  cDNA    439    662 ( 224 n); score: 0.777

MATCH	21326110-	18066500-	0.777	224	0.338	C
PGS_21326110-_18066500-	(17097  16874)

Alignment (genomic DNA sequence = upper lines):

AAAAACCAAA AACTTTTCAA AATTTCTCAA CACATCAAAT ATTACGACAC ATGCATGAAG    17038
|||||||||| |  |||||||  |||||||    | ||| |||  || ||  |  ||  ||  || 
AAAAACCAAA ACATTTTCAA GATTTCTCGT TAAATCGAAT CTTGCGGTAT ATATATAGAG      498


CATTAAATAT ATACAAAAAT AAAAACTAAT TGCACAGTTT ACCTATAAAT CGCGAGATAA    16978
 ||||||||| | | |||||| |||||||||| | || | |||   || ||||| |||||||  | 
TATTAAATAT AGATAAAAAT AAAAACTAAT TACATAATTT GTCTGTAAAT CGCGAGACGA      558


ATCTTTTAAA CCTAGTTACT CTATGATTAG ACAATATTTG TCAAATAAAA ACGAAAGTGC    16918
|||||||||   | | ||||| |||||||| | | ||  |||| |||||||||| |||||| ||| 
ATCTTTTAAG TCAAATTACT CTATGATTGG ATAACTTTTG TCAAATAAAA ACGAAAATGC      618


TACAGTCTCA AAAACCAAAA AGTTTTCGAA ACTAAACAAG GCCT    16874
|| ||| | |  ||   |||  | ||| || |  ||||||||| || |
TATAGTGTTA TAATTTAAAC ATTTTCCGGA TCTAAACAAG GCTT      662





********************************************************************************
EST sequence   14 -strand (File: 20549510-)

     1  CCCAAAAAGT TTTCAAGATT CCATGTCACA TCGAATCTTG CGGCATATGC ACGAAGCATT
    61  AAATATAGAC GAAAACAAAA ACTAATCACA CAGTTTGACT CTAAATCGCG AGACGAATCT
   121  TTTGACCATA GTTAGTCTAT AATTGGATAA TATTTACCAC AAACAAACGA AAGTGCTACA
   181  GTGCCGAAAT CCGAAATTTT TTCGGAACTA AACAAGGCCT AGCTCAAATT TCAGAAACCT
   241  ATGTCCCTTC TGGGAATATC TCGCTTCAAT CTTGCAGGAC AATTCCAGCT ATGAACTCAT
   301  TCGACAAAAA GACGGTAATA TTTCCTAACC TTCCCGTTTG AAGCATACAA AGCCCTGATA
   361  TTGGTTTCTT ATCCATCTTA TATTCTTATG CATAGGCCCT CACGTGGCAA TCGCAGTGGT
   421  CACTCAATCA AGTCAATGGT AGCACAGTAT TCCATCGCAT CCTCACCAAT GCAATTATCA
   481  AAATGCAGCT GGCATCAACC AGACTGTCTT ATCTACGGAA ACCAGTACTC CCGCTAGGAT
   541  ATCTGAAGTG TGGCACAACG TATGTTCTTC TGGATGAGGA TGGTACCCAG TTCCTCGTGC
   601  CG

Predicted gene structure (within gDNA segment 17606 to 14664):

 Exon  1  17093  16874 ( 220 n);  cDNA      1    220 ( 220 n); score: 0.800

MATCH	21326110-	20549510-	0.800	220	0.365	C
PGS_21326110-_20549510-	(17093  16874)

Alignment (genomic DNA sequence = upper lines):

ACCAAAAACT TTTCAAAATT TCTCAACACA TCAAATATTA CGACACATGC ATGAAGCATT    17034
 ||||||| | |||||| |||  |    |||| || ||| ||  || || |||| | |||||||| 
CCCAAAAAGT TTTCAAGATT CCATGTCACA TCGAATCTTG CGGCATATGC ACGAAGCATT       60


AAATATATAC AAAAATAAAA ACTAATTGCA CAGTTTACCT ATAAATCGCG AGATAAATCT    16974
||||||| ||  |||| |||| ||||||  || ||||||  ||  ||||||||| |||  ||||| 
AAATATAGAC GAAAACAAAA ACTAATCACA CAGTTTGACT CTAAATCGCG AGACGAATCT      120


TTTAAACCTA GTTACTCTAT GATTAGACAA TATTTGTCAA ATAAAAACGA AAGTGCTACA    16914
||| | | || |||| |||||  ||| || || |||||  ||  | | |||||| |||||||||| 
TTTGACCATA GTTAGTCTAT AATTGGATAA TATTTACCAC AAACAAACGA AAGTGCTACA      180


GTCTCAAAAA CCAAAAAGTT TTCGAAACTA AACAAGGCCT    16874
||  | |||  || |||  || |||| ||||| |||||||||| 
GTGCCGAAAT CCGAAATTTT TTCGGAACTA AACAAGGCCT      220





********************************************************************************
EST sequence   13 -strand (File: 20548647-)

     1  GTTTTCAAGA TTCCATGTCA CATCGAATCT TGCGGCATAT GCACGAAGCA TTAAATATAG
    61  ACGAAAACAA AAACTAATCA CACAGTTTGA CTCTAAATCG CGAGACGAAT CTTTTGACCA
   121  TAGTTAGTCT ATAATTGGAT AATATTTACC ACAAACAAAC GAAAGTGCTA CAGTGCCGAA
   181  ATCCGAAATT TTTTCGGAAC TAAACAAGGC CTAGCTCAAA TTTCAGAAAC CTATGTCCCT
   241  TCTGGGAATA TCTCGCTTCA ATCTTGCAGG ACAATTCCAG CTATGAACTC ATTCGACAAA
   301  AAGACGGTAA TATTTCCTAA CCTTCCCGTT TGAAGCATAC AAAGCCCTGA TATTGGTTTC
   361  TTATCCATCT TATATTCTTA TGCATAGGCC CTCACGTGGC AATCGCAGTG GTCACTCAAT
   421  CAAGTCAATG GTAGCACAGT ATTCCATCGC ATCCTCACCA ATGCAATTAT CAAAATGCAG
   481  CTGGCATCAA CCAGACTGTC TTATCTACGG AAACCAGTAC TCCCGCTAGG ATATCTGAAG
   541  TGTGGCACAA CGTATGTTCT TCTGGATGAG GATGGTACCC AGTTCCTCGT GCCGA

Predicted gene structure (within gDNA segment 17566 to 14659):

 Exon  1  17085  16874 ( 212 n);  cDNA      1    212 ( 212 n); score: 0.797

MATCH	21326110-	20548647-	0.797	212	0.356	C
PGS_21326110-_20548647-	(17085  16874)

Alignment (genomic DNA sequence = upper lines):

CTTTTCAAAA TTTCTCAACA CATCAAATAT TACGACACAT GCATGAAGCA TTAAATATAT    17026
 ||||||| | || |    || |||| ||| | | || || || ||| |||||| |||||||||  
GTTTTCAAGA TTCCATGTCA CATCGAATCT TGCGGCATAT GCACGAAGCA TTAAATATAG       60


ACAAAAATAA AAACTAATTG CACAGTTTAC CTATAAATCG CGAGATAAAT CTTTTAAACC    16966
|| |||| || ||||||||   ||||||||   || ||||||| |||||  ||| ||||| | |  
ACGAAAACAA AAACTAATCA CACAGTTTGA CTCTAAATCG CGAGACGAAT CTTTTGACCA      120


TAGTTACTCT ATGATTAGAC AATATTTGTC AAATAAAAAC GAAAGTGCTA CAGTCTCAAA    16906
|||||| ||| || ||| ||  |||||||  | | | | |||| |||||||||| ||||  | || 
TAGTTAGTCT ATAATTGGAT AATATTTACC ACAAACAAAC GAAAGTGCTA CAGTGCCGAA      180


AACCAAAAAG TTTTCGAAAC TAAACAAGGC CT    16874
| || |||   |||||| ||| |||||||||| ||
ATCCGAAATT TTTTCGGAAC TAAACAAGGC CT      212





********************************************************************************
EST sequence   34 -strand (File: 8548754-)

     1  AGCGTTGTTT AGTTCCCAAA ATATTTTGCA AAATTTCTCA GATTCCCCAT CACATTGAAT
    61  CTTGCGGCAC ATGCATGAAG CACTAAATAT AAATAAAAAA ATAACTAATT ACACAGTTTA
   121  CCGCGAGATG AATCTTTTGA GCCTAGTTAG TCCATGATCA GACAATATTT GTCAAATACA
   181  AACCAAAATG CTACTATTCC TATTTTGCAA AAAAAATTAG AACTAAACAA GGCCTTAGTG
   241  TACTGGATTG AGCGAGCAAA AAAAAATTTA GCCTATGTTA TTTAGCCCCC CTCTTGGTCC
   301  ATTTCTGGGT CCGCCGCTGC ATCCAGTCAT GAATACATGA CGTTTTGTTT TCTTTGTCCA
   361  AAATGTCTGG TATTCATGAC

Predicted gene structure (within gDNA segment 18049 to 15849):

 Exon  1  17066  16874 ( 193 n);  cDNA     52    235 ( 184 n); score: 0.777

MATCH	21326110-	8548754-	0.777	193	0.508	C
PGS_21326110-_8548754-	(17066  16874)

Alignment (genomic DNA sequence = upper lines):

ACATCAAATA TTACGACACA TGCATGAAGC ATTAAATATA TACAAAAATA AAAACTAATT    17007
||||  |||  || || |||| |||||||||| | ||||||||  | ||||| | | |||||||| 
ACATTGAATC TTGCGGCACA TGCATGAAGC ACTAAATATA AATAAAAA-A ATAACTAATT      110


GCACAGTTTA CCTATAAATC GCGAGATAAA TCTTTTAAAC CTAGTTACTC TATGATTAGA    16947
 |||||||||  |       | ||||||| || |||||| | | ||||||| ||  ||||| ||| 
ACACAGTTTA -C-------C GCGAGATGAA TCTTTTGAGC CTAGTTAGTC CATGATCAGA      162


CAATATTTGT CAAATAAAAA CGAAAGTGCT AC-AGTCTCA AAAACCAAAA AGTTTTCGAA    16888
|||||||||| |||||| ||| | ||| |||| || | ||  |      ||||| |   || | | 
CAATATTTGT CAAATACAAA CCAAAATGCT ACTATTCCTA TTTTGCAAAA AAAATTAG-A      221


ACTAAACAAG GCCT    16874
|||||||||| ||||
ACTAAACAAG GCCT      235





********************************************************************************
EST sequence   30 -strand (File: 6672435-)

     1  CGAAAATAAA ACTAATTACA CAGTTTGCTT GTAAATCGCG AGATGAATCT TTTAACCCTA
    61  ATTAGTCTAT GATTGGAGAA TATTTACCAC AAACAAACAA AAGTGCTACA GTAGCGAAAT
   121  CCAAAAAGTT TTCGTATCTA AACAAGGCCT TGGTGTGGAA AAAGTTCGTG CTACTGGATG
   181  ATGACAGACA GCTTGGGGGC TTGAGCACTT GGTACCCTGG AGGATTTCTA AAGACTGAGC
   241  GCACGTCTTG TTTAGTGTAC AATGTACGTT AATCATGGTC TTCATGAGGA AATGTCATCT
   301  CCTTTCCACA GCAGGCCAGT GCATAAAATT CAGTTGCGTT TGCGTACCCA TAATCATCAC
   361  TCGTGCGGTC ATGCTTAACA CAACTGCAAT TTCAAGCTCC ACTGATGTAA ATGATCTCGC
   421  CTTTTGGTAG GCAAGTGTAT CTCAGTTCCT TTTTTCCCCC ACGTTCCTAT GATTTACACA
   481  CACTTAAACA GTGCCTTTTT CACAATTGAG GCGAGTTTAA CACTTCAGCA CCAAAACTTT
   541  TCATAATACA GACGACACCA ATCAACACTT GGATGCAAAA TAGAACTAAT CTACACC

Predicted gene structure (within gDNA segment 17452 to 14339):

 Exon  1  17024  16874 ( 151 n);  cDNA      1    150 ( 150 n); score: 0.841

MATCH	21326110-	6672435-	0.841	151	0.253	C
PGS_21326110-_6672435-	(17024  16874)

Alignment (genomic DNA sequence = upper lines):

CAAAAATAAA AACTAATTGC ACAGTTTACC TATAAATCGC GAGATAAATC TTTTAAACCT    16965
| |||||| | |||||||| | ||||||| |  | |||||||| ||||| |||| |||||| ||| 
CGAAAATA-A AACTAATTAC ACAGTTTGCT TGTAAATCGC GAGATGAATC TTTTAACCCT       59


AGTTACTCTA TGATTAGACA ATATTTGTCA AATAAAAACG AAAGTGCTAC AGTCTCAAAA    16905
| ||| |||| ||||| || | ||||||  ||  | | ||||  |||||||||| |||  | ||| 
AATTAGTCTA TGATTGGAGA ATATTTACCA CAAACAAACA AAAGTGCTAC AGTAGCGAAA      119


ACCAAAAAGT TTTCGAAACT AAACAAGGCC T    16874
 ||||||||| ||||| | || |||||||||| |
TCCAAAAAGT TTTCGTATCT AAACAAGGCC T      150





********************************************************************************
EST sequence   38 -strand (File: 6673765-)

     1  GAGCATAATT AGTCTATGAT TAGACAATAA TTGTCAAATA AAAACGAAAG TGATACAGTA
    61  GCAAAATAAA AAAAAAAATC ACGAACTAAA CAAGGCCTCA GTTTTATATG CATTTTACAC
   121  AGTATGGCAA ATTGGTAAAC ATTACCAAAA TTTGTGTGCT TTCCACATTA TGGGGAAAAA
   181  AAATTGGCCA CCACTTCTAC CAGTGAGAAG AGGACTACAT ATATATAGTA CGTATGCCTT
   241  ATTTTCATGT CTACATGCAT TTAAGGTCTC AAAGATAATC TAAACTGCTT CACATAGCCT
   301  CAACTAGAAT TTACATTTAT GCCGATGGAT GTGCTGCACA TGCGACATCT CATATGTCTG
   361  TAAATAAGAG CTGAAACAAA ACATGTGCGG TTTACAAGAC CTCCCAACCA TCCTCTAGAT
   421  CATCCGATGA AGAAACCAGT TGATATCGTC CAAGA

Predicted gene structure (within gDNA segment 17323 to 14789):

 Exon  1  16970  16874 (  97 n);  cDNA      1     98 (  98 n); score: 0.794
  Intron  1  16873  16478 ( 396 n); Pd: 0.000 (s: 0.71), Pa: 0.593 (s:    0)
 Exon  2  16477  16453 (  25 n);  cDNA     99    123 (  25 n); score: 0.680
  Intron  2  16452  14799 (1654 n); Pd: 0.000 (s:    0), Pa: 0.704 (s:    0)
 Exon  3  14798  14792 (   7 n);  cDNA    124    130 (   7 n); score: 0.714

MATCH	21326110-	6673765-	0.794	129	0.284	C
PGS_21326110-_6673765-	(16970  16874,16477  16453,14798  14792)

Alignment (genomic DNA sequence = upper lines):

AAACCTAGTT ACTCTATGAT TAGACAATAT TTGTCAAATA AAAACGAAAG TGCTACAGTC    16911
 | | || || | |||||||| |||||||||  |||||||||| |||||||||| || ||||||  
GAGCATAATT AGTCTATGAT TAGACAATAA TTGTCAAATA AAAACGAAAG TGATACAGTA       60


TCAAAAACCA AAAAGTTTTC -GAAACTAAA CAAGGCCTGA CACTTGCACA TCTTTTTTAA    16852
 |||||   | ||||    ||    ||||||| ||||||||                         
GCAAAATAAA AAAAAAAATC ACGAACTAAA CAAGGCCT.. .......... ..........       98


AAAATATAAG GCCCTGTTTA GTTCCCACCT AAAAAATTTT CATCCATCAC ATTGAATCTT    16792
                                                                  
.......... .......... .......... .......... .......... ..........       98


TAGACACATA CATAAAACAT TAAATGTAGA TAAAAAATAA TTACACAGTT TGGTTGAAAA    16732
                                                                  
.......... .......... .......... .......... .......... ..........       98


TCGCGAGATG AATTTTTTAA GCCTAGTTAG TCCATGATTA GCCTTAAGTG CTACAGTAAC    16672
                                                                  
.......... .......... .......... .......... .......... ..........       98


CCACATGTGC TAATAATAGA TTAATTATAC TTAATAGATT CGTCTTGCAG TTTCCTGACG    16612
                                                                  
.......... .......... .......... .......... .......... ..........       98


AGTTATGTAA TTTGTTTTTT TTATTAGTTT TTAAAAACCC CTCCCGACAT CCTTCCGACA    16552
                                                                  
.......... .......... .......... .......... .......... ..........       98


TATCCGATGT GACCTAAAAA ATTTTCATCT TCAATCTAAA CATGCCCTAA GTGAAATGCA    16492
                                                                  
.......... .......... .......... .......... .......... ..........       98


ATAATGTGTT GTAGAACTTT TATAGGC-TA TCACACATGT GGTAGGGCGA GACCATCATT    16433
                | ||| |||| || |  | ||||| ||                       
.......... ....CAGTTT TATATGCATT TTACACA-GT .......... ..........      123


ACATTCGAAG AAGAAATATA TTCCGCAATC CACAATTGGG ATAAAATAGC AAATCATCGA    16373
                                                                  
.......... .......... .......... .......... .......... ..........      123


AAAGGGCCTG ACCAATAAGA ATCAGGTCAA GGGTTCATAC AACTGTCATC AGCTATGCAG    16313
                                                                  
.......... .......... .......... .......... .......... ..........      123


AGCCAAAAAA AAAACATATC ATTGGGGTTT GCTATTAGAT CAATCAATTG CTTATGCAGT    16253
                                                                  
.......... .......... .......... .......... .......... ..........      123


TTCCAATAAA AAAAATGCTT ATGCAAATTT CTCCCATATA CAACTAAAGT TACATGAGCA    16193
                                                                  
.......... .......... .......... .......... .......... ..........      123


CATTCCTCCT GAAACGTAAT ACTGAAAGCA TACTTTTGAT TTGAATGGTT GAATCTACAA    16133
                                                                  
.......... .......... .......... .......... .......... ..........      123


GCTATACGGT TTGTTTCCAG AATCTGATCG ATCTATCATT TCCACAAATA ACAAAAACTG    16073
                                                                  
.......... .......... .......... .......... .......... ..........      123


GTTCAACTGG GGAGTGGTCG AGCCATCTGG GAGCACCAGT GCTGCCAGAG GGCAATCTTG    16013
                                                                  
.......... .......... .......... .......... .......... ..........      123


CAACCTTTTC TGCAGTAAGT GCATCCCAGA CGACAACCTG AAGAGTGACG TATCATAGTT    15953
                                                                  
.......... .......... .......... .......... .......... ..........      123


AAGCTTGCTG AAATACAAAT ATATATACTG TTCTCAATTT GGAATTTACC TCATTGTTTT    15893
                                                                  
.......... .......... .......... .......... .......... ..........      123


GTTCATCAAC TGATAGAACA AATTCTTCGG TTTCATTGAA GACAGCCTGG ATAGTAAGAA    15833
                                                                  
.......... .......... .......... .......... .......... ..........      123


CAGTTATTAT CATATTTATT GTCTATCATA GCAAGGTTAG GTATGTTGTT ATCCTAAGCT    15773
                                                                  
.......... .......... .......... .......... .......... ..........      123


GCAAGCTCAA ACCAGCCTAT TTTCAAATTA AAGAATTGCA ATATTTTGTT TCCTAAAATT    15713
                                                                  
.......... .......... .......... .......... .......... ..........      123


TTGGGTAAAA ATAATATATA TGGCACACGA GTAAATTTAA ATCAGGAAAA AATAATAATC    15653
                                                                  
.......... .......... .......... .......... .......... ..........      123


TTATAGAAAC ACAGAGAAAC TAACCTGACA ACGAAATTGT CTGCGAATGG CTCCTGCATA    15593
                                                                  
.......... .......... .......... .......... .......... ..........      123


TTGCTTCACA AGTCGTCCAG TGCCAACTTC CCATAACTTG ACACAAGAAT CTTTCCCACA    15533
                                                                  
.......... .......... .......... .......... .......... ..........      123


AGATAGGACA TACCTGAAAG AACGTAGTAA ACTTCATAAC AGATAACCAG AATACAGTGT    15473
                                                                  
.......... .......... .......... .......... .......... ..........      123


GCAGTTTTAT GAAAGAAATC CATGAACTAT CTAAGCATAT ACTTCGGGTA GTCAAAGTTC    15413
                                                                  
.......... .......... .......... .......... .......... ..........      123


ACTACATCAA TTTTTTAGAT CAATCTTATA TGCAAGTGCA TTCACGCTGC ATATAACCAC    15353
                                                                  
.......... .......... .......... .......... .......... ..........      123


ATAAACACTA GGCCTTTCAG AAGAAGTCTA AAAAGTGTTT ATAGGCAAGT TAGTTGTTTA    15293
                                                                  
.......... .......... .......... .......... .......... ..........      123


GTGGTGAAAT AGTAGGGTAA AGGAGAAAGA GTTATTCGTG TTATAAAGTT ACGACACGTC    15233
                                                                  
.......... .......... .......... .......... .......... ..........      123


TGAAACACAG GAAATTATCC AGGACATGTT ATAAATCATT CAGAATCACT ACAAGATTCC    15173
                                                                  
.......... .......... .......... .......... .......... ..........      123


CACATTCCAA ACAGGGTTTG AAGTAGTTAC TGTCTTGAAT CATACAGCAT ATGCCTTTCT    15113
                                                                  
.......... .......... .......... .......... .......... ..........      123


CTCTGTTCTT CAAACCAAAC AATGACTGGA TTTTATCTTG AGGGAAGAGC ACCTTAGACA    15053
                                                                  
.......... .......... .......... .......... .......... ..........      123


TGCTGGTAGC TCGCTTACCT CTCATCTCTG GTGAAAATTG CGCTAGTAGC TTCTGCAGAT    14993
                                                                  
.......... .......... .......... .......... .......... ..........      123


CCATGTGCTC CAATAATAGG TCGAACACAT TCAGCAGATA CTCCATCCCA AATGCGCAGA    14933
                                                                  
.......... .......... .......... .......... .......... ..........      123


GAACCATCTT TAGAAGCAGT CACATACAAG CTCCCAGTAC AGGAGTAGCG TACCTGGCAG    14873
                                                                  
.......... .......... .......... .......... .......... ..........      123


CAACATCAGT AAGCATGGCT GGCGGAGAAC TTTGATGAGA ATATAACCAA TGCAATCTAA    14813
                                                                  
.......... .......... .......... .......... .......... ..........      123


TGCTTGTGAA TCAGAAGGAA A    14792
               | || | |
.......... ....ATGGCA A      130





********************************************************************************
EST sequence   54 -strand (File: 14514528-)

     1  TTNTTCGTCA CATCAAATCT TTAGATCAAA TCTTTGAACA TATGCATGAA GCATTAAATA
    61  TAGATAAAAA GAATAACTAA TTGCACAGTT TGTTTGTGAG ACAAATCTTT TAAGCCTAAT
   121  TAGTCCATAA TTGAACAATA ATAACCAAAT ACAAACGAAA ATGCTACACT ATTCAAAACC
   181  AACAAATTTT CCCAACTAAA CAAGGCCATA GCCCATAGGC CATAGGGGTG GGGTGTGTGC
   241  GGCGCACGTC AACTTATTCG CTCAGCTGAC ACTCTTCGTA TCTTATACGT AGCATTATAT
   301  ATGGCACACA AAGATTGAAA ATCTTGCAAT TTGCAGTGCA GCTTACATTG GCCAGCAGTC
   361  AAATTGTTTA TTAGCGACTT CTTCAAAACT AGGCAACTCC GTCCTCTCTG AAATTTCCGA
   421  TCCATGAAGG CCCAAGCCCA ACCCAACCAG AATTTCCATA TTTGAAACTC TTAGATCTCT
   481  TCCTGTTCTG GCGATGACTG ACCACCCTCG TGC

Predicted gene structure (within gDNA segment 17557 to 14365):

 Exon  1  17064  16875 ( 190 n);  cDNA     25    207 ( 183 n); score: 0.789

MATCH	21326110-	14514528-	0.789	190	0.370	C
PGS_21326110-_14514528-	(17064  16875)

Alignment (genomic DNA sequence = upper lines):

ATCAAATATT ACGACACATG CATGAAGCAT TAAATATATA CAAAAATAAA AACTAATTGC    17005
||||||| ||    ||| ||| |||||||||| |||||||| |  ||||| ||  |||||||||| 
ATCAAATCTT TGAACATATG CATGAAGCAT TAAATATAGA TAAAAAGAAT AACTAATTGC       84


ACAGTTTACC TATAAATCGC GAGATAAATC TTTTAAACCT AGTTACTCTA TGATTAGACA    16945
|||||||    | |   | |  |||| ||||| |||||| ||| | ||| || | | |||  ||| 
ACAGTTT--G T-T---T-GT GAGACAAATC TTTTAAGCCT AATTAGTCCA TAATTGAACA      137


ATATTTGTCA AATAAAAACG AAAGTGCTAC AGTCTCAAAA ACCAAAAAGT TTTCGAAACT    16885
||| |   || |||| ||||| ||| |||||| | | |  ||| ||||| || | ||||  |||| 
ATAATAACCA AATACAAACG AAAATGCTAC ACTATTCAAA ACCAACAAAT TTTCCCAACT      197


AAACAAGGCC    16875
|||||||||| 
AAACAAGGCC      207





********************************************************************************
EST sequence   89 -strand (File: 11996680-)

     1  TTACGGCATA TGCATAGAGC ATTAAATATA GATAAAAATA AAAAGTAATT GTACAGTTTG
    61  TCTGTAAATC GCGAGATGAA TCTTTTAAGC CTAGTTACTT CATGATTGGA CAATGTTTGT
   121  CAAATAAAAA TGAAAGTGCT ACAATGTTAA AATCCAAAAA CTTTTTAGAT CTAAACAAAG
   181  CTTAAAAGAG CTATTAACGG TACGACTGTT GGCAGGCAGC GCTGCAATGC AAAGGCTGTT
   241  GATGCACAAT GCAATCCTGC AAATCGTCAG CGAAACATTA GACATTGACA GAGTTTAGCA
   301  TGTTCACGAC AGTGGAGGGC CCAGGGTATG CCACTAAGTT CTCTGAATGG CGTTGTGGCA
   361  AACAGCTAAT GCTGCTACTG GTGCGCTGGA GGCTGGACGC CGGAGCTTCA CATGGCTCCC
   421  ACTTTGTACA GTTATACAAA TCTACTAGCT GCTTTAAGCC GAGCAACTGT AACAACAGTA
   481  GACATGTACA GTTATACAAA TCTAGCTGGC ACCCCGAACA CCCGAGAGTC CGAGTAGCAT
   541  CAACCTTAGG CCATCAGTTT TGCAGCATTT CTGTTCTTCA ATGTCAAAAA TGCTGCTTCA
   601  GCAAATGCTT GCGCAGCTTG GGCTTCTGCT TCTGCAGACT CTGCTTCTTT CGCTGCAGCT
   661  T

Predicted gene structure (within gDNA segment 17429 to 14024):

 Exon  1  17056  16876 ( 181 n);  cDNA      1    181 ( 181 n); score: 0.845

MATCH	21326110-	11996680-	0.845	181	0.274	C
PGS_21326110-_11996680-	(17056  16876)

Alignment (genomic DNA sequence = upper lines):

TTACGACACA TGCATGAAGC ATTAAATATA TACAAAAATA AAAACTAATT GCACAGTTTA    16997
||||| || | |||||  ||| ||||||||||  | ||||||| |||| ||||| | |||||||  
TTACGGCATA TGCATAGAGC ATTAAATATA GATAAAAATA AAAAGTAATT GTACAGTTTG       60


CCTATAAATC GCGAGATAAA TCTTTTAAAC CTAGTTACTC TATGATTAGA CAATATTTGT    16937
 || |||||| ||||||| || |||||||| | |||||||||   |||||| || |||| ||||| 
TCTGTAAATC GCGAGATGAA TCTTTTAAGC CTAGTTACTT CATGATTGGA CAATGTTTGT      120


CAAATAAAAA CGAAAGTGCT ACAGTCTCAA AAACCAAAAA GTTTTCGAAA CTAAACAAGG    16877
||||||||||  ||||||||| ||| | | || || |||||||  ||||   |  |||||||| | 
CAAATAAAAA TGAAAGTGCT ACAATGTTAA AATCCAAAAA CTTTTTAGAT CTAAACAAAG      180


C    16876
|
C      181





********************************************************************************
EST sequence  127 +strand (File: 9301429+)

     1  GGTAAGATAA AAAGATTCCC TGCACTAGGA GGGGACGGTA TCCCGGGATA CTGTTTGTGG
    61  TGGCTCGTCA CTACTCACTT ATCCTATCAC TTATCTCTGA AGTCACCATC CGCTGAGCTG
   121  TTCTTTGGCT TATATACAAG AGCTCTGCTC ACCACTACCA CTGCAATTGA ATTTTTTTTT
   181  CTCTTCTGTT TACTTCCCAG AAAATTTTGC AAAATTTTTC ACATTCCCTG TCACATCGAA
   241  TCTTTAGACG CATGCATGGA GTATTAAATA TAGACGAAAA TAAAAACTAA TTGCATAGTT
   301  TGGTCGAAAT TAACGAGACG AATCTTTTGA ACCTAGTTAG TACATGATTG GACAATATTT
   361  GTCAAATACA AACGAAAATG CTACGGTGTC CATTTCCTAA AATTTTTCAG AACTAAACAA
   421  GGCCCTGATC TCGTTGTGGT TGGTGCTGGT GCAGACC

Predicted gene structure (within gDNA segment 19434 to 16405):

 Exon  1  17091  16878 ( 214 n);  cDNA    210    421 ( 212 n); score: 0.780

MATCH	21326110-	9301429+	0.780	214	0.468	C
PGS_21326110-_9301429+	(17091  16878)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
| |||| ||| || | ||| |     ||||||  ||| ||  | || ||||||| | || ||||| 
C-AAAATTTT TC-ACATTCC CTGTCACATC GAATCTTTAG ACGCATGCAT GGAGTATTAA      267


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| || | |||||||||| |||||||| | ||||       || |  |||| |  ||||||| 
ATATAGACGA AAATAAAAAC TAATTGCATA GTTTGGTCGA AATTAACGAG ACGAATCTTT      327


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTACAGT    16912
| |||||||| || |  |||| || ||||||| |||||||||| | ||||||||  |||||| || 
TGAACCTAGT TAGTACATGA TTGGACAATA TTTGTCAAAT ACAAACGAAA ATGCTACGGT      387


CTCAAAAACC AAAAAGTTTT CGAAACTAAA CAAG    16878
 || |   ||  |||| |||| |  ||||||| ||||
GTCCATTTCC TAAAATTTTT CAGAACTAAA CAAG      421





********************************************************************************
EST sequence   47 -strand (File: 9299558-)

     1  AGTACAGAAT ACAGATCACA CGCTCTAGCT ACATTCTTCG ATGTATATAT GTATAATCAG
    61  GTGTAGTAGC TTAGCTATCT AGCGACTGCG GCGGTACAAG CAGTAGGCGT TGAGGATGGT
   121  GAGCAGGACG AGGATGACGG AGGCGACGAG GCCCAGGAAG ACGGAGCTGC CGATGTGACG
   181  GCAGAAGTTG CCGTAGATGT TGCAGATCTT GGTCCAGTTG GTGTGTGTGT TGCCCTTGAG
   241  CCCGATCCAC GCTACACCAC CCGCTGACCC CGTCGCTGAA GCCATGATAG CTGCGTATAA
   301  CACATCGAGC AGAACAAGAA GGAAGAGAGT CTTGGTGGGA GAGGAGCCGG AGATGAGCTT
   361  GAGCGAGGTG AGCGCCGTCA GCAAGCTGTA GAAGCACGTC ACGCACTGCG CCACCAGCAG
   421  ATATCTACCA GAGCCAGCGA GCACGAAGCA CATGCATGCA TGCATGCGCA TGCAAATAAA
   481  GAGTCATCGT GAGAGACCAT ATTTAGGCCT TGTTTAGTTG CCAAAATTTT TCAAGATTCT
   541  CCGTCACATC GAATTTTGCG GTACATACAT GAAGCATTAA ATATAAACGA AAATAAAAAC
   601  TAATTACGCA GTTTACCTGT AAATCGTGAG ACGAATCTTT TGATTCTAGT TAGTCTATGA
   661  TTGGATAATA TTTGCCACAA ACAAACGAAA GTGCTACAGT AGCGAAATTC AAAATTTTTC
   721  TCANACTAA

Predicted gene structure (within gDNA segment 20184 to 16467):

 Exon  1  19888  19839 (  50 n);  cDNA    409    452 (  44 n); score: 0.660
  Intron  1  19838  19083 ( 756 n); Pd: 0.000 (s: 0.66), Pa: 0.062 (s:    0)
 Exon  2  19082  19052 (  31 n);  cDNA    453    483 (  31 n); score: 0.613
  Intron  2  19051  18750 ( 302 n); Pd: 0.000 (s:    0), Pa: 0.484 (s: 0.57)
 Exon  3  18749  18710 (  40 n);  cDNA    484    520 (  37 n); score: 0.575
  Intron  3  18709  17092 (1618 n); Pd: 0.000 (s: 0.57), Pa: 0.000 (s: 0.72)
 Exon  4  17091  16883 ( 209 n);  cDNA    521    729 ( 209 n); score: 0.794

MATCH	21326110-	9299558-	0.768	330	0.453	C
PGS_21326110-_9299558-	(19888  19839,19082  19052,18749  18710,17091  16883)

Alignment (genomic DNA sequence = upper lines):

CTCCAGCAAG GCAGCAATTT GCCAGATCGA ATGGAGCATC GCAGTCATCA AGAACAGAAG    19829
| ||| | |  ||||  || |  ||||| |   |  ||||| | | || || ||            
CGCCA-CCA- GCAGATATCT ACCAGAGC-C AGCGAGCA-C GAAG-CA-CA ..........      452


AATTGTTGAG TGGTGGCCTA GGAAGAAGCC AAATGGGGGA GTGAGCAGAT TCATAATGGG    19769
                                                                  
.......... .......... .......... .......... .......... ..........      452


ATATATGGGG ACTAGAGGCT GTCACGACAA GAAAGGGAGA AGAAGCAGTG CAGAGAGTAT    19709
                                                                  
.......... .......... .......... .......... .......... ..........      452


TTGTACAGGA ACCACTTCAA CTAGGTTCCA CCAGTATGGG TTTCAAAGAA TGGAAGAAAT    19649
                                                                  
.......... .......... .......... .......... .......... ..........      452


GCCAAGGAAT TAGGCGAGGC ATACTAGATA ACAAATATAT ACTTTCTTAT TTTTCATTTT    19589
                                                                  
.......... .......... .......... .......... .......... ..........      452


AAACCTAATA GACCATAATG CACTTGCAGT ATGACACTTA AAGAAACAGT TAGGACTTCA    19529
                                                                  
.......... .......... .......... .......... .......... ..........      452


CAGCAATCAT TTTCCAACAC AGACTTGCTT CAAGTTCCCA TAAAAGTACC ATCACATTGA    19469
                                                                  
.......... .......... .......... .......... .......... ..........      452


AGAACTATGC ACAAGCACAA ATGGGTCCGC TTATGGTAAA CTGGCATGGA CAAGTTTCAT    19409
                                                                  
.......... .......... .......... .......... .......... ..........      452


CTGCCACTTC ATTTTGTTTG TTACATCGAT GTGAAGTTTC TTGAACTATG GATTTGAATG    19349
                                                                  
.......... .......... .......... .......... .......... ..........      452


GCAAAACAAA CACTGTTTAG AATACCGTGT TGCGCTTTGA CATGGTTCTT GTCAGCTGGG    19289
                                                                  
.......... .......... .......... .......... .......... ..........      452


CAGCTACACC AAAATCACCT GTTTTGCACA TTGTTGTGGC GCCACAGCAT GCCGACCACA    19229
                                                                  
.......... .......... .......... .......... .......... ..........      452


GAGTCAGGAC ATGCAGAAAT ATGGGTGCTA AGAATGCAAA CTAAAACTTT TGAAGAAAAC    19169
                                                                  
.......... .......... .......... .......... .......... ..........      452


AAATGTGCTT ACCCAACTTC ACCTCGCCTT GCTCAGTTAG AAGAATGTTG CCACCCTTAA    19109
                                                                  
.......... .......... .......... .......... .......... ..........      452


TATCTCTATG AACTTTAAAA ATGGAGTGCA GGTAAGCAAG GCCCTGGAAG AAAATAAGCA    19049
                            ||||  | | ||| |   | || ||   ||| |     
.......... .......... ......TGCA TGCATGCATG CGCATGCAAA TAAAGAG...      483


CGCAAAAGTT CAATATCCAA ATACATTTAG TTGCCCAACA AGGCAGCAAA TACTTCAAAT    18989
                                                                  
.......... .......... .......... .......... .......... ..........      483


CTGATGCAAC TATGTTAGAA CCTTTAGTGC TTCTCTACAT ATATAAGCTA TTTGGGATTC    18929
                                                                  
.......... .......... .......... .......... .......... ..........      483


ATCAAGAGGC TCCTCTGTGA TGCCTATCAA ATCAGCAACA CTTCCACCAC CACAGTACTC    18869
                                                                  
.......... .......... .......... .......... .......... ..........      483


CATAACTATC TGTAAGTTGA GAATCGCATT TGCATCAAGC CCATGTTAAA TGACTCAAGA    18809
                                                                  
.......... .......... .......... .......... .......... ..........      483


AGTAGAGAAA TCTCCCAATG ATAGTTATTT CTTAATGTTA ATAAAATGGA TACTATCAGG    18749
                                                                  
.......... .......... .......... .......... .......... .........T      484


CTATTTGATT GTACCCATAG GTAGTCCTCT CCTTGGTAGC TTCCAAAGTA GCGGACAACA    18689
|    |||   | | |||||   ||| ||| |   || || |                        
CATCGTGAGA G-A-CCATAT TTAGGCCT-T GTTTAGTTG. .......... ..........      520


TTTGGATGGC TACACTGCTG CAGCATCTCA ATTTCTCCCC GTATGTCTTC ATATCCTTCT    18629
                                                                  
.......... .......... .......... .......... .......... ..........      520


TCCTGAAAAC CAAAGATACA TACTTATATT TTGGAAAAAT GCAACGACTC GGAAAACAGA    18569
                                                                  
.......... .......... .......... .......... .......... ..........      520


CAGCAACCAC ATTTATGAGA TTCTCTCACA ATTGAGCCCA TGCAAACAAA ATGCTCACAA    18509
                                                                  
.......... .......... .......... .......... .......... ..........      520


CAAAAGCAAT ATGGTTGCCA AATATGAAAT ATGTCTCGGG TGGCCTTTCA GAATATTCAC    18449
                                                                  
.......... .......... .......... .......... .......... ..........      520


AGAACTTTGT AATAGAAAAT TAGAAACTAA CCCCTTCTGT TAGTGAGATA ATCTTGACAG    18389
                                                                  
.......... .......... .......... .......... .......... ..........      520


CCACAAGCTC CTGCGTTCTG AGATCCCTTG CTTTGTACAC TGCACCATAT GAGCCTTTCC    18329
                                                                  
.......... .......... .......... .......... .......... ..........      520


CTGCATTCCC AATTGAATTT TGCATTTCGC AAAACAGCTC AAAGCTTCAG CCATTCTACA    18269
                                                                  
.......... .......... .......... .......... .......... ..........      520


AGTAGACATA CAGAACTAAT GAAACAATAA TTCCAGAGCA AGAGGCGCAC CAAGCTCATG    18209
                                                                  
.......... .......... .......... .......... .......... ..........      520


GAGCAGCTCG TACTTGGTGG AAGGATCCTC TCTGGTAACA CTGTCTGGCG CCGAGCTCAC    18149
                                                                  
.......... .......... .......... .......... .......... ..........      520


TGATGGCTTC CGCCTTGAAT GCTGCTGCTG TTGTTGCTGC ATCAGAGGCG ACGGTTGCCG    18089
                                                                  
.......... .......... .......... .......... .......... ..........      520


GAGCTCCTCT GTCTGCTCCA CCGCTGGACT CCAGAAAGAG GACCCGAAAC CCCCGCCGCC    18029
                                                                  
.......... .......... .......... .......... .......... ..........      520


GCCAGAAGCA GATTCATAGG AACTGGAACC CCCGCTGGTG TGGCGAATGA AGGTGCCAGA    17969
                                                                  
.......... .......... .......... .......... .......... ..........      520


GAACGACCCG CGGGGGCTCG ACGGGCTCCC TGGTCGGCGG ATGAATGTGC CGGAGACCGA    17909
                                                                  
.......... .......... .......... .......... .......... ..........      520


GTCCCGGGGG CTCGACGGGG TGCTAGTCCG GCGGATGAAT GTGCCAGAGA CGGATTCGTG    17849
                                                                  
.......... .......... .......... .......... .......... ..........      520


AGGGCTGGAC GAGCCCCCGG AGCGACGGAT GAATGTGCCT GAGGCGGACC CTCGAGGGCT    17789
                                                                  
.......... .......... .......... .......... .......... ..........      520


GGAGGAGGTC CCCCCCGAGC GTGCGGTGGA GTGGACGACG AAGGTAGAGT ATGGGTCGTC    17729
                                                                  
.......... .......... .......... .......... .......... ..........      520


ATCGGTAGCG CGGGGGCTGG AGCGCCGCAG ATCCAGGAAC GGAGATCGAG CGGAGGCCGG    17669
                                                                  
.......... .......... .......... .......... .......... ..........      520


GGCGCCGCTC TTGAAGACCA CCGTAGCGGA GAGGGAAGCA TCGTCGGGGT CGGAGGAGTA    17609
                                                                  
.......... .......... .......... .......... .......... ..........      520


GGCGTCCTCG TCTTCGTCAA AGGAGGGGCC GCCGAAGTCC TTGGGGAGCC GCTGGAGAAG    17549
                                                                  
.......... .......... .......... .......... .......... ..........      520


CGGAGGCAGC GAGGAGGGGT CTTCCTCCTC GTCTTCCTCC GCCCGCGTGG ACGGGCCCCT    17489
                                                                  
.......... .......... .......... .......... .......... ..........      520


GCCGCGCCTG CTGCCGCGGG CGTCGTCCTC GTCGTCATCG CCGTGGACGA CGAAGGTTGA    17429
                                                                  
.......... .......... .......... .......... .......... ..........      520


GTAGACGTCG TTTCTCTTGG GACGCGACCA CGGCGAGCGC GGGGAGAAAG CCATGGCGTG    17369
                                                                  
.......... .......... .......... .......... .......... ..........      520


CCACGCGAGG TGGGAGGAGA CGGTGAAGGT GCTCGTCGGG AATGGCAAAT GGGGAAAATT    17309
                                                                  
.......... .......... .......... .......... .......... ..........      520


GTTTAGTTGG AGCCAGTTCA CTCGAATCTG GCAAATATGG GTCGGGCTCG GATGGGCCAT    17249
                                                                  
.......... .......... .......... .......... .......... ..........      520


CCCATTCTAG GCCCACGTGA CATAGAGAAT CCGGTCAAAT TCTTCCTTCC CGCAGTCCCG    17189
                                                                  
.......... .......... .......... .......... .......... ..........      520


CTAGGCCCAC ACGACCACAC CCAGTCACCC GCAGCCACAG GCCGCAGAGA GCTTCCTCGA    17129
                                                                  
.......... .......... .......... .......... .......... ..........      520


AAGGAGCTTC TCTTTTTTCT CCACTCACCC CAAAAACCAA AAACTTTTCA AAATTTCTCA    17069
                                        | | ||| |||||| | |||   |  
.......... .......... .......... .......CCA AAATTTTTCA AGATTCTCCG      543


ACACATCAAA TATTACGACA CATGCATGAA GCATTAAATA TATACAAAAA TAAAAACTAA    17009
 |||||| || | || ||  | ||| |||||| |||||||||| || || |||| |||||||||| 
TCACATCGAA TTTTGCGGTA CATACATGAA GCATTAAATA TAAACGAAAA TAAAAACTAA      603


TTGCACAGTT TACCTATAAA TCGCGAGATA AATCTTTTAA ACCTAGTTAC TCTATGATTA    16949
|| | ||||| ||||| |||| ||| ||||   |||||||| |   |||||||  |||||||||  
TTACGCAGTT TACCTGTAAA TCGTGAGACG AATCTTTTGA TTCTAGTTAG TCTATGATTG      663


GACAATATTT GTCAAATAAA AACGAAAGTG CTACAGTCTC AAAAACCAAA AAGTTTTCGA    16889
|| ||||||| | || | | | |||||||||| |||||||  |  |||  |||| |  |||   | 
GATAATATTT GCCACAAACA AACGAAAGTG CTACAGTAGC GAAATTCAAA ATTTTTCTCA      723


AACTAA    16883
 |||||
NACTAA      729





********************************************************************************
EST sequence   84 -strand (File: 11552500-)

     1  TCATGCGCTG CGACACCAGG TGCCACTCGC GCGGGCCGTA CTGCCGGACG TACGCGCGCA
    61  GGACGGCGTC TTCCTCAGGC CGCCAGCGCT GTCGCTCCTT CATCTGCACA GGCNCAGGCC
   121  ATCGCCCATC CCACACCACC ACACCTCATA ATGCGCGCTG CTTCCGTTGC ATTTGCAAGA
   181  AAAAGATCAA ATCTTTGATT AGCTCATTGC AAGAAAACCA GGAACATCAA ATCGTAACCG
   241  TGGATAGTAG TATATATATT AGAAGTTACT AGTGAATCTT TAGCTCATCA GCTTTGAAAA
   301  AAGAATGACC AAGAACAGAC TGAGGCTTTG TTTAGTTCGC AAAAATTTTC AAGATTCCTC
   361  GTCACATCGA ATCTTTGGTC GCATGCATGG AGCATTAAAT ATAGACGAAA ATAAAAACTA
   421  ATTGCACAGT TTACCTGTAA TTTGTGAGAT GAATCTTTTG AGCCTAGTTA CTCCGTGATT
   481  GGACAATGTT TGTCAAATAA AAACGAAATG CTACAGTAAC CAAAAAAAGA AAAATCCTCG
   541  TGC

Predicted gene structure (within gDNA segment 19294 to 16261):

 Exon  1  17091  16887 ( 205 n);  cDNA    340    543 ( 204 n); score: 0.810

MATCH	21326110-	11552500-	0.810	205	0.378	C
PGS_21326110-_11552500-	(17091  16887)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
|||||| ||| |||| ||| | ||  ||||||  ||| ||  |  | ||||||| | |||||||| 
CAAAAA-TTT TCAAGATTCC TCGTCACATC GAATCTTTGG TCGCATGCAT GGAGCATTAA      398


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| || | |||||||||| |||||||||| |||||||| | || | | ||| || ||||||| 
ATATAGACGA AAATAAAAAC TAATTGCACA GTTTACCTGT AATTTGTGAG ATGAATCTTT      458


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTACAGT    16912
| | |||||| |||||  ||| || ||||||  |||||||||| ||||||||||  ||||||||| 
TGAGCCTAGT TACTCCGTGA TTGGACAATG TTTGTCAAAT AAAAACGAAA -TGCTACAGT      517


-CTCAAAAAC CAAAAAGTTT TCGAAA    16887
   ||||||    |||| |   |||   
AACCAAAAAA AGAAAAATCC TCGTGC      543





********************************************************************************
EST sequence   85 -strand (File: 11552512-)

     1  CCGCCAGCGC TGTCGCTCCT TCATCTGCAC AGGCCCAGGC CATCGCCCAT CCCACACCAC
    61  CACACCTCAT AATGCGCGCT GCTTCCGTTG CATTTGCAAG AAAAAGATCA AATCTTTGAT
   121  TAGCTCATTG CAAGAAAACC AGGAACATCA AATCGTAACC GTGGATAGTA GTATATATAT
   181  TAGAAGTTAC TAGTGAATCT TTAGCTCATC AGCTTTGAAA AAAGAATGAC CAAGAACAGA
   241  CTGAGGCTTT GTTTAGTTCG CAAAAATTTT CAAGATTCCT CGTCACATCG AATCTTTGGT
   301  CGCATGCATG GAGCATTAAA TATAGACGAA AATAAAAACT AATTGCACAG TTTACCTGTA
   361  ATTTGTGAGA TGAATCTTTT GAGCGTAGTT ACTCCGTGAT TGGACACATG TTTGTCAAAT
   421  AAAAACGAAA TGCTACAGTA ACCAAAAAAA GAAAAATCCT CGTGC

Predicted gene structure (within gDNA segment 18899 to 16261):

 Exon  1  17091  16887 ( 205 n);  cDNA    261    465 ( 205 n); score: 0.795

MATCH	21326110-	11552512-	0.795	205	0.441	C
PGS_21326110-_11552512-	(17091  16887)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
|||||| ||| |||| ||| | ||  ||||||  ||| ||  |  | ||||||| | |||||||| 
CAAAAA-TTT TCAAGATTCC TCGTCACATC GAATCTTTGG TCGCATGCAT GGAGCATTAA      319


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| || | |||||||||| |||||||||| |||||||| | || | | ||| || ||||||| 
ATATAGACGA AAATAAAAAC TAATTGCACA GTTTACCTGT AATTTGTGAG ATGAATCTTT      379


TAAACCTAGT TACTCTATGA TTAGACA-AT ATTTGTCAAA TAAAAACGAA AGTGCTACAG    16913
| | | |||| |||||  ||| || |||| ||  ||||||||| |||||||||| | |||||||| 
TGAGCGTAGT TACTCCGTGA TTGGACACAT GTTTGTCAAA TAAAAACGAA A-TGCTACAG      438


T-CTCAAAAA CCAAAAAGTT TTCGAAA    16887
|   ||||||    |||| |   |||   
TAACCAAAAA AAGAAAAATC CTCGTGC      465





********************************************************************************
EST sequence   56 -strand (File: 8088762-)

     1  ATCTTGAGCC TAGTTAGTAC ATGGATTGGA TAATANTTTG TCAAATACAA ACGAAAGTGC
    61  TACAGTACCT GTTTTGCAAA AATTTTGGAA CTAAACAAGA CCTTAGTTTC CAGCGAAATC
   121  CAAAAAGTTT TCAAGATTCC CCGTAACATC GAATCTTGTG GCACATGCAT GAAACACTAA
   181  ATATATTACA CAGTTTGTCT ATAAATCATG AGACGAATCT TTTGACTTTA GTTAGTTTAT
   241  GATTGGACAA TATTTACCAC AAGCAAACGA AAGTGCTACA GTAGCGAAAT CCGAAATTTT
   301  TTCGGATCAA GAGACCAGGA CAAGGAGCGA TGCGTTCTTG GCTGCGGCGC AGACGAGGCA
   361  GGCGTNGACG GCGGCCTCGC ACGCGCGGCA CAGGCACAGG TGGCGGCACG GGAGCAGCAG
   421  CACGCACGCC TCTCCGCCGC CGCACGACCT GCACTCCTCC ACCGCCCCCT GTGGTC

Predicted gene structure (within gDNA segment 17474 to 15045):

 Exon  1  17104  16888 ( 217 n);  cDNA    109    306 ( 198 n); score: 0.705
  Intron  1  16887  15071 (1817 n); Pd: 0.000 (s: 0.74), Pa: 0.120 (s:    0)
 Exon  2  15070  15045 (  26 n);  cDNA    307    330 (  24 n); score: 0.577

MATCH	21326110-	8088762-	0.705	243	0.511	C
PGS_21326110-_8088762-	(17104  16888,15070  15045)

Alignment (genomic DNA sequence = upper lines):

TCACCCCAAA AACCAAAAAC TTTTCAAAAT TTCTCAACAC ATCAAATATT ACGACACATG    17045
|| |  | || | |||||||  ||||||| || | | |   || ||| ||| ||   | |||||| 
TC-CAGCGAA ATCCAAAAAG TTTTCAAGAT TCCCCGTAAC ATCGAATCTT GTGGCACATG      167


CATGAAGCAT TAAATATATA CAAAAATAAA AACTAATTGC ACAGTTTACC TATAAATCGC    16985
|||||| ||  |||||||||                | |   | |||||||  | ||||||||   
CATGAAACAC TAAATATAT- ---------- ---T-A---C ACAGTTTGTC TATAAATCAT      209


GAGATAAATC TTTTAAACCT AGTTACTCTA TGATTAGACA ATATTTGTCA AATAAAAACG    16925
||||  |||| |||| |   | ||||| | || ||||| |||| ||||||  ||  |   ||||| 
GAGACGAATC TTTTGACTTT AGTTAGTTTA TGATTGGACA ATATTTACCA CAAGCAAACG      269


AAAGTGCTAC AGTCTCAAAA ACCAAAAAGT TTTCGAAACT AAACAAGGCC TGACACTTGC    16865
|||||||||| |||  | |||  || |||  | ||||| |                          
AAAGTGCTAC AGTAGCGAAA TCCGAAATTT TTTCGGA... .......... ..........      306


ACATCTTTTT TAAAAAATAT AAGGCCCTGT TTAGTTCCCA CCTAAAAAAT TTTCATCCAT    16805
                                                                  
.......... .......... .......... .......... .......... ..........      306


CACATTGAAT CTTTAGACAC ATACATAAAA CATTAAATGT AGATAAAAAA TAATTACACA    16745
                                                                  
.......... .......... .......... .......... .......... ..........      306


GTTTGGTTGA AAATCGCGAG ATGAATTTTT TAAGCCTAGT TAGTCCATGA TTAGCCTTAA    16685
                                                                  
.......... .......... .......... .......... .......... ..........      306


GTGCTACAGT AACCCACATG TGCTAATAAT AGATTAATTA TACTTAATAG ATTCGTCTTG    16625
                                                                  
.......... .......... .......... .......... .......... ..........      306


CAGTTTCCTG ACGAGTTATG TAATTTGTTT TTTTTATTAG TTTTTAAAAA CCCCTCCCGA    16565
                                                                  
.......... .......... .......... .......... .......... ..........      306


CATCCTTCCG ACATATCCGA TGTGACCTAA AAAATTTTCA TCTTCAATCT AAACATGCCC    16505
                                                                  
.......... .......... .......... .......... .......... ..........      306


TAAGTGAAAT GCAATAATGT GTTGTAGAAC TTTTATAGGC TATCACACAT GTGGTAGGGC    16445
                                                                  
.......... .......... .......... .......... .......... ..........      306


GAGACCATCA TTACATTCGA AGAAGAAATA TATTCCGCAA TCCACAATTG GGATAAAATA    16385
                                                                  
.......... .......... .......... .......... .......... ..........      306


GCAAATCATC GAAAAGGGCC TGACCAATAA GAATCAGGTC AAGGGTTCAT ACAACTGTCA    16325
                                                                  
.......... .......... .......... .......... .......... ..........      306


TCAGCTATGC AGAGCCAAAA AAAAAACATA TCATTGGGGT TTGCTATTAG ATCAATCAAT    16265
                                                                  
.......... .......... .......... .......... .......... ..........      306


TGCTTATGCA GTTTCCAATA AAAAAAATGC TTATGCAAAT TTCTCCCATA TACAACTAAA    16205
                                                                  
.......... .......... .......... .......... .......... ..........      306


GTTACATGAG CACATTCCTC CTGAAACGTA ATACTGAAAG CATACTTTTG ATTTGAATGG    16145
                                                                  
.......... .......... .......... .......... .......... ..........      306


TTGAATCTAC AAGCTATACG GTTTGTTTCC AGAATCTGAT CGATCTATCA TTTCCACAAA    16085
                                                                  
.......... .......... .......... .......... .......... ..........      306


TAACAAAAAC TGGTTCAACT GGGGAGTGGT CGAGCCATCT GGGAGCACCA GTGCTGCCAG    16025
                                                                  
.......... .......... .......... .......... .......... ..........      306


AGGGCAATCT TGCAACCTTT TCTGCAGTAA GTGCATCCCA GACGACAACC TGAAGAGTGA    15965
                                                                  
.......... .......... .......... .......... .......... ..........      306


CGTATCATAG TTAAGCTTGC TGAAATACAA ATATATATAC TGTTCTCAAT TTGGAATTTA    15905
                                                                  
.......... .......... .......... .......... .......... ..........      306


CCTCATTGTT TTGTTCATCA ACTGATAGAA CAAATTCTTC GGTTTCATTG AAGACAGCCT    15845
                                                                  
.......... .......... .......... .......... .......... ..........      306


GGATAGTAAG AACAGTTATT ATCATATTTA TTGTCTATCA TAGCAAGGTT AGGTATGTTG    15785
                                                                  
.......... .......... .......... .......... .......... ..........      306


TTATCCTAAG CTGCAAGCTC AAACCAGCCT ATTTTCAAAT TAAAGAATTG CAATATTTTG    15725
                                                                  
.......... .......... .......... .......... .......... ..........      306


TTTCCTAAAA TTTTGGGTAA AAATAATATA TATGGCACAC GAGTAAATTT AAATCAGGAA    15665
                                                                  
.......... .......... .......... .......... .......... ..........      306


AAAATAATAA TCTTATAGAA ACACAGAGAA ACTAACCTGA CAACGAAATT GTCTGCGAAT    15605
                                                                  
.......... .......... .......... .......... .......... ..........      306


GGCTCCTGCA TATTGCTTCA CAAGTCGTCC AGTGCCAACT TCCCATAACT TGACACAAGA    15545
                                                                  
.......... .......... .......... .......... .......... ..........      306


ATCTTTCCCA CAAGATAGGA CATACCTGAA AGAACGTAGT AAACTTCATA ACAGATAACC    15485
                                                                  
.......... .......... .......... .......... .......... ..........      306


AGAATACAGT GTGCAGTTTT ATGAAAGAAA TCCATGAACT ATCTAAGCAT ATACTTCGGG    15425
                                                                  
.......... .......... .......... .......... .......... ..........      306


TAGTCAAAGT TCACTACATC AATTTTTTAG ATCAATCTTA TATGCAAGTG CATTCACGCT    15365
                                                                  
.......... .......... .......... .......... .......... ..........      306


GCATATAACC ACATAAACAC TAGGCCTTTC AGAAGAAGTC TAAAAAGTGT TTATAGGCAA    15305
                                                                  
.......... .......... .......... .......... .......... ..........      306


GTTAGTTGTT TAGTGGTGAA ATAGTAGGGT AAAGGAGAAA GAGTTATTCG TGTTATAAAG    15245
                                                                  
.......... .......... .......... .......... .......... ..........      306


TTACGACACG TCTGAAACAC AGGAAATTAT CCAGGACATG TTATAAATCA TTCAGAATCA    15185
                                                                  
.......... .......... .......... .......... .......... ..........      306


CTACAAGATT CCCACATTCC AAACAGGGTT TGAAGTAGTT ACTGTCTTGA ATCATACAGC    15125
                                                                  
.......... .......... .......... .......... .......... ..........      306


ATATGCCTTT CTCTCTGTTC TTCAAACCAA ACAATGACTG GATTTTATCT TGAGGGAAGA    15065
                                                             |||| 
.......... .......... .......... .......... .......... ....TCAAGA      312


GCACCTTAGA CATGCTGGTA    15045
| |||   || || |  |  | 
G-ACC-AGGA CAAGGAGCGA      330





********************************************************************************
EST sequence   86 -strand (File: 12617906-)

     1  GTCGACAGCA GCTCATTTTT ATCAATATTG TTACCAAATC CTGCAACATT TCATCATTTC
    61  GTCAACAATT CATTATTTTC ATTAGTATAA TAATTAGCGG CGCACACACA TCTATATAGT
   121  TAATTTTCAC CAGGCAGCTA CTAGACCGAC TGTTAGAACG GGCTGTGCCC GCGCCGTGCC
   181  GTGTGCCTGG GTGGTGGCCT AGGCACAGCC TGGTCCCTCA GGCCGGGCCG AGCCAAATCG
   241  TCGGGCCACG GGCTGCATGA CCATATATAA TCAAATTGAA TTTTGCGGCA AAAACATAGA
   301  ACATTAAATA TATTAAAAAA TAATTAATTA CACAGTATAT CTGTAACTTA CGAGATAAAT
   361  CTTTTTAAGA CTAGTTAGTT TATGATTGGA CAATAATTAC TAAATACAAA CGAAAGTGTT
   421  ATAATGTCAA AATCCAAAAA AAAATTTGGA TCTAATCGGA AAAAATGACT TATAGGCTTG
   481  TTTAGTTCGC GAGCTACTGT AACACTTTCA TTTGTATTTA ACAGTTATTA TCTAATTATG
   541  AACTAACCAG ACTTA

Predicted gene structure (within gDNA segment 21074 to 15407):

 Exon  1  20470  20463 (   8 n);  cDNA    267    274 (   8 n); score: 0.750
  Intron  1  20462  17065 (3398 n); Pd: 0.000 (s:    0), Pa: 0.000 (s: 0.68)
 Exon  2  17064  16897 ( 168 n);  cDNA    275    440 ( 166 n); score: 0.756

MATCH	21326110-	12617906-	0.756	176	0.317	C
PGS_21326110-_12617906-	(20470  20463,17064  16897)

Alignment (genomic DNA sequence = upper lines):

AAAAGCAATG GATACCATCG AGAAGAGGGC ACCAACTGTT GTCGGCACAC TTTACTACGA    20411
| || |||                                                          
ATAATCAA.. .......... .......... .......... .......... ..........      274


AAGGGTGTGG GTGGGTGGGG TAGAACTATT TGTTATGGGC TCCTCAAGCA TTTATGTATT    20351
                                                                  
.......... .......... .......... .......... .......... ..........      274


GTCATGATTG GAAACTAGAG AAGTGTAGCA GCCAAGAAGG TGTACAAGAG AGAAAAAAAA    20291
                                                                  
.......... .......... .......... .......... .......... ..........      274


AAGAGTAGAA GTATCAGCAG CAGTAGAAAG GGGAGTAGAT TGTTTTTTTA TATTGGTTTC    20231
                                                                  
.......... .......... .......... .......... .......... ..........      274


TAGCTAGATA TTAATAAATT CCATAGTCAA TTCTTGTAGT ATGGTACTAC ATTATATCAT    20171
                                                                  
.......... .......... .......... .......... .......... ..........      274


CGTCCTAGGG AACCTGAACT TGTATTCTAC CCTGATTTTC CAAACTCTCA CTCACATACC    20111
                                                                  
.......... .......... .......... .......... .......... ..........      274


TCCTCCTAGA TCTAGCCAAT TATGAACTAT CAACTATCCT ACCTGATTTG GACTCCCTGT    20051
                                                                  
.......... .......... .......... .......... .......... ..........      274


GCACTAACTC TTCCTCTAGT GTCAAGCAGA GTCCATAACT TGGAGGTAAG ATGACGCCCT    19991
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGATAATATT TCCCACTTGG AGGTTCATTG TGATTATGAT TTCCAACAGA CCTGTTGGTT    19931
                                                                  
.......... .......... .......... .......... .......... ..........      274


TGATATGCTA ATGTCACAGT AACCCTCTAC GTTCTTGAAT AGCTCCAGCA AGGCAGCAAT    19871
                                                                  
.......... .......... .......... .......... .......... ..........      274


TTGCCAGATC GAATGGAGCA TCGCAGTCAT CAAGAACAGA AGAATTGTTG AGTGGTGGCC    19811
                                                                  
.......... .......... .......... .......... .......... ..........      274


TAGGAAGAAG CCAAATGGGG GAGTGAGCAG ATTCATAATG GGATATATGG GGACTAGAGG    19751
                                                                  
.......... .......... .......... .......... .......... ..........      274


CTGTCACGAC AAGAAAGGGA GAAGAAGCAG TGCAGAGAGT ATTTGTACAG GAACCACTTC    19691
                                                                  
.......... .......... .......... .......... .......... ..........      274


AACTAGGTTC CACCAGTATG GGTTTCAAAG AATGGAAGAA ATGCCAAGGA ATTAGGCGAG    19631
                                                                  
.......... .......... .......... .......... .......... ..........      274


GCATACTAGA TAACAAATAT ATACTTTCTT ATTTTTCATT TTAAACCTAA TAGACCATAA    19571
                                                                  
.......... .......... .......... .......... .......... ..........      274


TGCACTTGCA GTATGACACT TAAAGAAACA GTTAGGACTT CACAGCAATC ATTTTCCAAC    19511
                                                                  
.......... .......... .......... .......... .......... ..........      274


ACAGACTTGC TTCAAGTTCC CATAAAAGTA CCATCACATT GAAGAACTAT GCACAAGCAC    19451
                                                                  
.......... .......... .......... .......... .......... ..........      274


AAATGGGTCC GCTTATGGTA AACTGGCATG GACAAGTTTC ATCTGCCACT TCATTTTGTT    19391
                                                                  
.......... .......... .......... .......... .......... ..........      274


TGTTACATCG ATGTGAAGTT TCTTGAACTA TGGATTTGAA TGGCAAAACA AACACTGTTT    19331
                                                                  
.......... .......... .......... .......... .......... ..........      274


AGAATACCGT GTTGCGCTTT GACATGGTTC TTGTCAGCTG GGCAGCTACA CCAAAATCAC    19271
                                                                  
.......... .......... .......... .......... .......... ..........      274


CTGTTTTGCA CATTGTTGTG GCGCCACAGC ATGCCGACCA CAGAGTCAGG ACATGCAGAA    19211
                                                                  
.......... .......... .......... .......... .......... ..........      274


ATATGGGTGC TAAGAATGCA AACTAAAACT TTTGAAGAAA ACAAATGTGC TTACCCAACT    19151
                                                                  
.......... .......... .......... .......... .......... ..........      274


TCACCTCGCC TTGCTCAGTT AGAAGAATGT TGCCACCCTT AATATCTCTA TGAACTTTAA    19091
                                                                  
.......... .......... .......... .......... .......... ..........      274


AAATGGAGTG CAGGTAAGCA AGGCCCTGGA AGAAAATAAG CACGCAAAAG TTCAATATCC    19031
                                                                  
.......... .......... .......... .......... .......... ..........      274


AAATACATTT AGTTGCCCAA CAAGGCAGCA AATACTTCAA ATCTGATGCA ACTATGTTAG    18971
                                                                  
.......... .......... .......... .......... .......... ..........      274


AACCTTTAGT GCTTCTCTAC ATATATAAGC TATTTGGGAT TCATCAAGAG GCTCCTCTGT    18911
                                                                  
.......... .......... .......... .......... .......... ..........      274


GATGCCTATC AAATCAGCAA CACTTCCACC ACCACAGTAC TCCATAACTA TCTGTAAGTT    18851
                                                                  
.......... .......... .......... .......... .......... ..........      274


GAGAATCGCA TTTGCATCAA GCCCATGTTA AATGACTCAA GAAGTAGAGA AATCTCCCAA    18791
                                                                  
.......... .......... .......... .......... .......... ..........      274


TGATAGTTAT TTCTTAATGT TAATAAAATG GATACTATCA GGCTATTTGA TTGTACCCAT    18731
                                                                  
.......... .......... .......... .......... .......... ..........      274


AGGTAGTCCT CTCCTTGGTA GCTTCCAAAG TAGCGGACAA CATTTGGATG GCTACACTGC    18671
                                                                  
.......... .......... .......... .......... .......... ..........      274


TGCAGCATCT CAATTTCTCC CCGTATGTCT TCATATCCTT CTTCCTGAAA ACCAAAGATA    18611
                                                                  
.......... .......... .......... .......... .......... ..........      274


CATACTTATA TTTTGGAAAA ATGCAACGAC TCGGAAAACA GACAGCAACC ACATTTATGA    18551
                                                                  
.......... .......... .......... .......... .......... ..........      274


GATTCTCTCA CAATTGAGCC CATGCAAACA AAATGCTCAC AACAAAAGCA ATATGGTTGC    18491
                                                                  
.......... .......... .......... .......... .......... ..........      274


CAAATATGAA ATATGTCTCG GGTGGCCTTT CAGAATATTC ACAGAACTTT GTAATAGAAA    18431
                                                                  
.......... .......... .......... .......... .......... ..........      274


ATTAGAAACT AACCCCTTCT GTTAGTGAGA TAATCTTGAC AGCCACAAGC TCCTGCGTTC    18371
                                                                  
.......... .......... .......... .......... .......... ..........      274


TGAGATCCCT TGCTTTGTAC ACTGCACCAT ATGAGCCTTT CCCTGCATTC CCAATTGAAT    18311
                                                                  
.......... .......... .......... .......... .......... ..........      274


TTTGCATTTC GCAAAACAGC TCAAAGCTTC AGCCATTCTA CAAGTAGACA TACAGAACTA    18251
                                                                  
.......... .......... .......... .......... .......... ..........      274


ATGAAACAAT AATTCCAGAG CAAGAGGCGC ACCAAGCTCA TGGAGCAGCT CGTACTTGGT    18191
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGAAGGATCC TCTCTGGTAA CACTGTCTGG CGCCGAGCTC ACTGATGGCT TCCGCCTTGA    18131
                                                                  
.......... .......... .......... .......... .......... ..........      274


ATGCTGCTGC TGTTGTTGCT GCATCAGAGG CGACGGTTGC CGGAGCTCCT CTGTCTGCTC    18071
                                                                  
.......... .......... .......... .......... .......... ..........      274


CACCGCTGGA CTCCAGAAAG AGGACCCGAA ACCCCCGCCG CCGCCAGAAG CAGATTCATA    18011
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGAACTGGAA CCCCCGCTGG TGTGGCGAAT GAAGGTGCCA GAGAACGACC CGCGGGGGCT    17951
                                                                  
.......... .......... .......... .......... .......... ..........      274


CGACGGGCTC CCTGGTCGGC GGATGAATGT GCCGGAGACC GAGTCCCGGG GGCTCGACGG    17891
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGTGCTAGTC CGGCGGATGA ATGTGCCAGA GACGGATTCG TGAGGGCTGG ACGAGCCCCC    17831
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGAGCGACGG ATGAATGTGC CTGAGGCGGA CCCTCGAGGG CTGGAGGAGG TCCCCCCCGA    17771
                                                                  
.......... .......... .......... .......... .......... ..........      274


GCGTGCGGTG GAGTGGACGA CGAAGGTAGA GTATGGGTCG TCATCGGTAG CGCGGGGGCT    17711
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGAGCGCCGC AGATCCAGGA ACGGAGATCG AGCGGAGGCC GGGGCGCCGC TCTTGAAGAC    17651
                                                                  
.......... .......... .......... .......... .......... ..........      274


CACCGTAGCG GAGAGGGAAG CATCGTCGGG GTCGGAGGAG TAGGCGTCCT CGTCTTCGTC    17591
                                                                  
.......... .......... .......... .......... .......... ..........      274


AAAGGAGGGG CCGCCGAAGT CCTTGGGGAG CCGCTGGAGA AGCGGAGGCA GCGAGGAGGG    17531
                                                                  
.......... .......... .......... .......... .......... ..........      274


GTCTTCCTCC TCGTCTTCCT CCGCCCGCGT GGACGGGCCC CTGCCGCGCC TGCTGCCGCG    17471
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGCGTCGTCC TCGTCGTCAT CGCCGTGGAC GACGAAGGTT GAGTAGACGT CGTTTCTCTT    17411
                                                                  
.......... .......... .......... .......... .......... ..........      274


GGGACGCGAC CACGGCGAGC GCGGGGAGAA AGCCATGGCG TGCCACGCGA GGTGGGAGGA    17351
                                                                  
.......... .......... .......... .......... .......... ..........      274


GACGGTGAAG GTGCTCGTCG GGAATGGCAA ATGGGGAAAA TTGTTTAGTT GGAGCCAGTT    17291
                                                                  
.......... .......... .......... .......... .......... ..........      274


CACTCGAATC TGGCAAATAT GGGTCGGGCT CGGATGGGCC ATCCCATTCT AGGCCCACGT    17231
                                                                  
.......... .......... .......... .......... .......... ..........      274


GACATAGAGA ATCCGGTCAA ATTCTTCCTT CCCGCAGTCC CGCTAGGCCC ACACGACCAC    17171
                                                                  
.......... .......... .......... .......... .......... ..........      274


ACCCAGTCAC CCGCAGCCAC AGGCCGCAGA GAGCTTCCTC GAAAGGAGCT TCTCTTTTTT    17111
                                                                  
.......... .......... .......... .......... .......... ..........      274


CTCCACTCAC CCCAAAAACC AAAAACTTTT CAAAATTTCT CAACACATCA AATATTACGA    17051
                                                  ||   ||| || ||  
.......... .......... .......... .......... ......ATTG AATTTTGCGG      288


CACATGCATG AAGCATTAAA TATATACAAA AATAAAAACT AATTGCACAG TTTACCTATA    16991
|| |  |||   | ||||||| |||||  ||| |||   || | |||| ||||| | || || || 
CAAAAACATA GAACATTAAA TATATTAAAA AAT---AATT AATTACACAG TATATCTGTA      345


AATCGCGAGA TAAATC-TTT TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT    16932
| |  ||||| |||||| ||| |||  ||||| || | ||||| || |||||||  ||   |||| 
ACTTACGAGA TAAATCTTTT TAAGACTAGT TAGTTTATGA TTGGACAATA ATTACTAAAT      405


AAAAACGAAA GTGCTACAGT CTCAAAAACC AAAAA    16897
| |||||||| ||| || | |  |||||| || |||||
ACAAACGAAA GTGTTATAAT GTCAAAATCC AAAAA      440





********************************************************************************
EST sequence   39 -strand (File: 6673837-)

     1  TAAAAATAAT AACTAATTGC ACAATTTGTC TGTAATTTAC GAGACAAATC TTTTGAGCCT
    61  AGTTAGTCCA TGATTGGACA ACATTTGTCA AATACGAACG AAAGTGCTAC AGTGTGCATT
   121  GACACAGCAG TTCTGATTCT GAGTATATCT CTGGTGTTCA GGCATCTAGA AGAAGCCGTG
   181  AGAAAACCTA GAGCTTGTTG CTGCGCTTTG ATCTCCATAT CCTATTGATT GGGTCAGGTG
   241  GTTGGAAATT CTGGAGTTGG CAGTGAGAAC TTTTTGAATG AACAATCCTA TGAACCTTAG
   301  ATGTGATGCC ATTTGTCTCT TTCATCATTC TGAATTCTGG TTCCTTGAAT CAATCACTGT
   361  AGTTGTTGAT CTTCTTGAAA AGCATGTTTA GCCAGTGGGA GATGAACTGC TCTTGGATTT
   421  CATTGTGACA ACTGGTAACT ATTTTTCATG GTACAACAAA GAATTCGCTA CCTATAACAA
   481  TTGTAAAATA AGCAGCCGGG CAAACCCTCT GTTAGTAGTA CTTACAGGTT TTGGGCTTTC
   541  AACCGGCAAG CTCACTAATC GG

Predicted gene structure (within gDNA segment 17369 to 14367):

 Exon  1  17024  16910 ( 115 n);  cDNA      1    115 ( 115 n); score: 0.835
  Intron  1  16909  16467 ( 443 n); Pd: 0.000 (s: 0.86), Pa: 0.878 (s:    0)
 Exon  2  16466  16452 (  15 n);  cDNA    116    130 (  15 n); score: 0.600
  Intron  2  16451  15035 (1417 n); Pd: 0.000 (s:    0), Pa: 0.000 (s:    0)
 Exon  3  15034  15023 (  12 n);  cDNA    131    141 (  11 n); score: 0.750
  Intron  3  15022  14402 ( 621 n); Pd: 0.467 (s:    0), Pa: 0.393 (s:    0)
 Exon  4  14401  14367 (  35 n);  cDNA    142    175 (  34 n); score: 0.657

MATCH	21326110-	6673837-	0.835	177	0.315	C
PGS_21326110-_6673837-	(17024  16910,16466  16452,15034  15023,14401  14367)

Alignment (genomic DNA sequence = upper lines):

CAAAAATAAA AACTAATTGC ACAGTTTACC TATAAATCGC GAGATAAATC TTTTAAACCT    16965
 ||||||||  |||||||||| ||| |||  | | ||| |  | |||| ||||| |||| | ||| 
TAAAAATAAT AACTAATTGC ACAATTTGTC TGTAATTTAC GAGACAAATC TTTTGAGCCT       60


AGTTACTCTA TGATTAGACA ATATTTGTCA AATAAAAACG AAAGTGCTAC AGTCTCAAAA    16905
||||| || | ||||| |||| | |||||||| ||||  |||| |||||||||| ||| |      
AGTTAGTCCA TGATTGGACA ACATTTGTCA AATACGAACG AAAGTGCTAC AGTGT.....      115


ACCAAAAAGT TTTCGAAACT AAACAAGGCC TGACACTTGC ACATCTTTTT TAAAAAATAT    16845
                                                                  
.......... .......... .......... .......... .......... ..........      115


AAGGCCCTGT TTAGTTCCCA CCTAAAAAAT TTTCATCCAT CACATTGAAT CTTTAGACAC    16785
                                                                  
.......... .......... .......... .......... .......... ..........      115


ATACATAAAA CATTAAATGT AGATAAAAAA TAATTACACA GTTTGGTTGA AAATCGCGAG    16725
                                                                  
.......... .......... .......... .......... .......... ..........      115


ATGAATTTTT TAAGCCTAGT TAGTCCATGA TTAGCCTTAA GTGCTACAGT AACCCACATG    16665
                                                                  
.......... .......... .......... .......... .......... ..........      115


TGCTAATAAT AGATTAATTA TACTTAATAG ATTCGTCTTG CAGTTTCCTG ACGAGTTATG    16605
                                                                  
.......... .......... .......... .......... .......... ..........      115


TAATTTGTTT TTTTTATTAG TTTTTAAAAA CCCCTCCCGA CATCCTTCCG ACATATCCGA    16545
                                                                  
.......... .......... .......... .......... .......... ..........      115


TGTGACCTAA AAAATTTTCA TCTTCAATCT AAACATGCCC TAAGTGAAAT GCAATAATGT    16485
                                                                  
.......... .......... .......... .......... .......... ..........      115


GTTGTAGAAC TTTTATAGGC TATCACACAT GTGGTAGGGC GAGACCATCA TTACATTCGA    16425
                   ||   | |||||    |                              
.......... ........GC ATTGACACAG CAG....... .......... ..........      130


AGAAGAAATA TATTCCGCAA TCCACAATTG GGATAAAATA GCAAATCATC GAAAAGGGCC    16365
                                                                  
.......... .......... .......... .......... .......... ..........      130


TGACCAATAA GAATCAGGTC AAGGGTTCAT ACAACTGTCA TCAGCTATGC AGAGCCAAAA    16305
                                                                  
.......... .......... .......... .......... .......... ..........      130


AAAAAACATA TCATTGGGGT TTGCTATTAG ATCAATCAAT TGCTTATGCA GTTTCCAATA    16245
                                                                  
.......... .......... .......... .......... .......... ..........      130


AAAAAAATGC TTATGCAAAT TTCTCCCATA TACAACTAAA GTTACATGAG CACATTCCTC    16185
                                                                  
.......... .......... .......... .......... .......... ..........      130


CTGAAACGTA ATACTGAAAG CATACTTTTG ATTTGAATGG TTGAATCTAC AAGCTATACG    16125
                                                                  
.......... .......... .......... .......... .......... ..........      130


GTTTGTTTCC AGAATCTGAT CGATCTATCA TTTCCACAAA TAACAAAAAC TGGTTCAACT    16065
                                                                  
.......... .......... .......... .......... .......... ..........      130


GGGGAGTGGT CGAGCCATCT GGGAGCACCA GTGCTGCCAG AGGGCAATCT TGCAACCTTT    16005
                                                                  
.......... .......... .......... .......... .......... ..........      130


TCTGCAGTAA GTGCATCCCA GACGACAACC TGAAGAGTGA CGTATCATAG TTAAGCTTGC    15945
                                                                  
.......... .......... .......... .......... .......... ..........      130


TGAAATACAA ATATATATAC TGTTCTCAAT TTGGAATTTA CCTCATTGTT TTGTTCATCA    15885
                                                                  
.......... .......... .......... .......... .......... ..........      130


ACTGATAGAA CAAATTCTTC GGTTTCATTG AAGACAGCCT GGATAGTAAG AACAGTTATT    15825
                                                                  
.......... .......... .......... .......... .......... ..........      130


ATCATATTTA TTGTCTATCA TAGCAAGGTT AGGTATGTTG TTATCCTAAG CTGCAAGCTC    15765
                                                                  
.......... .......... .......... .......... .......... ..........      130


AAACCAGCCT ATTTTCAAAT TAAAGAATTG CAATATTTTG TTTCCTAAAA TTTTGGGTAA    15705
                                                                  
.......... .......... .......... .......... .......... ..........      130


AAATAATATA TATGGCACAC GAGTAAATTT AAATCAGGAA AAAATAATAA TCTTATAGAA    15645
                                                                  
.......... .......... .......... .......... .......... ..........      130


ACACAGAGAA ACTAACCTGA CAACGAAATT GTCTGCGAAT GGCTCCTGCA TATTGCTTCA    15585
                                                                  
.......... .......... .......... .......... .......... ..........      130


CAAGTCGTCC AGTGCCAACT TCCCATAACT TGACACAAGA ATCTTTCCCA CAAGATAGGA    15525
                                                                  
.......... .......... .......... .......... .......... ..........      130


CATACCTGAA AGAACGTAGT AAACTTCATA ACAGATAACC AGAATACAGT GTGCAGTTTT    15465
                                                                  
.......... .......... .......... .......... .......... ..........      130


ATGAAAGAAA TCCATGAACT ATCTAAGCAT ATACTTCGGG TAGTCAAAGT TCACTACATC    15405
                                                                  
.......... .......... .......... .......... .......... ..........      130


AATTTTTTAG ATCAATCTTA TATGCAAGTG CATTCACGCT GCATATAACC ACATAAACAC    15345
                                                                  
.......... .......... .......... .......... .......... ..........      130


TAGGCCTTTC AGAAGAAGTC TAAAAAGTGT TTATAGGCAA GTTAGTTGTT TAGTGGTGAA    15285
                                                                  
.......... .......... .......... .......... .......... ..........      130


ATAGTAGGGT AAAGGAGAAA GAGTTATTCG TGTTATAAAG TTACGACACG TCTGAAACAC    15225
                                                                  
.......... .......... .......... .......... .......... ..........      130


AGGAAATTAT CCAGGACATG TTATAAATCA TTCAGAATCA CTACAAGATT CCCACATTCC    15165
                                                                  
.......... .......... .......... .......... .......... ..........      130


AAACAGGGTT TGAAGTAGTT ACTGTCTTGA ATCATACAGC ATATGCCTTT CTCTCTGTTC    15105
                                                                  
.......... .......... .......... .......... .......... ..........      130


TTCAAACCAA ACAATGACTG GATTTTATCT TGAGGGAAGA GCACCTTAGA CATGCTGGTA    15045
                                                                  
.......... .......... .......... .......... .......... ..........      130


GCTCGCTTAC CTCTCATCTC TGGTGAAAAT TGCGCTAGTA GCTTCTGCAG ATCCATGTGC    14985
            ||| || || ||                                          
.......... TTCTGAT-TC TG........ .......... .......... ..........      141


TCCAATAATA GGTCGAACAC ATTCAGCAGA TACTCCATCC CAAATGCGCA GAGAACCATC    14925
                                                                  
.......... .......... .......... .......... .......... ..........      141


TTTAGAAGCA GTCACATACA AGCTCCCAGT ACAGGAGTAG CGTACCTGGC AGCAACATCA    14865
                                                                  
.......... .......... .......... .......... .......... ..........      141


GTAAGCATGG CTGGCGGAGA ACTTTGATGA GAATATAACC AATGCAATCT AATGCTTGTG    14805
                                                                  
.......... .......... .......... .......... .......... ..........      141


AATCAGAAGG AAAGAGAAAA GCTACCTGGT TAATGGGAGA ACTAGAATCC TGTGCATTTG    14745
                                                                  
.......... .......... .......... .......... .......... ..........      141


CTGATAAGTA GCATGTAAAA GTATTTATAT CATATAAATG AGCAACTGGG TGATCAGTCC    14685
                                                                  
.......... .......... .......... .......... .......... ..........      141


CTGCAAATAA TTTTATCAGT GTCACTTGCT TCCAAATATA TGAAAATGAG TTTTTTTAAA    14625
                                                                  
.......... .......... .......... .......... .......... ..........      141


AAAAATACAT ATTTGAATGT TAATATTTGA CTATATGTAA GAAGAAAATT CCATACGATA    14565
                                                                  
.......... .......... .......... .......... .......... ..........      141


TGCTTGCAGT ATTTTTCAAA TGCCCACGAG ACAGAAACTG TTGATCCAGG AACGAAATCC    14505
                                                                  
.......... .......... .......... .......... .......... ..........      141


AAATTCTTAA GCCCAAATAT CAAATTGTTT TGGTGAAATG ATTAAATTAC TTTACAGATA    14445
                                                                  
.......... .......... .......... .......... .......... ..........      141


ACAACTGAAA ACATGTTAAC AACTTATAAT GCATAAAAAT CAGAGCATAT CAAACTGAT-    14386
                                               || |||| |   ||| |  
.......... .......... .......... .......... ...AGTATAT C--TCTGGTG      156


ATCAGACATC AAGAATCAG    14367
 |||| ||||  ||||  ||
TTCAGGCATC TAGAAGAAG      175





********************************************************************************
EST sequence   55 -strand (File: 12501667-)

     1  AGAGCATTAA ATATATATAA AAATAATAAC TAATTGCACA ATTTGTCTGT AATTTACGAG
    61  ACAAATCTTT TGAGCCTAGT TAGTCCATGA TTGGACAACA TTTGTCAAAT ACGAACGAAA
   121  GTGCTACAGT GTGCATTGAC ACAGCAGTTC TGATTCTGAG TATATCTCTG GTGTTCAGGC
   181  ATCTAGAAGA AGCCGTGAGA AAACCTAGAG CTTGTTGCTG CGCTTTGATC TCCATATCCT
   241  ATTGATTGGG TCAGGTGGTT GGAAATTCTG GAGTTGGCAG TGAGAACTTT TTGAATGAAC
   301  AATCCTATGA ACCTTAGATG TGATGCCATT TGTCTCTTTC ATCATTCTGA ATTCTGGTTC
   361  CTTGAATCAA

Predicted gene structure (within gDNA segment 17354 to 15412):

 Exon  1  17041  16912 ( 130 n);  cDNA      1    130 ( 130 n); score: 0.846

MATCH	21326110-	12501667-	0.846	130	0.351	C
PGS_21326110-_12501667-	(17041  16912)

Alignment (genomic DNA sequence = upper lines):

GAAGCATTAA ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG    16982
  |||||||| ||||||| || |||||| ||| ||||||||||  |||  || | || |  |||| 
AGAGCATTAA ATATATATAA AAATAATAAC TAATTGCACA ATTTGTCTGT AATTTACGAG       60


ATAAATCTTT TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA    16922
| |||||||| | | |||||| || || |||| || ||||| | |||||||||| |  ||||||| 
ACAAATCTTT TGAGCCTAGT TAGTCCATGA TTGGACAACA TTTGTCAAAT ACGAACGAAA      120


GTGCTACAGT    16912
|||||||||| 
GTGCTACAGT      130





********************************************************************************
EST sequence   48 -strand (File: 6859140-)

     1  TCTCCACAGT TTTTTTGACT GATAAGTCAT GACAAAAATC AATGATTGTT GTGAGAGAAA
    61  AACATTATTG AATGACGATA GATTTGGCTG ATAAGCTCAA ATAAATAGGC TTGACCAAAT
   121  TACGGTGAGT AGTGATTGAT ATGGTGTTTC GAGCATTGTT GTATGTATGA TTTATGTTCA
   181  GTTGTTCCTG ATTATATTTC CCGCAAACTG GAGGCAGCGG AAAAGTGGCT TTCAGGGAAA
   241  ACCGGAGGCA GCGGAAAACT ACGGCGTTGT TTAGTTTCCA AATCTTTTCA AGATTTTTCG
   301  TCACATCGAA TCTTGCGGCA CATGCATGAA ACACTGAATA TAGATAAAAA AGATAACTAA
   361  TTGCACAATT TACCTGTAAT TTGCGAGATG AATTTTTTAA ACCTAGTTAG TCTATAATTA
   421  AATAATAATT GTCAAATAAA ACCAAAAGTA CTACAATAAG CCTACCTTCC AAAC

Predicted gene structure (within gDNA segment 18945 to 16463):

 Exon  1  17091  16914 ( 178 n);  cDNA    278    455 ( 178 n); score: 0.820

MATCH	21326110-	6859140-	0.820	178	0.376	C
PGS_21326110-_6859140-	(17091  16914)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
| ||| |||| |||| ||||  ||  ||||||  ||| || ||  ||||||||| ||| || | | 
CCAAATCTTT TCAAGATTTT TCGTCACATC GAATCTTGCG GCACATGCAT GAAACACTGA      337


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| | || |||  | ||| ||||||||||  ||||||| | || | ||||| || ||| ||| 
ATATAGATAA AAAAGATAAC TAATTGCACA ATTTACCTGT AATTTGCGAG ATGAATTTTT      397


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTACA    16914
|||||||||| || ||||| | ||| | ||||  ||||||||| |||| | ||| || |||||
TAAACCTAGT TAGTCTATAA TTAAATAATA ATTGTCAAAT AAAACCAAAA GTACTACA      455





********************************************************************************
EST sequence   50 -strand (File: 6859177-)

     1  TCCACAGTTT TTTTGACTGA TAAGTCATGA CAAAAATCAA TGATTGTTGT GAGAGAAAAA
    61  CATTATTGAA TGACGATAGA TTTGGCTGAT AAGCTCAAAT AAATAGGCTT GACCAAATTA
   121  CGGTGAGTAG TGATTGATAT GGTGTTTCGA GCATTGTTGT ATGTATGATT TATGTTCAGT
   181  TGTTCCTGAT TATATTTCCC GCAAACTGGA GGCAGCGGAA AAGTGGCTTT CAGGGAAAAC
   241  CGGAGGCAGC GGAAAACTAC GGCGTTGTTT AGTTTCCAAA TCTTTTCAAG ATTTTTCGTC
   301  ACATCGAATC TTGCGGCACA TGCATGAAAC ACTGAATATA GATAAAAAAG ATAACTAATT
   361  GCACAATTTA CCTGTAATTT GCGAGATGAA TTTTTTAAAC CTAGTTAGTC TATAATTAAA
   421  TAATAATTGT CAAATAAAAC CAAAAGTACT ACAATAAGCC TACCTTCCAA AC

Predicted gene structure (within gDNA segment 18935 to 16463):

 Exon  1  17091  16914 ( 178 n);  cDNA    276    453 ( 178 n); score: 0.820

MATCH	21326110-	6859177-	0.820	178	0.377	C
PGS_21326110-_6859177-	(17091  16914)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
| ||| |||| |||| ||||  ||  ||||||  ||| || ||  ||||||||| ||| || | | 
CCAAATCTTT TCAAGATTTT TCGTCACATC GAATCTTGCG GCACATGCAT GAAACACTGA      335


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| | || |||  | ||| ||||||||||  ||||||| | || | ||||| || ||| ||| 
ATATAGATAA AAAAGATAAC TAATTGCACA ATTTACCTGT AATTTGCGAG ATGAATTTTT      395


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTACA    16914
|||||||||| || ||||| | ||| | ||||  ||||||||| |||| | ||| || |||||
TAAACCTAGT TAGTCTATAA TTAAATAATA ATTGTCAAAT AAAACCAAAA GTACTACA      453





********************************************************************************
EST sequence  110 +strand (File: 24978904+)

     1  GGCACGAGGG TTTGTTGTTG CTGCTAGTGG AACAATTTCC TCAGCTCATA GGATGCACAC
    61  GATTGATCGA GCTGAAGCAA ATCACCGGCA AGGCTGGGGT TGATGCGCGG ATCGTTGGCA
   121  TGATGATGGA GGCTTACCAG CCGCTTTGAT CCATCAAGGA TCGCTCTTTG CTATTCAGAA
   181  AGGCTACAGG CTCATTGCAG TTATGCCAGC TAAATATTTG CTTGACAAGC TGATCTTGCT
   241  GAGATTCATG GGTGCTGAGT TGTACTTAAC CGGTATGATT AGTTGAAGAA AGTTACGGTA
   301  TCACCTTAAT TGCTTTTTTC AGTCAAATTT CCTTGGTTAA GGAATTTTAT GGGTGGCCTT
   361  CTTCCTTTGG TGTACTGTAT GTGCAGATCC GGCCCTTGGC TTTGCGGGCA TGTTTGACAA
   421  AGTTGAACAG CTCCGAGAAC AACTGCCAAA TGTACTTGTT CTGAATCAAG TTACTAAAAA
   481  TTTGCAAAAT TTTTTCAGAT TCCCCGTCAC ATCGAATGTT TAGACGTATG CATGGAGTAT
   541  TAAATATAGA TGAAAATAAA AACTAATTAC ACAGTTTGGT CGGAATTGAT CAGACGAATC
   601  TTTTGAGCCT AGTTAGTCCA TAATTGGACA ATATTTGTCA AATACAAACG AAAATGCTAC
   661  TATTCCTATT TTGCAAAATT TTTTGGAAGT AAACAAGGCC TAAGAGAGCA AATTCTG

Predicted gene structure (within gDNA segment 18480 to 16489):

 Exon  1  17091  16914 ( 178 n);  cDNA    485    661 ( 177 n); score: 0.764

MATCH	21326110-	24978904+	0.764	178	0.248	C
PGS_21326110-_24978904+	(17091  16914)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
|||||  ||| || | ||| |  |  ||||||  ||| ||  | ||  |||||| | || ||||| 
CAAAATTTTT TC-AGATTCC CCGTCACATC GAATGTTTAG ACGTATGCAT GGAGTATTAA      543


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| |  | |||||||||| ||||| |||| ||||       || |    || |  ||||||| 
ATATAGATGA AAATAAAAAC TAATTACACA GTTTGGTCGG AATTGATCAG ACGAATCTTT      603


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTACA    16914
| | |||||| || || || | || ||||||| |||||||||| | ||||||||  |||||| 
TGAGCCTAGT TAGTCCATAA TTGGACAATA TTTGTCAAAT ACAAACGAAA ATGCTACT      661





********************************************************************************
EST sequence   44 -strand (File: 6675384-)

     1  TGTGTGATGC TCGATAAGTG GTGCACTGCA GAGAAATATA ATGGGCCAAC GGTGCATCAT
    61  TTTACAAGTT TAGGCCTGCC TTGTTTAGTC TTTTTAAAAT TCTCCGTCAC ATCGAATTTT
   121  ACGACATGAA ATATCAAATA TAGAGGAAAA TAAAAATTAA TTGCACAGTT TACCTGTAAA
   181  TCCGAGATAA ATCTTTTGAG CCTAGTTAGT CTATAATTAG ACAATAATTA CCAAATAAAA
   241  GCAAAAGTAA TACATGATGC ATTGCTTAAC AAGTTTAGAG AACTAGAATT ACAGACTCAA
   301  AAGATTCCTC GTGCCGAATT CGGCACGAGG GAGAGAACTA GTCTCGAGTT TTTTTTTTTT
   361  TTTTTTTTTT TTTGGAGAAA CAAAGCTTTG TTATTAGGAA CAGATTACAA ACTTCACATA
   421  TTCCACGCAA CCGATCGATT A

Predicted gene structure (within gDNA segment 18101 to 13697):

 Exon  1  17084  16914 ( 171 n);  cDNA     91    254 ( 164 n); score: 0.807
  Intron  1  16913  13778 (3136 n); Pd: 0.000 (s: 0.82), Pa: 0.000 (s:    0)
 Exon  2  13777  13753 (  25 n);  cDNA    255    277 (  23 n); score: 0.680

MATCH	21326110-	6675384-	0.807	196	0.444	C
PGS_21326110-_6675384-	(17084  16914,13777  13753)

Alignment (genomic DNA sequence = upper lines):

TTTTCAAAAT TTCTCAACAC ATCAAATATT ACGACACATG CATGAAGCAT TAAATATATA    17025
|||| ||||| |   |  ||| ||| ||| || |||  |||||  |  ||  ||  ||||||| | 
TTTTTAAAAT TCTCCGTCAC ATCGAATTTT ACG--ACATG -A--AA-TAT CAAATATAGA      144


CAAAAATAAA AACTAATTGC ACAGTTTACC TATAAATCGC GAGATAAATC TTTTAAACCT    16965
  |||||||| || ||||||| |||||||||| | |||||| | |||||||||| |||| | ||| 
GGAAAATAAA AATTAATTGC ACAGTTTACC TGTAAATC-C GAGATAAATC TTTTGAGCCT      203


AGTTACTCTA TGATTAGACA ATATTTGTCA AATAAAAACG AAAGTGCTAC AGTCTCAAAA    16905
||||| |||| | |||||||| ||| ||  || ||||||| |  |||||  ||| |          
AGTTAGTCTA TAATTAGACA ATAATTACCA AATAAAAGCA AAAGTAATAC A.........      254


ACCAAAAAGT TTTCGAAACT AAACAAGGCC TGACACTTGC ACATCTTTTT TAAAAAATAT    16845
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAGGCCCTGT TTAGTTCCCA CCTAAAAAAT TTTCATCCAT CACATTGAAT CTTTAGACAC    16785
                                                                  
.......... .......... .......... .......... .......... ..........      254


ATACATAAAA CATTAAATGT AGATAAAAAA TAATTACACA GTTTGGTTGA AAATCGCGAG    16725
                                                                  
.......... .......... .......... .......... .......... ..........      254


ATGAATTTTT TAAGCCTAGT TAGTCCATGA TTAGCCTTAA GTGCTACAGT AACCCACATG    16665
                                                                  
.......... .......... .......... .......... .......... ..........      254


TGCTAATAAT AGATTAATTA TACTTAATAG ATTCGTCTTG CAGTTTCCTG ACGAGTTATG    16605
                                                                  
.......... .......... .......... .......... .......... ..........      254


TAATTTGTTT TTTTTATTAG TTTTTAAAAA CCCCTCCCGA CATCCTTCCG ACATATCCGA    16545
                                                                  
.......... .......... .......... .......... .......... ..........      254


TGTGACCTAA AAAATTTTCA TCTTCAATCT AAACATGCCC TAAGTGAAAT GCAATAATGT    16485
                                                                  
.......... .......... .......... .......... .......... ..........      254


GTTGTAGAAC TTTTATAGGC TATCACACAT GTGGTAGGGC GAGACCATCA TTACATTCGA    16425
                                                                  
.......... .......... .......... .......... .......... ..........      254


AGAAGAAATA TATTCCGCAA TCCACAATTG GGATAAAATA GCAAATCATC GAAAAGGGCC    16365
                                                                  
.......... .......... .......... .......... .......... ..........      254


TGACCAATAA GAATCAGGTC AAGGGTTCAT ACAACTGTCA TCAGCTATGC AGAGCCAAAA    16305
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAAAAACATA TCATTGGGGT TTGCTATTAG ATCAATCAAT TGCTTATGCA GTTTCCAATA    16245
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAAAAAATGC TTATGCAAAT TTCTCCCATA TACAACTAAA GTTACATGAG CACATTCCTC    16185
                                                                  
.......... .......... .......... .......... .......... ..........      254


CTGAAACGTA ATACTGAAAG CATACTTTTG ATTTGAATGG TTGAATCTAC AAGCTATACG    16125
                                                                  
.......... .......... .......... .......... .......... ..........      254


GTTTGTTTCC AGAATCTGAT CGATCTATCA TTTCCACAAA TAACAAAAAC TGGTTCAACT    16065
                                                                  
.......... .......... .......... .......... .......... ..........      254


GGGGAGTGGT CGAGCCATCT GGGAGCACCA GTGCTGCCAG AGGGCAATCT TGCAACCTTT    16005
                                                                  
.......... .......... .......... .......... .......... ..........      254


TCTGCAGTAA GTGCATCCCA GACGACAACC TGAAGAGTGA CGTATCATAG TTAAGCTTGC    15945
                                                                  
.......... .......... .......... .......... .......... ..........      254


TGAAATACAA ATATATATAC TGTTCTCAAT TTGGAATTTA CCTCATTGTT TTGTTCATCA    15885
                                                                  
.......... .......... .......... .......... .......... ..........      254


ACTGATAGAA CAAATTCTTC GGTTTCATTG AAGACAGCCT GGATAGTAAG AACAGTTATT    15825
                                                                  
.......... .......... .......... .......... .......... ..........      254


ATCATATTTA TTGTCTATCA TAGCAAGGTT AGGTATGTTG TTATCCTAAG CTGCAAGCTC    15765
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAACCAGCCT ATTTTCAAAT TAAAGAATTG CAATATTTTG TTTCCTAAAA TTTTGGGTAA    15705
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAATAATATA TATGGCACAC GAGTAAATTT AAATCAGGAA AAAATAATAA TCTTATAGAA    15645
                                                                  
.......... .......... .......... .......... .......... ..........      254


ACACAGAGAA ACTAACCTGA CAACGAAATT GTCTGCGAAT GGCTCCTGCA TATTGCTTCA    15585
                                                                  
.......... .......... .......... .......... .......... ..........      254


CAAGTCGTCC AGTGCCAACT TCCCATAACT TGACACAAGA ATCTTTCCCA CAAGATAGGA    15525
                                                                  
.......... .......... .......... .......... .......... ..........      254


CATACCTGAA AGAACGTAGT AAACTTCATA ACAGATAACC AGAATACAGT GTGCAGTTTT    15465
                                                                  
.......... .......... .......... .......... .......... ..........      254


ATGAAAGAAA TCCATGAACT ATCTAAGCAT ATACTTCGGG TAGTCAAAGT TCACTACATC    15405
                                                                  
.......... .......... .......... .......... .......... ..........      254


AATTTTTTAG ATCAATCTTA TATGCAAGTG CATTCACGCT GCATATAACC ACATAAACAC    15345
                                                                  
.......... .......... .......... .......... .......... ..........      254


TAGGCCTTTC AGAAGAAGTC TAAAAAGTGT TTATAGGCAA GTTAGTTGTT TAGTGGTGAA    15285
                                                                  
.......... .......... .......... .......... .......... ..........      254


ATAGTAGGGT AAAGGAGAAA GAGTTATTCG TGTTATAAAG TTACGACACG TCTGAAACAC    15225
                                                                  
.......... .......... .......... .......... .......... ..........      254


AGGAAATTAT CCAGGACATG TTATAAATCA TTCAGAATCA CTACAAGATT CCCACATTCC    15165
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAACAGGGTT TGAAGTAGTT ACTGTCTTGA ATCATACAGC ATATGCCTTT CTCTCTGTTC    15105
                                                                  
.......... .......... .......... .......... .......... ..........      254


TTCAAACCAA ACAATGACTG GATTTTATCT TGAGGGAAGA GCACCTTAGA CATGCTGGTA    15045
                                                                  
.......... .......... .......... .......... .......... ..........      254


GCTCGCTTAC CTCTCATCTC TGGTGAAAAT TGCGCTAGTA GCTTCTGCAG ATCCATGTGC    14985
                                                                  
.......... .......... .......... .......... .......... ..........      254


TCCAATAATA GGTCGAACAC ATTCAGCAGA TACTCCATCC CAAATGCGCA GAGAACCATC    14925
                                                                  
.......... .......... .......... .......... .......... ..........      254


TTTAGAAGCA GTCACATACA AGCTCCCAGT ACAGGAGTAG CGTACCTGGC AGCAACATCA    14865
                                                                  
.......... .......... .......... .......... .......... ..........      254


GTAAGCATGG CTGGCGGAGA ACTTTGATGA GAATATAACC AATGCAATCT AATGCTTGTG    14805
                                                                  
.......... .......... .......... .......... .......... ..........      254


AATCAGAAGG AAAGAGAAAA GCTACCTGGT TAATGGGAGA ACTAGAATCC TGTGCATTTG    14745
                                                                  
.......... .......... .......... .......... .......... ..........      254


CTGATAAGTA GCATGTAAAA GTATTTATAT CATATAAATG AGCAACTGGG TGATCAGTCC    14685
                                                                  
.......... .......... .......... .......... .......... ..........      254


CTGCAAATAA TTTTATCAGT GTCACTTGCT TCCAAATATA TGAAAATGAG TTTTTTTAAA    14625
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAAAATACAT ATTTGAATGT TAATATTTGA CTATATGTAA GAAGAAAATT CCATACGATA    14565
                                                                  
.......... .......... .......... .......... .......... ..........      254


TGCTTGCAGT ATTTTTCAAA TGCCCACGAG ACAGAAACTG TTGATCCAGG AACGAAATCC    14505
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAATTCTTAA GCCCAAATAT CAAATTGTTT TGGTGAAATG ATTAAATTAC TTTACAGATA    14445
                                                                  
.......... .......... .......... .......... .......... ..........      254


ACAACTGAAA ACATGTTAAC AACTTATAAT GCATAAAAAT CAGAGCATAT CAAACTGATA    14385
                                                                  
.......... .......... .......... .......... .......... ..........      254


TCAGACATCA AGAATCAGTT AATCACAGCA GAACTAGAAA TCAAATTTAA ATTTAGTGAA    14325
                                                                  
.......... .......... .......... .......... .......... ..........      254


AAGATCATAG TACCTGCTAA AAGGTAATCC CCACAAGGAT GAAAACATAC AGATCTAACA    14265
                                                                  
.......... .......... .......... .......... .......... ..........      254


TTATGAGTAT CCTGCCAAGC ATTAACAAAT GAGCCTGGTT AAATGCAATG AACACACCAT    14205
                                                                  
.......... .......... .......... .......... .......... ..........      254


TTTACATGAT ATATAGAGAG ATTGGATTGC TAGAATTTAC AACCTGAATA ACTCTGAACG    14145
                                                                  
.......... .......... .......... .......... .......... ..........      254


CTTTCCTCGC ATTGGTCTTT GAGAAGTCAA AAAATCTGTT GAGCAAAATT TTTTCATGTA    14085
                                                                  
.......... .......... .......... .......... .......... ..........      254


CAAAACAATA ACACAGATAG CAATTAATAC CGCAAAAAAT TCCTAAAAAA TCATGCTTAA    14025
                                                                  
.......... .......... .......... .......... .......... ..........      254


TCCTAGTATG AGCACTTCAA ATAGACAATT TAACAGCACG GAGTGTAGAC ATCAAGGATA    13965
                                                                  
.......... .......... .......... .......... .......... ..........      254


AGCATACTTT ATTGTATTGT CTTTTGCAGC TGATATCAGT ATTGGACTCT CAGGATGAAA    13905
                                                                  
.......... .......... .......... .......... .......... ..........      254


ATCCAGATCA TTGATGGCCT GCAAGAAATC AATCATGTTT ACGAGCACAG TGGAAATTTG    13845
                                                                  
.......... .......... .......... .......... .......... ..........      254


AGCAATGGGA AATGAAGTAG AAACTAGTGA AAATGGAAAA AAATGTTGTT TATTAAAAAA    13785
                                                                  
.......... .......... .......... .......... .......... ..........      254


TTGAATATCA TGTCAATGCT CCACACAGCT CA    13753
       | | || || ||||   ||| || |  |
.......TGA TG-CATTGCT TAACA-AGTT TA      277





********************************************************************************
EST sequence   51 -strand (File: 6859195-)

     1  TGCATGAAAC ACTGAATATA GATAAAAAAG ATAACTAATT GCACAATTTA CCTGTAATTT
    61  GCGAGATGAA TTTTTTAAAC CTAGTTAGTC TATAATTAAA TAATAATTGT CAAATAAAAC
   121  CAAAAGTACT ACAATAAGCC TACCTTCCAA AC

Predicted gene structure (within gDNA segment 17479 to 16463):

 Exon  1  17046  16914 ( 133 n);  cDNA      1    133 ( 133 n); score: 0.835

MATCH	21326110-	6859195-	0.835	133	0.875	C
PGS_21326110-_6859195-	(17046  16914)

Alignment (genomic DNA sequence = upper lines):

TGCATGAAGC ATTAAATATA TACAAAAATA AAAACTAATT GCACAGTTTA CCTATAAATC    16987
|||||||| | | | ||||||  | |||||   | |||||||| ||||| |||| ||| ||| |  
TGCATGAAAC ACTGAATATA GATAAAAAAG ATAACTAATT GCACAATTTA CCTGTAATTT       60


GCGAGATAAA TCTTTTAAAC CTAGTTACTC TATGATTAGA CAATATTTGT CAAATAAAAA    16927
||||||| || | |||||||| ||||||| || ||| |||| |  |||| |||| |||||||||  
GCGAGATGAA TTTTTTAAAC CTAGTTAGTC TATAATTAAA TAATAATTGT CAAATAAAAC      120


CGAAAGTGCT ACA    16914
| ||||| || |||
CAAAAGTACT ACA      133





********************************************************************************
EST sequence  123 +strand (File: 8548455+)

     1  TGGATCTGGC ATGGATCTCA GGAGCAAAGC CAGGGTAAGA TAAAAAGATT CCCTGCACTA
    61  GGAGGGGACG GTATCCCGGG ATACTGTTTG TGGTGGCTCG TCACTACTCA CTTATCCTAT
   121  CACTTATCTC TGAAGTCACC ATCCGCTGAG CTGTTCTTTG GCTTATATAC AAGAGCTCTG
   181  CTCACCACTA CCACTGCAAT TGAATTTTTT TTTCTCTTCT GTTTACTTCC CAGAAAATTT
   241  TGCAAAATTT TTCACATTCC CTGTCACATC GAATCTTTAG ACGCATGCAT GGAGTATTAA
   301  ATATAGACGA AAATAAAAAC TAATTGCATA GTTTGGTCGA AATTAACGAG ACGAATCTTT
   361  TGAACCTAGT TAGTACATGA TTGGACAATA TTTGTCAAAT ACAAACGAAA ATGCTA

Predicted gene structure (within gDNA segment 19599 to 16551):

 Exon  1  17091  16916 ( 176 n);  cDNA    243    416 ( 174 n); score: 0.790

MATCH	21326110-	8548455+	0.790	176	0.423	C
PGS_21326110-_8548455+	(17091  16916)

Alignment (genomic DNA sequence = upper lines):

CAAAAACTTT TCAAAATTTC TCAACACATC AAATATTACG ACACATGCAT GAAGCATTAA    17032
| |||| ||| || | ||| |     ||||||  ||| ||  | || ||||||| | || ||||| 
C-AAAATTTT TC-ACATTCC CTGTCACATC GAATCTTTAG ACGCATGCAT GGAGTATTAA      300


ATATATACAA AAATAAAAAC TAATTGCACA GTTTACCTAT AAATCGCGAG ATAAATCTTT    16972
||||| || | |||||||||| |||||||| | ||||       || |  |||| |  ||||||| 
ATATAGACGA AAATAAAAAC TAATTGCATA GTTTGGTCGA AATTAACGAG ACGAATCTTT      360


TAAACCTAGT TACTCTATGA TTAGACAATA TTTGTCAAAT AAAAACGAAA GTGCTA    16916
| |||||||| || |  |||| || ||||||| |||||||||| | ||||||||  |||||
TGAACCTAGT TAGTACATGA TTGGACAATA TTTGTCAAAT ACAAACGAAA ATGCTA      416





********************************************************************************
EST sequence  141 +strand (File: 11679374+)

     1  ATCTTCTCAA AAACAAAAGA TTTCCCACAT GTCAGCTGGG TTGCCCAAAA GCTTCTCGAT
    61  CGCCATTTTC GTGCTATAGA GGAGCCAAAA CATTCCTTAG AGTTTATTCA TCTTCCATCG
   121  AAATAATCTG GATATCGACT TGGAAACTCT TTCCACCAAA TCTCTTCGTT TTAATTCACA
   181  TCTGGCAATC TTTAACAATT ACTAGTAGTA CTTGATTCCA TTTTCAGTGA ACAACTGCCA
   241  ATTGTGAACN ANNNNNNGCC AATATCATAT TCCATGCATG CATGCACACC AAACGCATGG
   301  CATCCCGTCC CATCCACCTC CAAAATCATT CGCTCCCATC CATACAAATT ACAAAGGCCT
   361  TGTTTAGTTC AGCCTAAAAA CCAAAAATTT TACAAGATTT TCCGTCGTAT CAAATCTTAC
   421  GGCACATGAA GCATTAAATA TAAATATAAA TAAAAACTAA TTGAACAGTT TGTCTGTAAA
   481  TCACGAGATG AATTT

Predicted gene structure (within gDNA segment 19464 to 16412):

 Exon  1  19464  19434 (  31 n);  cDNA    340    368 (  29 n); score: 0.581
  Intron  1  19433  17105 (2329 n); Pd: 0.912 (s:    0), Pa: 0.000 (s: 0.76)
 Exon  2  17104  16974 ( 131 n);  cDNA    369    495 ( 127 n); score: 0.794

MATCH	21326110-	11679374+	0.794	162	0.327	C
PGS_21326110-_11679374+	(19464  19434,17104  16974)

Alignment (genomic DNA sequence = upper lines):

CTATGCACAA GCACAAATGG GTCCGCTTAT GGTAAACTGG CATGGACAAG TTTCATCTGC    19405
| || || ||   ||||| ||     | |||                                   
CCATACA-AA TTACAAA-GG CCTTGTTTAG T......... .......... ..........      368


CACTTCATTT TGTTTGTTAC ATCGATGTGA AGTTTCTTGA ACTATGGATT TGAATGGCAA    19345
                                                                  
.......... .......... .......... .......... .......... ..........      368


AACAAACACT GTTTAGAATA CCGTGTTGCG CTTTGACATG GTTCTTGTCA GCTGGGCAGC    19285
                                                                  
.......... .......... .......... .......... .......... ..........      368


TACACCAAAA TCACCTGTTT TGCACATTGT TGTGGCGCCA CAGCATGCCG ACCACAGAGT    19225
                                                                  
.......... .......... .......... .......... .......... ..........      368


CAGGACATGC AGAAATATGG GTGCTAAGAA TGCAAACTAA AACTTTTGAA GAAAACAAAT    19165
                                                                  
.......... .......... .......... .......... .......... ..........      368


GTGCTTACCC AACTTCACCT CGCCTTGCTC AGTTAGAAGA ATGTTGCCAC CCTTAATATC    19105
                                                                  
.......... .......... .......... .......... .......... ..........      368


TCTATGAACT TTAAAAATGG AGTGCAGGTA AGCAAGGCCC TGGAAGAAAA TAAGCACGCA    19045
                                                                  
.......... .......... .......... .......... .......... ..........      368


AAAGTTCAAT ATCCAAATAC ATTTAGTTGC CCAACAAGGC AGCAAATACT TCAAATCTGA    18985
                                                                  
.......... .......... .......... .......... .......... ..........      368


TGCAACTATG TTAGAACCTT TAGTGCTTCT CTACATATAT AAGCTATTTG GGATTCATCA    18925
                                                                  
.......... .......... .......... .......... .......... ..........      368


AGAGGCTCCT CTGTGATGCC TATCAAATCA GCAACACTTC CACCACCACA GTACTCCATA    18865
                                                                  
.......... .......... .......... .......... .......... ..........      368


ACTATCTGTA AGTTGAGAAT CGCATTTGCA TCAAGCCCAT GTTAAATGAC TCAAGAAGTA    18805
                                                                  
.......... .......... .......... .......... .......... ..........      368


GAGAAATCTC CCAATGATAG TTATTTCTTA ATGTTAATAA AATGGATACT ATCAGGCTAT    18745
                                                                  
.......... .......... .......... .......... .......... ..........      368


TTGATTGTAC CCATAGGTAG TCCTCTCCTT GGTAGCTTCC AAAGTAGCGG ACAACATTTG    18685
                                                                  
.......... .......... .......... .......... .......... ..........      368


GATGGCTACA CTGCTGCAGC ATCTCAATTT CTCCCCGTAT GTCTTCATAT CCTTCTTCCT    18625
                                                                  
.......... .......... .......... .......... .......... ..........      368


GAAAACCAAA GATACATACT TATATTTTGG AAAAATGCAA CGACTCGGAA AACAGACAGC    18565
                                                                  
.......... .......... .......... .......... .......... ..........      368


AACCACATTT ATGAGATTCT CTCACAATTG AGCCCATGCA AACAAAATGC TCACAACAAA    18505
                                                                  
.......... .......... .......... .......... .......... ..........      368


AGCAATATGG TTGCCAAATA TGAAATATGT CTCGGGTGGC CTTTCAGAAT ATTCACAGAA    18445
                                                                  
.......... .......... .......... .......... .......... ..........      368


CTTTGTAATA GAAAATTAGA AACTAACCCC TTCTGTTAGT GAGATAATCT TGACAGCCAC    18385
                                                                  
.......... .......... .......... .......... .......... ..........      368


AAGCTCCTGC GTTCTGAGAT CCCTTGCTTT GTACACTGCA CCATATGAGC CTTTCCCTGC    18325
                                                                  
.......... .......... .......... .......... .......... ..........      368


ATTCCCAATT GAATTTTGCA TTTCGCAAAA CAGCTCAAAG CTTCAGCCAT TCTACAAGTA    18265
                                                                  
.......... .......... .......... .......... .......... ..........      368


GACATACAGA ACTAATGAAA CAATAATTCC AGAGCAAGAG GCGCACCAAG CTCATGGAGC    18205
                                                                  
.......... .......... .......... .......... .......... ..........      368


AGCTCGTACT TGGTGGAAGG ATCCTCTCTG GTAACACTGT CTGGCGCCGA GCTCACTGAT    18145
                                                                  
.......... .......... .......... .......... .......... ..........      368


GGCTTCCGCC TTGAATGCTG CTGCTGTTGT TGCTGCATCA GAGGCGACGG TTGCCGGAGC    18085
                                                                  
.......... .......... .......... .......... .......... ..........      368


TCCTCTGTCT GCTCCACCGC TGGACTCCAG AAAGAGGACC CGAAACCCCC GCCGCCGCCA    18025
                                                                  
.......... .......... .......... .......... .......... ..........      368


GAAGCAGATT CATAGGAACT GGAACCCCCG CTGGTGTGGC GAATGAAGGT GCCAGAGAAC    17965
                                                                  
.......... .......... .......... .......... .......... ..........      368


GACCCGCGGG GGCTCGACGG GCTCCCTGGT CGGCGGATGA ATGTGCCGGA GACCGAGTCC    17905
                                                                  
.......... .......... .......... .......... .......... ..........      368


CGGGGGCTCG ACGGGGTGCT AGTCCGGCGG ATGAATGTGC CAGAGACGGA TTCGTGAGGG    17845
                                                                  
.......... .......... .......... .......... .......... ..........      368


CTGGACGAGC CCCCGGAGCG ACGGATGAAT GTGCCTGAGG CGGACCCTCG AGGGCTGGAG    17785
                                                                  
.......... .......... .......... .......... .......... ..........      368


GAGGTCCCCC CCGAGCGTGC GGTGGAGTGG ACGACGAAGG TAGAGTATGG GTCGTCATCG    17725
                                                                  
.......... .......... .......... .......... .......... ..........      368


GTAGCGCGGG GGCTGGAGCG CCGCAGATCC AGGAACGGAG ATCGAGCGGA GGCCGGGGCG    17665
                                                                  
.......... .......... .......... .......... .......... ..........      368


CCGCTCTTGA AGACCACCGT AGCGGAGAGG GAAGCATCGT CGGGGTCGGA GGAGTAGGCG    17605
                                                                  
.......... .......... .......... .......... .......... ..........      368


TCCTCGTCTT CGTCAAAGGA GGGGCCGCCG AAGTCCTTGG GGAGCCGCTG GAGAAGCGGA    17545
                                                                  
.......... .......... .......... .......... .......... ..........      368


GGCAGCGAGG AGGGGTCTTC CTCCTCGTCT TCCTCCGCCC GCGTGGACGG GCCCCTGCCG    17485
                                                                  
.......... .......... .......... .......... .......... ..........      368


CGCCTGCTGC CGCGGGCGTC GTCCTCGTCG TCATCGCCGT GGACGACGAA GGTTGAGTAG    17425
                                                                  
.......... .......... .......... .......... .......... ..........      368


ACGTCGTTTC TCTTGGGACG CGACCACGGC GAGCGCGGGG AGAAAGCCAT GGCGTGCCAC    17365
                                                                  
.......... .......... .......... .......... .......... ..........      368


GCGAGGTGGG AGGAGACGGT GAAGGTGCTC GTCGGGAATG GCAAATGGGG AAAATTGTTT    17305
                                                                  
.......... .......... .......... .......... .......... ..........      368


AGTTGGAGCC AGTTCACTCG AATCTGGCAA ATATGGGTCG GGCTCGGATG GGCCATCCCA    17245
                                                                  
.......... .......... .......... .......... .......... ..........      368


TTCTAGGCCC ACGTGACATA GAGAATCCGG TCAAATTCTT CCTTCCCGCA GTCCCGCTAG    17185
                                                                  
.......... .......... .......... .......... .......... ..........      368


GCCCACACGA CCACACCCAG TCACCCGCAG CCACAGGCCG CAGAGAGCTT CCTCGAAAGG    17125
                                                                  
.......... .......... .......... .......... .......... ..........      368


AGCTTCTCTT TTTTCTCCAC TCACCCCAAA AACCAAAAAC TTTTCAAAAT TTCTCAACAC    17065
                      ||| || ||| |||||||||  ||| ||| || ||  |  |   
.......... .......... TCAGCCTAAA AACCAAAAAT TTTACAAGAT TTTCCGTCGT      408


ATCAAATATT ACGACACATG CATGAAGCAT TAAATATATA CAAAAATAAA AACTAATTGC    17005
||||||| || |||   ||   |||||||||| |||||||| |  | ||||||| |||||||||  
ATCAAATCTT ACG--GCA-- CATGAAGCAT TAAATATAAA TATAAATAAA AACTAATTGA      464


ACAGTTTACC TATAAATCGC GAGATAAATC T    16974
|||||||  | | |||||| | ||||| |||  |
ACAGTTTGTC TGTAAATCAC GAGATGAATT T      495





********************************************************************************
EST sequence  129 +strand (File: 14514413+)

     1  GATGCAATAA GGAAGGAAGG CTGCAACGTC CACGGCTACT TTGTATGGTC ACTGCTAGAT
    61  AACTGGGAGT GGAACTCTGG GTACACGGTG CGGTTTGGAC TCTACTACAT TGACTACAAC
   121  AACAACCTGA CAAGGATTCC CAAGGCGTCA GTGGAATGGT TCAAGCAGGT CTTAGCCCAA
   181  AAGACGGCTA ATTTGGAGTA CAGTGGTTCG ACAATAGCCA GTAGTTAAGT GTATATAATA
   241  TCTACAGCTA CCATCTCTAC ATGCTTTGCG TACCTTTGGA TTAGATTGTG ATTATTCTCA
   301  AATGTATATA GCCCACCATT TGGACGACCT TCAACCGTCC AGTTGAATGT GTCGTTATGC
   361  TTGTCATACA TGGCCTTGTT TAGTTCACCC CAGAAACCAA AAACTTTTCA AGATTCTCCA
   421  TCACATCAAA TCTTGTAGCA CATACATGAA ACACTAAATA TAGACGAAAA TAAAAACTAA
   481  TTGCACAGTT TACCT

Predicted gene structure (within gDNA segment 19360 to 16689):

 Exon  1  17104  16994 ( 111 n);  cDNA    385    495 ( 111 n); score: 0.856

MATCH	21326110-	14514413+	0.856	111	0.224	C
PGS_21326110-_14514413+	(17104  16994)

Alignment (genomic DNA sequence = upper lines):

TCACCCCAAA AACCAAAAAC TTTTCAAAAT TTCTCAACAC ATCAAATATT ACGACACATG    17045
|||||||| | |||||||||| ||||||| || |   || ||| ||||||| ||     |||||  
TCACCCCAGA AACCAAAAAC TTTTCAAGAT TCTCCATCAC ATCAAATCTT GTAGCACATA      444


CATGAAGCAT TAAATATATA CAAAAATAAA AACTAATTGC ACAGTTTACC T    16994
|||||| ||  |||||||| | | |||||||| |||||||||| |||||||||| |
CATGAAACAC TAAATATAGA CGAAAATAAA AACTAATTGC ACAGTTTACC T      495





********************************************************************************
EST sequence   17 +strand (File: 25451626+)

     1  GCCGTCCTCC GCCCCACCTC CCTCCCATGG CCTTCTCCCC GCGCTCGCCG TGGTCGCGCT
    61  CCAAAAAGCC CGACATCTAC TCCACCGTTG TGGTCCACGA CGACGAGGAC GACGCCCGCG
   121  GCGGCGGCGC CGCCCGCGCG GAGGATGACG ACGACGACGA CCCCTCCGCG CTGCCCCCGC
   181  TCCTCCAAGC GCCTCCCCAA GGACTTCGGN GGNGCGTCCT TCGAACGACG AANAACAACC
   241  TTACTCCTCG GACCTCGAAG AAGCCTCGCT CTCCGGCAAC GTNGTCAANA AAGCGGCGGG
   301  GGCCCCGCCT NCAAATTGTN CTCCTCCCGA TTCCCGTTTC TGGATTTGNN GCGNTTCAAG
   361  CCCCGNGGCG GCCAAAGGCG AACCGTTNTN CAACTTNCTC GTCCAAGGGA ACGNGCGCTN
   421  CGGGGGGGGG CCTNCAAACC CCGNGAATTC GTNTCCCGGA AGNTTANAAC CCANTNCGGG
   481  NGGGCCCCCA AACCCCGNGA GTCCTTTTTC GGGAAAAATT ANTCGGCAAA AANCGTGGGT
   541  TCTCCAAACC CCAAAAANNT NTTTCCGGGA AGNTTAATTA A

Predicted gene structure (within gDNA segment 16921 to 19742):

 Exon  1  17372  17665 ( 294 n);  cDNA     24    297 ( 274 n); score: 0.745

MATCH	21326110+	25451626+	0.745	294	0.506	C
PGS_21326110+_25451626+	(17372  17665)

Alignment (genomic DNA sequence = upper lines):

GCCATGGCTT TCTCCCCGCG CTCGCCGTGG TCGCGTCCCA AGAGAAACGA CGTCTACTCA    17431
 ||||||| | |||||||||| |||||||||| |||||  ||| | |    ||| | |||||||  
CCCATGGCCT TCTCCCCGCG CTCGCCGTGG TCGCGCTCCA AAAAGCCCGA CATCTACTCC       83


ACCTTCGTCG TCCACGGCGA TGACGACGAG GACGACGCCC GCGGCAGCAG GCGCGGCAGG    17491
||| | || | ||||   |    ||||||||| |||||||||| || |  ||   | |||||    
ACCGTTGTGG TCCA---C-- -GACGACGAG GACGACGCCC GC-G--GC-- G-GCGGC---      128


GGCCCGTCCA CGCGGGCGGA GGAAGACGAG GAGGAAGACC CCTCCTCGCT GCCTCCGCTT    17551
 | ||| ||  |||  ||||| ||| |||||  || || |||| ||||| |||| ||| |||||  
-G-CCG-CC- CGC--GCGGA GGATGACGAC GACGACGACC CCTCCGCGCT GCCCCCGCTC      182


CTCC-AGCGG CTCCCCAAGG ACTTCGGCGG CCCCTCCTTT G-ACGAAGAC GAGGACGCCT    17609
|||| ||||  |||||||||| ||||||| ||   | |||||  | |||| ||   |  |  | | 
CTCCAAGCGC CTCCCCAAGG ACTTCGGNGG NGCGTCCTTC GAACGACGAA NAACAACCTT      242


ACTCCTCCGA CCCCGACGAT GCTTCCCTCT CCGCTACGGT GGTCTTCAAG AGCGGC    17665
||||||| || || ||| ||  || || |||| |||  |  ||  |||   ||  ||||||
ACTCCTCGGA CCTCGAAGAA GCCTCGCTCT CCGGCAACGT NGTCAANAA- AGCGGC      297





********************************************************************************
EST sequence   82 +strand (File: 2352083+)

     1  ATAGATGGAT CATAACTCGC CGAAATCTCG TCGGAGCCGG AAACCGGAGC CCAAACCTGA
    61  CATATACTCC ACTTTCGTAG TCCACTCCGA CTCTGATTCT GATCAAGGTC GAGATCGAGA
   121  CAAACGTAAA GCCAAACCTG AGGAAGACGA AAATGTCGAT TTATACGCTA CAATGGTCTA
   181  CAAAGGCGAT AGTGACGGAG AAGGAGAGGA AGATGATGAT GACGATTCTA TGCTTCCTCC
   241  TCTTCTCAAG CGTCTTCCCA AGGATTTCGG AGGCGGCGCG TCGCTCGATT ACGACGACGA
   301  CGACGGTGAT GAATCTGGAG ATTTCGGTAC GATGATTGTG AAAACAGATC GGAGTAGTCA
   361  TAGTAAGAAG AACAGTCCGT ACTCGTCCAA ACCGCGAATG GGAGTTAGTC CTAGGAGGAG
   421  AGCGAGAGGC GGAGATGAGG AATCTTCTGA TGAAGAAGAC GAAGAAGAAG ATGATGATGA
   481  CGACGACGGA GACTACGGTA CGTTTGTTGT GAAATCTAAG GATAAAAAGG GAAAGAAGAA
   541  AGACAAGGAG ATTGATATGA CAACTATGGG AAGAGCTGTT GCGAGTATGC AGAAATCAAA
   601  TTTTGGTGGT AAGACTCGGA AATTGGATCC TTCCTCTTCT TCTTCGAAAC TTCACGGTGA
   661  AGATAATCGG AAAATGCAGC AGCAAAACAG TAAGATGTCG ACTACGTCTC TTCCGGATAG
   721  CATTACTAGA GAAGATCCAA CCACCAAATA CGAATTCCTC AATGAACTTG GGAAAGGATC
   781  ATATGGATCT GTATACAAGG CAAGAGATTT GAAAACATCA GAGATTGTTG CTGTGAAAGT
   841  CATATCACTT ACTGAAGGGG AGGAGGGGTA TGAAGAGATC CGGGGAGAAA TTGAGATGCT
   901  GCAGCAATGT AATCATCCTA ATGTTGTCCG CTACCTAGGG AGTTACCAAG GAGAAGATTA
   961  TCTTTGGATA GTGATGGAGT ATTGTGGAGG TGGAAGTGTT GCTGATCTTA TGAATGTTAC
  1021  TGAGGAGGCG TTAGAGGAGT ATCAGATAGC ATATATATGT CGGGAGGCGT TGAAGGGCCT
  1081  TGCATACTTG CACTCAATAT ATAAAGTCCA TAGAGACATT AAAGGTGGAA ATATCTTGTT
  1141  AACTGAACAA GGAGAGGTCA AGTTGGGTGA CTTTGGGGTT GCAGCTCAAC TTACTCGCAC
  1201  TATGTCGAAG CGAAACACGT TCATTGGGAC TCCACATTGG ATGGCCCCAG AGGTTATTCA
  1261  GGAAAATCGT TATGATGGGA AGGTTGATGT ATGGGCTCTT GGTGTTTCAG CTATTGAGAT
  1321  GGCAGAGGGG CTCCCTCCAA GATCATCAGT TCATCCGATG AGGGTTTTGT TCATGATATC
  1381  CATCGAGCCA GCTCCAATGC TCGAGGATAA AGAAAAATGG TCCCTGGTCT TTCATGATTT
  1441  TGTTGCAAAG TGCCTCACAA AGGAACCACG TCTTCGCCCA ACTGCAGCTG AGATGCTTAA
  1501  GCACAAATTT GTTGAGAGAT GTAAAACTGG GGCTTCTGCA ATGTCGCCAA AGATTGAGAA
  1561  GTCCAGACAA ATCAGAGCTA CAATGGCTCT GCAAGCGCAA AGTGTTGTCG CACCTTCTTT
  1621  GGAGGACACT TCAACACTGG GTCCAAAATC AAGCGAGGAG CTTGGAATTA CTGTTCCATC
  1681  TAAACCTCCT CAAAATTCGA CCGAAGCACC TCTAACCAGC ACCCTGAATC GGCAGCATAT
  1741  TACTGGCAAC ACTGTGTTGG CTGGAGAAGG TGGTGACTTC GGAACTATGA TCGTTCATGG
  1801  TGAGGATGAG ACAGAGGAGA GTGACTCCAG GTCTCAGCTT GTCAGAGAAA AAGAATCTTC
  1861  ATCTTCTCAG TTTGAAGGTG TTCCTCGCGA ATTCCCAGGA GAAGAATTAC CTGACTCATG
  1921  GATACATGAC AAAAAGAAGC CTCCGGCTAT TGATCTTCCA GTTGAAGCTT CGATTTCACA
  1981  GAGCATGCAG GCAAGTTCAT CTCATGAGCA TAGAACCAAG CTACATAACA TAGCTGGAAC
  2041  ACAGATGGAA GGTGGCAGTG ATGCAAGTGG TAGTACCTTG AAAAATGAAA CTGTTGGCAG
  2101  GAAAGCTTTT GCTTTGCAAG ATAAGTTATG GTCAATCTAC GCAGCTGGAA ACACAGTACC
  2161  GATACCGTTC TTGAGAGCAA CAGATATATC CCCAATCGCA CTCTTGTCAG AGAACATGAT
  2221  CGGAGGCATG CAACAAGATG GGAATGGAAC TGTAGCCGTC GAAGCACTTC AGGAGCTCTT
  2281  CACTTCTTCT GATCCCCAAT CCAAAAAGGG CCGACGTGGA CAAAACGAGA TGCCTCTTCC
  2341  TCCAAGCGTA TACCAAAGAC TGACAACAAG CTCTTCTCTG ATGAACCTTG CACAAGTTTT
  2401  AGCCTACCAC AGAGCGTGTT ACGAGGAAAT GCCGCTGCAG GAATTGCAAG CAACGCAGGA
  2461  GCAGCAAACC ATTCAGAATC TGTGCGATAC TCTTCGCACT ATTCTCCGCC TCTAAATAGT
  2521  CTTGTGTTCA TATCTGTTGC TACTCTTGTA TTAGTATAGG TCGTCTCAGC AAGTACATGT
  2581  TTATTTTCCT AGAAGTTTTT ATTAAAAACC AATCAATTTT GTCTCCTCTT AGCACAATTG
  2641  CTAGAAGATT GAATGGAACA AACGGATTTT GTAACACTCG TATAAATAGT ATCCCCTTAG

Predicted gene structure (within gDNA segment 14914 to 22500):

 Exon  1  15495  15519 (  25 n);  cDNA    691    716 (  26 n); score: 0.680
  Intron  1  15520  18164 (2645 n); Pd: 0.679 (s:    0), Pa: 0.000 (s: 0.74)
 Exon  2  18165  18218 (  54 n);  cDNA    717    770 (  54 n); score: 0.759
  Intron  2  18219  18328 ( 110 n); Pd: 0.941 (s: 0.76), Pa: 0.878 (s: 0.72)
 Exon  3  18329  18417 (  89 n);  cDNA    771    859 (  89 n); score: 0.742
  Intron  3  18418  18626 ( 209 n); Pd: 0.993 (s: 0.70), Pa: 0.998 (s: 0.88)
 Exon  4  18627  18734 ( 108 n);  cDNA    860    967 ( 108 n); score: 0.843
  Intron  4  18735  18859 ( 125 n); Pd: 0.980 (s: 0.82), Pa: 0.787 (s: 0.80)
 Exon  5  18860  18967 ( 108 n);  cDNA    968   1075 ( 108 n); score: 0.741
  Intron  5  18968  19065 (  98 n); Pd: 0.000 (s: 0.68), Pa: 0.953 (s: 0.84)
 Exon  6  19066  19156 (  91 n);  cDNA   1076   1166 (  91 n); score: 0.813
  Intron  6  19157  19270 ( 114 n); Pd: 0.984 (s: 0.78), Pa: 0.000 (s: 0.74)
 Exon  7  19271  19323 (  53 n);  cDNA   1167   1219 (  53 n); score: 0.755
  Intron  7  19324  20843 (1520 n); Pd: 0.770 (s: 0.74), Pa: 0.962 (s: 0.90)
 Exon  8  20844  20906 (  63 n);  cDNA   1220   1282 (  63 n); score: 0.905
  Intron  8  20907  21626 ( 720 n); Pd: 0.929 (s: 0.90), Pa: 0.999 (s: 0.82)
 Exon  9  21627  21671 (  45 n);  cDNA   1283   1327 (  45 n); score: 0.822
  Intron  9  21672  21777 ( 106 n); Pd: 0.992 (s: 0.82), Pa: 0.998 (s:    0)
 Exon 10  21778  21813 (  36 n);  cDNA   1328   1363 (  36 n); score: 0.722
  Intron 10  21814  22451 ( 638 n); Pd: 0.596 (s:    0), Pa: 0.894 (s: 0.84)
 Exon 11  22452  22500 (  49 n);  cDNA   1364   1412 (  49 n); score: 0.837

MATCH	21326110+	2352083+	0.793	721	0.267	C
PGS_21326110+_2352083+	(15495  15519,18165  18218,18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)

Alignment (genomic DNA sequence = upper lines):

TATGAAGTTT ACTACGT-TC TTTCAGGTAT GTCCTATCTT GTGGGAAAGA TTCTTGTGTC    15553
|| || ||   ||||||| || || | |                                      
TAAGATGTCG ACTACGTCTC TTCCGG.... .......... .......... ..........      716


AAGTTATGGG AAGTTGGCAC TGGACGACTT GTGAAGCAAT ATGCAGGAGC CATTCGCAGA    15613
                                                                  
.......... .......... .......... .......... .......... ..........      716


CAATTTCGTT GTCAGGTTAG TTTCTCTGTG TTTCTATAAG ATTATTATTT TTTCCTGATT    15673
                                                                  
.......... .......... .......... .......... .......... ..........      716


TAAATTTACT CGTGTGCCAT ATATATTATT TTTACCCAAA ATTTTAGGAA ACAAAATATT    15733
                                                                  
.......... .......... .......... .......... .......... ..........      716


GCAATTCTTT AATTTGAAAA TAGGCTGGTT TGAGCTTGCA GCTTAGGATA ACAACATACC    15793
                                                                  
.......... .......... .......... .......... .......... ..........      716


TAACCTTGCT ATGATAGACA ATAAATATGA TAATAACTGT TCTTACTATC CAGGCTGTCT    15853
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCAATGAAAC CGAAGAATTT GTTCTATCAG TTGATGAACA AAACAATGAG GTAAATTCCA    15913
                                                                  
.......... .......... .......... .......... .......... ..........      716


AATTGAGAAC AGTATATATA TTTGTATTTC AGCAAGCTTA ACTATGATAC GTCACTCTTC    15973
                                                                  
.......... .......... .......... .......... .......... ..........      716


AGGTTGTCGT CTGGGATGCA CTTACTGCAG AAAAGGTTGC AAGATTGCCC TCTGGCAGCA    16033
                                                                  
.......... .......... .......... .......... .......... ..........      716


CTGGTGCTCC CAGATGGCTC GACCACTCCC CAGTTGAACC AGTTTTTGTT ATTTGTGGAA    16093
                                                                  
.......... .......... .......... .......... .......... ..........      716


ATGATAGATC GATCAGATTC TGGAAACAAA CCGTATAGCT TGTAGATTCA ACCATTCAAA    16153
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCAAAAGTAT GCTTTCAGTA TTACGTTTCA GGAGGAATGT GCTCATGTAA CTTTAGTTGT    16213
                                                                  
.......... .......... .......... .......... .......... ..........      716


ATATGGGAGA AATTTGCATA AGCATTTTTT TTATTGGAAA CTGCATAAGC AATTGATTGA    16273
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCTAATAGCA AACCCCAATG ATATGTTTTT TTTTTGGCTC TGCATAGCTG ATGACAGTTG    16333
                                                                  
.......... .......... .......... .......... .......... ..........      716


TATGAACCCT TGACCTGATT CTTATTGGTC AGGCCCTTTT CGATGATTTG CTATTTTATC    16393
                                                                  
.......... .......... .......... .......... .......... ..........      716


CCAATTGTGG ATTGCGGAAT ATATTTCTTC TTCGAATGTA ATGATGGTCT CGCCCTACCA    16453
                                                                  
.......... .......... .......... .......... .......... ..........      716


CATGTGTGAT AGCCTATAAA AGTTCTACAA CACATTATTG CATTTCACTT AGGGCATGTT    16513
                                                                  
.......... .......... .......... .......... .......... ..........      716


TAGATTGAAG ATGAAAATTT TTTAGGTCAC ATCGGATATG TCGGAAGGAT GTCGGGAGGG    16573
                                                                  
.......... .......... .......... .......... .......... ..........      716


GTTTTTAAAA ACTAATAAAA AAAACAAATT ACATAACTCG TCAGGAAACT GCAAGACGAA    16633
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCTATTAAGT ATAATTAATC TATTATTAGC ACATGTGGGT TACTGTAGCA CTTAAGGCTA    16693
                                                                  
.......... .......... .......... .......... .......... ..........      716


ATCATGGACT AACTAGGCTT AAAAAATTCA TCTCGCGATT TTCAACCAAA CTGTGTAATT    16753
                                                                  
.......... .......... .......... .......... .......... ..........      716


ATTTTTTATC TACATTTAAT GTTTTATGTA TGTGTCTAAA GATTCAATGT GATGGATGAA    16813
                                                                  
.......... .......... .......... .......... .......... ..........      716


AATTTTTTAG GTGGGAACTA AACAGGGCCT TATATTTTTT AAAAAAGATG TGCAAGTGTC    16873
                                                                  
.......... .......... .......... .......... .......... ..........      716


AGGCCTTGTT TAGTTTCGAA AACTTTTTGG TTTTTGAGAC TGTAGCACTT TCGTTTTTAT    16933
                                                                  
.......... .......... .......... .......... .......... ..........      716


TTGACAAATA TTGTCTAATC ATAGAGTAAC TAGGTTTAAA AGATTTATCT CGCGATTTAT    16993
                                                                  
.......... .......... .......... .......... .......... ..........      716


AGGTAAACTG TGCAATTAGT TTTTATTTTT GTATATATTT AATGCTTCAT GCATGTGTCG    17053
                                                                  
.......... .......... .......... .......... .......... ..........      716


TAATATTTGA TGTGTTGAGA AATTTTGAAA AGTTTTTGGT TTTTGGGGTG AGTGGAGAAA    17113
                                                                  
.......... .......... .......... .......... .......... ..........      716


AAAGAGAAGC TCCTTTCGAG GAAGCTCTCT GCGGCCTGTG GCTGCGGGTG ACTGGGTGTG    17173
                                                                  
.......... .......... .......... .......... .......... ..........      716


GTCGTGTGGG CCTAGCGGGA CTGCGGGAAG GAAGAATTTG ACCGGATTCT CTATGTCACG    17233
                                                                  
.......... .......... .......... .......... .......... ..........      716


TGGGCCTAGA ATGGGATGGC CCATCCGAGC CCGACCCATA TTTGCCAGAT TCGAGTGAAC    17293
                                                                  
.......... .......... .......... .......... .......... ..........      716


TGGCTCCAAC TAAACAATTT TCCCCATTTG CCATTCCCGA CGAGCACCTT CACCGTCTCC    17353
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCCCACCTCG CGTGGCACGC CATGGCTTTC TCCCCGCGCT CGCCGTGGTC GCGTCCCAAG    17413
                                                                  
.......... .......... .......... .......... .......... ..........      716


AGAAACGACG TCTACTCAAC CTTCGTCGTC CACGGCGATG ACGACGAGGA CGACGCCCGC    17473
                                                                  
.......... .......... .......... .......... .......... ..........      716


GGCAGCAGGC GCGGCAGGGG CCCGTCCACG CGGGCGGAGG AAGACGAGGA GGAAGACCCC    17533
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCCTCGCTGC CTCCGCTTCT CCAGCGGCTC CCCAAGGACT TCGGCGGCCC CTCCTTTGAC    17593
                                                                  
.......... .......... .......... .......... .......... ..........      716


GAAGACGAGG ACGCCTACTC CTCCGACCCC GACGATGCTT CCCTCTCCGC TACGGTGGTC    17653
                                                                  
.......... .......... .......... .......... .......... ..........      716


TTCAAGAGCG GCGCCCCGGC CTCCGCTCGA TCTCCGTTCC TGGATCTGCG GCGCTCCAGC    17713
                                                                  
.......... .......... .......... .......... .......... ..........      716


CCCCGCGCTA CCGATGACGA CCCATACTCT ACCTTCGTCG TCCACTCCAC CGCACGCTCG    17773
                                                                  
.......... .......... .......... .......... .......... ..........      716


GGGGGGACCT CCTCCAGCCC TCGAGGGTCC GCCTCAGGCA CATTCATCCG TCGCTCCGGG    17833
                                                                  
.......... .......... .......... .......... .......... ..........      716


GGCTCGTCCA GCCCTCACGA ATCCGTCTCT GGCACATTCA TCCGCCGGAC TAGCACCCCG    17893
                                                                  
.......... .......... .......... .......... .......... ..........      716


TCGAGCCCCC GGGACTCGGT CTCCGGCACA TTCATCCGCC GACCAGGGAG CCCGTCGAGC    17953
                                                                  
.......... .......... .......... .......... .......... ..........      716


CCCCGCGGGT CGTTCTCTGG CACCTTCATT CGCCACACCA GCGGGGGTTC CAGTTCCTAT    18013
                                                                  
.......... .......... .......... .......... .......... ..........      716


GAATCTGCTT CTGGCGGCGG CGGGGGTTTC GGGTCCTCTT TCTGGAGTCC AGCGGTGGAG    18073
                                                                  
.......... .......... .......... .......... .......... ..........      716


CAGACAGAGG AGCTCCGGCA ACCGTCGCCT CTGATGCAGC AACAACAGCA GCAGCATTCA    18133
                                                                  
.......... .......... .......... .......... .......... ..........      716


AGGCGGAAGC CATCAGTGAG CTCGGCGCCA GACAGTGTTA CCAGAGAGGA TCCTTCCACC    18193
                                  | ||  ||| | ||||| || |||  ||||| 
.......... .......... .......... .ATAGCATTA CTAGAGAAGA TCCAACCACC      745


AAGTACGAGC TGCTCCATGA GCTTGGTGCG CCTCTTGCTC TGGAATTATT GTTTCATTAG    18253
|| |||||   | ||| ||||  ||||                                       
AAATACGAAT TCCTCAATGA ACTTG..... .......... .......... ..........      770


TTCTGTATGT CTACTTGTAG AATGGCTGAA GCTTTGAGCT GTTTTGCGAA ATGCAAAATT    18313
                                                                  
.......... .......... .......... .......... .......... ..........      770


CAATTGGGAA TGCAGGGAAA GGCTCATATG GTGCAGTGTA CAAAGCAAGG GATCTCAGAA    18373
                ||||| || ||||||| |  | || || ||| |||||  ||| | | || 
.......... .....GGAAA GGATCATATG GATCTGTATA CAAGGCAAGA GATTTGAAAA      815


CGCAGGAGCT TGTGGCTGTC AAGATTATCT CACTAACAGA AGGGGTTAGT TTCTAATTTT    18433
|    ||| | ||| |||||  ||  | || | |||| || || ||||                  
CATCAGAGAT TGTTGCTGTG AAAGTCATAT CACTTACTGA AGGG...... ..........      859


CTATTACAAA GTTCTGTGAA TATTCTGAAA GGCCACCCGA GACATATTTC ATATTTGGCA    18493
                                                                  
.......... .......... .......... .......... .......... ..........      859


ACCATATTGC TTTTGTTGTG AGCATTTTGT TTGCATGGGC TCAATTGTGA GAGAATCTCA    18553
                                                                  
.......... .......... .......... .......... .......... ..........      859


TAAATGTGGT TGCTGTCTGT TTTCCGAGTC GTTGCATTTT TCCAAAATAT AAGTATGTAT    18613
                                                                  
.......... .......... .......... .......... .......... ..........      859


CTTTGGTTTT CAGGAAGAAG GATATGAAGA CATACGGGGA GAAATTGAGA TGCTGCAGCA    18673
              || || | | ||||||||  || |||||| |||||||||| |||||||||| 
.......... ...GAGGAGG GGTATGAAGA GATCCGGGGA GAAATTGAGA TGCTGCAGCA      906


GTGTAGCCAT CCAAATGTTG TCCGCTACTT TGGAAGCTAC CAAGGAGAGG ACTACCTATG    18733
 ||||  ||| || ||||||| |||||||| |  || || ||| |||||||| | | || || || 
ATGTAATCAT CCTAATGTTG TCCGCTACCT AGGGAGTTAC CAAGGAGAAG ATTATCTTTG      966


GGTACAATCA AATAGCCTGA TAGTATCCAT TTTATTAACA TTAAGAAATA ACTATCATTG    18793
|                                                                 
G......... .......... .......... .......... .......... ..........      967


GGAGATTTCT CTACTTCTTG AGTCATTTAA CATGGGCTTG ATGCAAATGC GATTCTCAAC    18853
                                                                  
.......... .......... .......... .......... .......... ..........      967


TTACAGATAG TTATGGAGTA CTGTGGTGGT GGAAGTGTTG CTGATTTGAT AGGCATCACA    18913
      |||| | ||||||||  ||||| ||| |||||||||| ||||| | ||      | ||  
......ATAG TGATGGAGTA TTGTGGAGGT GGAAGTGTTG CTGATCTTAT GAATGTTACT     1021


GAGGAGCCTC TTGATGAATC CCAAATAGCT TATATATGTA GAGAAGCACT AAAGGTTCTA    18973
|||||| |   | || || |   || |||||  |||||||||  | || ||  |  |||       
GAGGAGGCGT TAGAGGAGTA TCAGATAGCA TATATATGTC GGGAGGCGTT GAAG......     1075


ACATAGTTGC ATCAGATTTG AAGTATTTGC TGCCTTGTTG GGCAACTAAA TGTATTTGGA    19033
                                                                  
.......... .......... .......... .......... .......... ..........     1075


TATTGAACTT TTGCGTGCTT ATTTTCTTCC AGGGCCTTGC TTACCTGCAC TCCATTTTTA    19093
                                   ||||||||  ||| ||||| || || | || 
.......... .......... .......... ..GGCCTTGC ATACTTGCAC TCAATATATA     1103


AAGTTCATAG AGATATTAAG GGTGGCAACA TTCTTCTAAC TGAGCAAGGC GAGGTGAAGT    19153
|||| ||||| ||| |||||  ||||| || | |  |  |||| ||| |||||  ||||| |||| 
AAGTCCATAG AGACATTAAA GGTGGAAATA TCTTGTTAAC TGAACAAGGA GAGGTCAAGT     1163


TGGGTAAGCA CATTTGTTTT CTTCAAAAGT TTTAGTTTGC ATTCTTAGCA CCCATATTTC    19213
|||                                                               
TGG....... .......... .......... .......... .......... ..........     1166


TGCATGTCCT GACTCTGTGG TCGGCATGCT GTGGCGCCAC AACAATGTGC AAAACAGGTG    19273
                                                              ||| 
.......... .......... .......... .......... .......... .......GTG     1169


ATTTTGGTGT AGCTGCCCAG CTGACAAGAA CCATGTCAAA GCGCAACACG GTATTCTAAA    19333
| ||||| ||  || || ||  || ||  | | | ||||| || ||| ||||||            
ACTTTGGGGT TGCAGCTCAA CTTACTCGCA CTATGTCGAA GCGAAACACG ..........     1219


CAGTGTTTGT TTTGCCATTC AAATCCATAG TTCAAGAAAC TTCACATCGA TGTAACAAAC    19393
                                                                  
.......... .......... .......... .......... .......... ..........     1219


AAAATGAAGT GGCAGATGAA ACTTGTCCAT GCCAGTTTAC CATAAGCGGA CCCATTTGTG    19453
                                                                  
.......... .......... .......... .......... .......... ..........     1219


CTTGTGCATA GTTCTTCAAT GTGATGGTAC TTTTATGGGA ACTTGAAGCA AGTCTGTGTT    19513
                                                                  
.......... .......... .......... .......... .......... ..........     1219


GGAAAATGAT TGCTGTGAAG TCCTAACTGT TTCTTTAAGT GTCATACTGC AAGTGCATTA    19573
                                                                  
.......... .......... .......... .......... .......... ..........     1219


TGGTCTATTA GGTTTAAAAT GAAAAATAAG AAAGTATATA TTTGTTATCT AGTATGCCTC    19633
                                                                  
.......... .......... .......... .......... .......... ..........     1219


GCCTAATTCC TTGGCATTTC TTCCATTCTT TGAAACCCAT ACTGGTGGAA CCTAGTTGAA    19693
                                                                  
.......... .......... .......... .......... .......... ..........     1219


GTGGTTCCTG TACAAATACT CTCTGCACTG CTTCTTCTCC CTTTCTTGTC GTGACAGCCT    19753
                                                                  
.......... .......... .......... .......... .......... ..........     1219


CTAGTCCCCA TATATCCCAT TATGAATCTG CTCACTCCCC CATTTGGCTT CTTCCTAGGC    19813
                                                                  
.......... .......... .......... .......... .......... ..........     1219


CACCACTCAA CAATTCTTCT GTTCTTGATG ACTGCGATGC TCCATTCGAT CTGGCAAATT    19873
                                                                  
.......... .......... .......... .......... .......... ..........     1219


GCTGCCTTGC TGGAGCTATT CAAGAACGTA GAGGGTTACT GTGACATTAG CATATCAAAC    19933
                                                                  
.......... .......... .......... .......... .......... ..........     1219


CAACAGGTCT GTTGGAAATC ATAATCACAA TGAACCTCCA AGTGGGAAAT ATTATCCAGG    19993
                                                                  
.......... .......... .......... .......... .......... ..........     1219


GCGTCATCTT ACCTCCAAGT TATGGACTCT GCTTGACACT AGAGGAAGAG TTAGTGCACA    20053
                                                                  
.......... .......... .......... .......... .......... ..........     1219


GGGAGTCCAA ATCAGGTAGG ATAGTTGATA GTTCATAATT GGCTAGATCT AGGAGGAGGT    20113
                                                                  
.......... .......... .......... .......... .......... ..........     1219


ATGTGAGTGA GAGTTTGGAA AATCAGGGTA GAATACAAGT TCAGGTTCCC TAGGACGATG    20173
                                                                  
.......... .......... .......... .......... .......... ..........     1219


ATATAATGTA GTACCATACT ACAAGAATTG ACTATGGAAT TTATTAATAT CTAGCTAGAA    20233
                                                                  
.......... .......... .......... .......... .......... ..........     1219


ACCAATATAA AAAAACAATC TACTCCCCTT TCTACTGCTG CTGATACTTC TACTCTTTTT    20293
                                                                  
.......... .......... .......... .......... .......... ..........     1219


TTTTTCTCTC TTGTACACCT TCTTGGCTGC TACACTTCTC TAGTTTCCAA TCATGACAAT    20353
                                                                  
.......... .......... .......... .......... .......... ..........     1219


ACATAAATGC TTGAGGAGCC CATAACAAAT AGTTCTACCC CACCCACCCA CACCCTTTCG    20413
                                                                  
.......... .......... .......... .......... .......... ..........     1219


TAGTAAAGTG TGCCGACAAC AGTTGGTGCC CTCTTCTCGA TGGTATCCAT TGCTTTTCTG    20473
                                                                  
.......... .......... .......... .......... .......... ..........     1219


CATGCACACA CAAACAAACA CTTCTAAATA CACATACTGA CTTGTCGTAT TGGCATGCAG    20533
                                                                  
.......... .......... .......... .......... .......... ..........     1219


TCATGCATTG AGACCAAATC CATCAGGACT GCATCCGCAC AACACAAAAT CTCACCATAC    20593
                                                                  
.......... .......... .......... .......... .......... ..........     1219


ATGCATACGG TGTCTTGGAT GTTTCTGTTG TTGGGGCGCT AATATGTACT TCTACCAAAA    20653
                                                                  
.......... .......... .......... .......... .......... ..........     1219


TGCAAGGACA AACTGTCCCA ATTTTACAGT AAAATAACTA TCATTGTGAA ACAGACTGTC    20713
                                                                  
.......... .......... .......... .......... .......... ..........     1219


AGCATCGCTC TCTAAGCTCA GTCTGTACAG CTTTTACCAA ATAAAAATAA TGCAATGGTT    20773
                                                                  
.......... .......... .......... .......... .......... ..........     1219


TTTGGAAAGA ATAAAGGTTT TAGTGGCACA CTAATTTCCA TAATTTGACC CTTCATGTTT    20833
                                                                  
.......... .......... .......... .......... .......... ..........     1219


ATGCTTTCAG TTCATTGGTA CTCCACATTG GATGGCACCA GAGGTCATTC AAGAAAGTCG    20893
           |||||||| | |||||||||| |||||| ||| ||||| |||| | |||| ||| 
.......... TTCATTGGGA CTCCACATTG GATGGCCCCA GAGGTTATTC AGGAAAATCG     1269


TTATGATGGA AAGGTATCAT GCTATCATCT CTACGGTGTT CAGCTATGGA ATTGTTCATT    20953
|||||||||  |||                                                    
TTATGATGGG AAG....... .......... .......... .......... ..........     1282


TTAGCAGCTT TTGTGGATGT TGCCATTTTA CTCTAAAGAC TTGGTGGCCG TAAATTTATG    21013
                                                                  
.......... .......... .......... .......... .......... ..........     1282


ATTGGGTTTT CAGTGAACAG GATTTCTTTA ATATTTTGTT TCTTTGGGTG TGGAATGTCC    21073
                                                                  
.......... .......... .......... .......... .......... ..........     1282


TTGCATATGG CAGAACAAGG TTACACGTAA ATTCATAAAA GCCATTAAAT AATTGTTATG    21133
                                                                  
.......... .......... .......... .......... .......... ..........     1282


GAACCCCTGC CAGTGCCAAA ACATGTTTAT TTCTTTTCCT TGTCTCTTGA TGGTTCCTCA    21193
                                                                  
.......... .......... .......... .......... .......... ..........     1282


AGCAAAAAAA AAATAAAATA AAATCATTAC CTACTACTAA GCCTCCAAAA CAAGTCTACT    21253
                                                                  
.......... .......... .......... .......... .......... ..........     1282


GGTTGCAATT AGGGATGAAA ACGGATCGGA TACGGACGGA TATCATCGAT ATCATATTTG    21313
                                                                  
.......... .......... .......... .......... .......... ..........     1282


TTTTCGTATT TCTGGTCGAA TTCGGATTCG AATACGGATA ATGTCAACTA TATCGGATAA    21373
                                                                  
.......... .......... .......... .......... .......... ..........     1282


GATACGATTG GATGTCGACA TCATAAATAT ATGATTTAAG TACTCGGATA CGGATACGGT    21433
                                                                  
.......... .......... .......... .......... .......... ..........     1282


ATCGGATGTA GAACATTCGA ACTCGGATAC GAACTGGTCT GAATCCCTCT AAACGAATTC    21493
                                                                  
.......... .......... .......... .......... .......... ..........     1282


GGTCTCAAAT ACGGTCGGAA AATATCCGTA CCGTTTTCAT CCCTAGTTGC AATGTTGAGA    21553
                                                                  
.......... .......... .......... .......... .......... ..........     1282


AAATTATTTT GGCAGCTGGA ATTCTTCCTT TAGTTTGTCT TACCAAAACA TTTGTTCTTG    21613
                                                                  
.......... .......... .......... .......... .......... ..........     1282


TTTCCTGCAC CAGGTAGATG TTTGGGCATT AGGTGTATCT GCAATTGAGA TGGCAGAGGT    21673
              || |||| | |||||  |  ||||| ||  || ||||||| ||||||||   
.......... ...GTTGATG TATGGGCTCT TGGTGTTTCA GCTATTGAGA TGGCAGAG..     1327


AGACATTGTT CCTTGCTTCT TTCTTTTTTT GACTGTACAC TTTTGTTTTT AATTTTGTGT    21733
                                                                  
.......... .......... .......... .......... .......... ..........     1327


CGTGACAATG CTTTTTAATA TTTATTTTGT ATCTCTGACT GTAGGGCATG CCACCAAGAT    21793
                                                ||  |  || ||||||| 
.......... .......... .......... .......... ....GGGCTC CCTCCAAGAT     1343


CCACTGTACA TCCAATGAGA GTAAGAGATG CTTCTCAATG CCTGTTAGTA TCTGCAGTTA    21853
|  | || || ||| |||||                                              
CATCAGTTCA TCCGATGAGG .......... .......... .......... ..........     1363


ATGAGGCTAA TAGGTTATAA CAGAATTAAA AAAATCTGCT CTATCTTTGG TGCACTGTAC    21913
                                                                  
.......... .......... .......... .......... .......... ..........     1363


TTTTTATCTC TTTACTGTCA AGGGCGTCGA GGGACAGGGT AGGAGGATCC CGGCTACGTA    21973
                                                                  
.......... .......... .......... .......... .......... ..........     1363


GTTCATAGAC CAATCTGTGG TGTGGGGCGG AGGTTTTACC CCTCAGTGCC CGATTGTTTC    22033
                                                                  
.......... .......... .......... .......... .......... ..........     1363


AGCAAAGGTA GATTAGGGAA TTGGGATAAT TGTTCTTTCT TGATTATCAT CATACGAGTA    22093
                                                                  
.......... .......... .......... .......... .......... ..........     1363


CAAGAATATA TAGGCCATTC GGCCATAACA GCTTGGAGCC AATTGCTCCT AAATCTAAGG    22153
                                                                  
.......... .......... .......... .......... .......... ..........     1363


CCATTATCGG CTCTCCTGCC TTCTAGGCTC TCGCCTGTTC AGTGTGCTCT GCATGCGTGG    22213
                                                                  
.......... .......... .......... .......... .......... ..........     1363


TGACCGCGCC TACGGTTCTG CTGGTGCGCC ATCTGCGGCT CTGCGAGCAT CCTGGGCGTG    22273
                                                                  
.......... .......... .......... .......... .......... ..........     1363


CCGTTTCCTT GTGTAGGCGC GGTCCCACAT GACATTTACT TTCTTTCTGA TGCATTTGCT    22333
                                                                  
.......... .......... .......... .......... .......... ..........     1363


TCTTTACTTT GCCTTGGTAA ATATTTGGTA TACATATCAA TATATTGTTT CATCTTCGTT    22393
                                                                  
.......... .......... .......... .......... .......... ..........     1363


TAGCATGAAT GCTTGATAGA CCGACTAACG ATCTCTCTTC CCCCTTCCCT TATCTCAGGT    22453
                                                               || 
.......... .......... .......... .......... .......... ........GT     1365


TATCTTCATG ATATCCAGTG AACCAGCACC AATGCTGGAG GATAAGG    22500
| | |||||| |||||||  | | ||||| || |||||| ||| ||||| |
TTTGTTCATG ATATCCATCG AGCCAGCTCC AATGCTCGAG GATAAAG     1412





********************************************************************************
EST sequence   92 +strand (File: 20172268+)

     1  GGTCGATTTC AATACCAGAC AGTGTGACTA GGGAAGATCC TTGTACTAAG TATGAATTGC
    61  TCCACGAGCT AGGGAAAGGT TCATATGGGG CTGTTTATAA AGCTTGAGAC TTGAGGACTT
   121  CAGAAATGGT TGCCATCAAA GTCATATCGT TATCTGAAGG GGAGGAAGGC TATGAAGAAA
   181  TTCGAGGTGA AATTGAGATG TTACAGCAGT GCAGTCATCC AAATGTTGTT CGCTATCTTG
   241  GGAGCTACCA AGGAGAAGAG TACCTTTGGA TAGTAATGGA GTATTGTGGG GGTGGAAGTG
   301  TTGCTGACTT AATGAATGTC ACAGATGAGG CTTTAGAGGA GTATCAAATA GCATTTATTT
   361  GTCGAGAGGC ATTGAAGGTG ATTTTGGTGT TGCTGCGCAG CTGACTAGAA CCATGTCCAA
   421  ACGTAACACG TTTATCGGCA CTCCCCATTG GATGGCACCA GAAGTTATTC AAGAAAGTCG
   481  TTATGATGGG AAGGTAGATG TATGGGCTCT TGGAGTGTCT GCTATTGAAA TGGCGGAGGG
   541  TCTTCCTCCT AGGGCAACAG TGCATCCAAT GAGGGTGCTA TTTATGATAT CCATTGAACC
   601  AGCTCCAATG CTCGAGGATA AAGAGAAATG GTCTCTTGTA TTCCATGATT TTGTTGCCAA
   661  GTGCCTTACA AAAGACACCC GACTTCGTCC AATTGCCTCC GAGATGCTAA AGCACAAATT
   721  CATCG

Predicted gene structure (within gDNA segment 17414 to 22387):

 Exon  1  18165  18218 (  54 n);  cDNA     19     72 (  54 n); score: 0.778
  Intron  1  18219  18328 ( 110 n); Pd: 0.941 (s: 0.76), Pa: 0.878 (s: 0.68)
 Exon  2  18329  18417 (  89 n);  cDNA     73    161 (  89 n); score: 0.663
  Intron  2  18418  18626 ( 209 n); Pd: 0.993 (s: 0.60), Pa: 0.998 (s: 0.84)
 Exon  3  18627  18734 ( 108 n);  cDNA    162    269 ( 108 n); score: 0.843
  Intron  3  18735  18859 ( 125 n); Pd: 0.980 (s: 0.86), Pa: 0.787 (s: 0.80)
 Exon  4  18860  18967 ( 108 n);  cDNA    270    377 ( 108 n); score: 0.769
  Intron  4  18968  19270 ( 303 n); Pd: 0.000 (s: 0.72), Pa: 0.000 (s: 0.88)
 Exon  5  19271  19323 (  53 n);  cDNA    378    430 (  53 n); score: 0.887
  Intron  5  19324  20843 (1520 n); Pd: 0.770 (s: 0.88), Pa: 0.962 (s: 0.88)
 Exon  6  20844  20906 (  63 n);  cDNA    431    493 (  63 n); score: 0.889
  Intron  6  20907  21626 ( 720 n); Pd: 0.929 (s: 0.92), Pa: 0.999 (s: 0.80)
 Exon  7  21627  21671 (  45 n);  cDNA    494    538 (  45 n); score: 0.800
  Intron  7  21672  21777 ( 106 n); Pd: 0.992 (s: 0.80), Pa: 0.998 (s:    0)
 Exon  8  21778  21813 (  36 n);  cDNA    539    574 (  36 n); score: 0.694

MATCH	21326110+	20172268+	0.796	556	0.767	C
PGS_21326110+_20172268+	(18165  18218,18329  18417,18627  18734,18860  18967,19271  19323,20844  20906,21627  21671,21778  21813)

Alignment (genomic DNA sequence = upper lines):

ACAGTGTTAC CAGAGAGGAT CCTTCCACCA AGTACGAGCT GCTCCATGAG CTTGGTGCGC    18224
||||||| ||  || || ||| ||||  || | |||| ||  | |||||| ||| || |       
ACAGTGTGAC TAGGGAAGAT CCTTGTACTA AGTATGAATT GCTCCACGAG CTAG......       72


CTCTTGCTCT GGAATTATTG TTTCATTAGT TCTGTATGTC TACTTGTAGA ATGGCTGAAG    18284
                                                                  
.......... .......... .......... .......... .......... ..........       72


CTTTGAGCTG TTTTGCGAAA TGCAAAATTC AATTGGGAAT GCAGGGAAAG GCTCATATGG    18344
                                                |||||| | |||||||| 
.......... .......... .......... .......... ....GGAAAG GTTCATATGG       88


TGCAGTGTAC AAAGCAAGGG ATCTCAGAAC GCAGGAGCTT GTGGCTGTCA AGATTATCTC    18404
 || || ||  |||||  | | |  | || ||     ||  |  || ||  ||| |  | || || 
GGCTGTTTAT AAAGCTTGAG ACTTGAGGAC TTCAGAAATG GTTGCCATCA AAGTCATATC      148


ACTAACAGAA GGGGTTAGTT TCTAATTTTC TATTACAAAG TTCTGTGAAT ATTCTGAAAG    18464
  || | ||| |||                                                    
GTTATCTGAA GGG....... .......... .......... .......... ..........      161


GCCACCCGAG ACATATTTCA TATTTGGCAA CCATATTGCT TTTGTTGTGA GCATTTTGTT    18524
                                                                  
.......... .......... .......... .......... .......... ..........      161


TGCATGGGCT CAATTGTGAG AGAATCTCAT AAATGTGGTT GCTGTCTGTT TTCCGAGTCG    18584
                                                                  
.......... .......... .......... .......... .......... ..........      161


TTGCATTTTT CCAAAATATA AGTATGTATC TTTGGTTTTC AGGAAGAAGG ATATGAAGAC    18644
                                              || |||||  ||||||||  
.......... .......... .......... .......... ..GAGGAAGG CTATGAAGAA      179


ATACGGGGAG AAATTGAGAT GCTGCAGCAG TGTAGCCATC CAAATGTTGT CCGCTACTTT    18704
|| || || | |||||||||| | | |||||| || || |||| ||||||||||  |||||  || 
ATTCGAGGTG AAATTGAGAT GTTACAGCAG TGCAGTCATC CAAATGTTGT TCGCTATCTT      239


GGAAGCTACC AAGGAGAGGA CTACCTATGG GTACAATCAA ATAGCCTGAT AGTATCCATT    18764
|| ||||||| ||||||| ||  ||||| |||                                  
GGGAGCTACC AAGGAGAAGA GTACCTTTGG .......... .......... ..........      269


TTATTAACAT TAAGAAATAA CTATCATTGG GAGATTTCTC TACTTCTTGA GTCATTTAAC    18824
                                                                  
.......... .......... .......... .......... .......... ..........      269


ATGGGCTTGA TGCAAATGCG ATTCTCAACT TACAGATAGT TATGGAGTAC TGTGGTGGTG    18884
                                      |||||  ||||||||  ||||| |||| 
.......... .......... .......... .....ATAGT AATGGAGTAT TGTGGGGGTG      294


GAAGTGTTGC TGATTTGATA GGCATCACAG AGGAGCCTCT TGATGAATCC CAAATAGCTT    18944
|||||||||| ||| || ||      |||||| | ||| || |  || || |   |||||||| | 
GAAGTGTTGC TGACTTAATG AATGTCACAG ATGAGGCTTT AGAGGAGTAT CAAATAGCAT      354


ATATATGTAG AGAAGCACTA AAGGTTCTAA CATAGTTGCA TCAGATTTGA AGTATTTGCT    19004
 ||| ||| | ||| ||| |  |||                                         
TTATTTGTCG AGAGGCATTG AAG....... .......... .......... ..........      377


GCCTTGTTGG GCAACTAAAT GTATTTGGAT ATTGAACTTT TGCGTGCTTA TTTTCTTCCA    19064
                                                                  
.......... .......... .......... .......... .......... ..........      377


GGGCCTTGCT TACCTGCACT CCATTTTTAA AGTTCATAGA GATATTAAGG GTGGCAACAT    19124
                                                                  
.......... .......... .......... .......... .......... ..........      377


TCTTCTAACT GAGCAAGGCG AGGTGAAGTT GGGTAAGCAC ATTTGTTTTC TTCAAAAGTT    19184
                                                                  
.......... .......... .......... .......... .......... ..........      377


TTAGTTTGCA TTCTTAGCAC CCATATTTCT GCATGTCCTG ACTCTGTGGT CGGCATGCTG    19244
                                                                  
.......... .......... .......... .......... .......... ..........      377


TGGCGCCACA ACAATGTGCA AAACAGGTGA TTTTGGTGTA GCTGCCCAGC TGACAAGAAC    19304
                            |||| |||||||||  ||||| |||| |||| ||||| 
.......... .......... ......GTGA TTTTGGTGTT GCTGCGCAGC TGACTAGAAC      411


CATGTCAAAG CGCAACACGG TATTCTAAAC AGTGTTTGTT TTGCCATTCA AATCCATAGT    19364
|||||| ||  || ||||||                                              
CATGTCCAAA CGTAACACG. .......... .......... .......... ..........      430


TCAAGAAACT TCACATCGAT GTAACAAACA AAATGAAGTG GCAGATGAAA CTTGTCCATG    19424
                                                                  
.......... .......... .......... .......... .......... ..........      430


CCAGTTTACC ATAAGCGGAC CCATTTGTGC TTGTGCATAG TTCTTCAATG TGATGGTACT    19484
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTTATGGGAA CTTGAAGCAA GTCTGTGTTG GAAAATGATT GCTGTGAAGT CCTAACTGTT    19544
                                                                  
.......... .......... .......... .......... .......... ..........      430


TCTTTAAGTG TCATACTGCA AGTGCATTAT GGTCTATTAG GTTTAAAATG AAAAATAAGA    19604
                                                                  
.......... .......... .......... .......... .......... ..........      430


AAGTATATAT TTGTTATCTA GTATGCCTCG CCTAATTCCT TGGCATTTCT TCCATTCTTT    19664
                                                                  
.......... .......... .......... .......... .......... ..........      430


GAAACCCATA CTGGTGGAAC CTAGTTGAAG TGGTTCCTGT ACAAATACTC TCTGCACTGC    19724
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTCTTCTCCC TTTCTTGTCG TGACAGCCTC TAGTCCCCAT ATATCCCATT ATGAATCTGC    19784
                                                                  
.......... .......... .......... .......... .......... ..........      430


TCACTCCCCC ATTTGGCTTC TTCCTAGGCC ACCACTCAAC AATTCTTCTG TTCTTGATGA    19844
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTGCGATGCT CCATTCGATC TGGCAAATTG CTGCCTTGCT GGAGCTATTC AAGAACGTAG    19904
                                                                  
.......... .......... .......... .......... .......... ..........      430


AGGGTTACTG TGACATTAGC ATATCAAACC AACAGGTCTG TTGGAAATCA TAATCACAAT    19964
                                                                  
.......... .......... .......... .......... .......... ..........      430


GAACCTCCAA GTGGGAAATA TTATCCAGGG CGTCATCTTA CCTCCAAGTT ATGGACTCTG    20024
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTTGACACTA GAGGAAGAGT TAGTGCACAG GGAGTCCAAA TCAGGTAGGA TAGTTGATAG    20084
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTCATAATTG GCTAGATCTA GGAGGAGGTA TGTGAGTGAG AGTTTGGAAA ATCAGGGTAG    20144
                                                                  
.......... .......... .......... .......... .......... ..........      430


AATACAAGTT CAGGTTCCCT AGGACGATGA TATAATGTAG TACCATACTA CAAGAATTGA    20204
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTATGGAATT TATTAATATC TAGCTAGAAA CCAATATAAA AAAACAATCT ACTCCCCTTT    20264
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTACTGCTGC TGATACTTCT ACTCTTTTTT TTTTCTCTCT TGTACACCTT CTTGGCTGCT    20324
                                                                  
.......... .......... .......... .......... .......... ..........      430


ACACTTCTCT AGTTTCCAAT CATGACAATA CATAAATGCT TGAGGAGCCC ATAACAAATA    20384
                                                                  
.......... .......... .......... .......... .......... ..........      430


GTTCTACCCC ACCCACCCAC ACCCTTTCGT AGTAAAGTGT GCCGACAACA GTTGGTGCCC    20444
                                                                  
.......... .......... .......... .......... .......... ..........      430


TCTTCTCGAT GGTATCCATT GCTTTTCTGC ATGCACACAC AAACAAACAC TTCTAAATAC    20504
                                                                  
.......... .......... .......... .......... .......... ..........      430


ACATACTGAC TTGTCGTATT GGCATGCAGT CATGCATTGA GACCAAATCC ATCAGGACTG    20564
                                                                  
.......... .......... .......... .......... .......... ..........      430


CATCCGCACA ACACAAAATC TCACCATACA TGCATACGGT GTCTTGGATG TTTCTGTTGT    20624
                                                                  
.......... .......... .......... .......... .......... ..........      430


TGGGGCGCTA ATATGTACTT CTACCAAAAT GCAAGGACAA ACTGTCCCAA TTTTACAGTA    20684
                                                                  
.......... .......... .......... .......... .......... ..........      430


AAATAACTAT CATTGTGAAA CAGACTGTCA GCATCGCTCT CTAAGCTCAG TCTGTACAGC    20744
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTTTACCAAA TAAAAATAAT GCAATGGTTT TTGGAAAGAA TAAAGGTTTT AGTGGCACAC    20804
                                                                  
.......... .......... .......... .......... .......... ..........      430


TAATTTCCAT AATTTGACCC TTCATGTTTA TGCTTTCAGT TCATTGGTAC TCCACATTGG    20864
                                          | | || || || ||| |||||| 
.......... .......... .......... .........T TTATCGGCAC TCCCCATTGG      451


ATGGCACCAG AGGTCATTCA AGAAAGTCGT TATGATGGAA AGGTATCATG CTATCATCTC    20924
|||||||||| | || ||||| |||||||||| |||||||| | ||                    
ATGGCACCAG AAGTTATTCA AGAAAGTCGT TATGATGGGA AG........ ..........      493


TACGGTGTTC AGCTATGGAA TTGTTCATTT TAGCAGCTTT TGTGGATGTT GCCATTTTAC    20984
                                                                  
.......... .......... .......... .......... .......... ..........      493


TCTAAAGACT TGGTGGCCGT AAATTTATGA TTGGGTTTTC AGTGAACAGG ATTTCTTTAA    21044
                                                                  
.......... .......... .......... .......... .......... ..........      493


TATTTTGTTT CTTTGGGTGT GGAATGTCCT TGCATATGGC AGAACAAGGT TACACGTAAA    21104
                                                                  
.......... .......... .......... .......... .......... ..........      493


TTCATAAAAG CCATTAAATA ATTGTTATGG AACCCCTGCC AGTGCCAAAA CATGTTTATT    21164
                                                                  
.......... .......... .......... .......... .......... ..........      493


TCTTTTCCTT GTCTCTTGAT GGTTCCTCAA GCAAAAAAAA AATAAAATAA AATCATTACC    21224
                                                                  
.......... .......... .......... .......... .......... ..........      493


TACTACTAAG CCTCCAAAAC AAGTCTACTG GTTGCAATTA GGGATGAAAA CGGATCGGAT    21284
                                                                  
.......... .......... .......... .......... .......... ..........      493


ACGGACGGAT ATCATCGATA TCATATTTGT TTTCGTATTT CTGGTCGAAT TCGGATTCGA    21344
                                                                  
.......... .......... .......... .......... .......... ..........      493


ATACGGATAA TGTCAACTAT ATCGGATAAG ATACGATTGG ATGTCGACAT CATAAATATA    21404
                                                                  
.......... .......... .......... .......... .......... ..........      493


TGATTTAAGT ACTCGGATAC GGATACGGTA TCGGATGTAG AACATTCGAA CTCGGATACG    21464
                                                                  
.......... .......... .......... .......... .......... ..........      493


AACTGGTCTG AATCCCTCTA AACGAATTCG GTCTCAAATA CGGTCGGAAA ATATCCGTAC    21524
                                                                  
.......... .......... .......... .......... .......... ..........      493


CGTTTTCATC CCTAGTTGCA ATGTTGAGAA AATTATTTTG GCAGCTGGAA TTCTTCCTTT    21584
                                                                  
.......... .......... .......... .......... .......... ..........      493


AGTTTGTCTT ACCAAAACAT TTGTTCTTGT TTCCTGCACC AGGTAGATGT TTGGGCATTA    21644
                                              ||||||||  |||||  |  
.......... .......... .......... .......... ..GTAGATGT ATGGGCTCTT      511


GGTGTATCTG CAATTGAGAT GGCAGAGGTA GACATTGTTC CTTGCTTCTT TCTTTTTTTG    21704
|| || |||| | ||||| || ||| |||                                     
GGAGTGTCTG CTATTGAAAT GGCGGAG... .......... .......... ..........      538


ACTGTACACT TTTGTTTTTA ATTTTGTGTC GTGACAATGC TTTTTAATAT TTATTTTGTA    21764
                                                                  
.......... .......... .......... .......... .......... ..........      538


TCTCTGACTG TAGGGCATGC CACCAAGATC CACTGTACAT CCAATGAGA    21813
              ||  | | | || ||  |  || || ||| |||||||| 
.......... ...GGTCTTC CTCCTAGGGC AACAGTGCAT CCAATGAGG      574





********************************************************************************
EST sequence   95 +strand (File: 13607727+)

     1  GGTCGATTTC AATACCAGAC AGTGTGACTA GGGAAGATCC TTGTACTAAG TATGAATTGC
    61  TCCACGAGCT AGGGAAAGGT TCATATGGGG CTGTTTATAA AGCTTGAGAC TTGAGGACTT
   121  CAGAAATGGT TGCCATCAAA GTCATATCGT TATCTGAAGG GGAGGAAGGC TATGAAGAAA
   181  TTCGAGGTGA AATTGAGATG TTACAGCAGT GCAGTCATCC AAATGTTGTT CGCTATCTTG
   241  GGAGCTACCA AGGAGAAGAG TACCTTTGGA TAGTAATGGA GTATTGTGGG GGTGGAAGTG
   301  TTGCTGACTT AATGAATGTC ACAGATGAGG CTTTAGAGGA GTATCAAATA GCATTTATTT
   361  GTCGAGAGGC ATTGAAGGTG ATTTTGGTGT TGCTGCGCAG CTGACTAGAA CCATGTCCAA
   421  ACGTAACACG TTTATCGGCA CTCCCCATTG GATGGCACCA GAAGTTATTC AAGAAAGTCG
   481  TTATGATGGG AAGGTAGATG TATGGGCTCT TGGAGTGTCT GCTATTGAAA TGGCGGAGGG
   541  TCTTCCTCCT AGGGCAACAG TGCATCCAAT GAGGGTGCTA TTTATGATAT CCATTGAACC
   601  AGC

Predicted gene structure (within gDNA segment 17414 to 21777):

 Exon  1  18165  18218 (  54 n);  cDNA     19     72 (  54 n); score: 0.778
  Intron  1  18219  18328 ( 110 n); Pd: 0.941 (s: 0.76), Pa: 0.878 (s: 0.68)
 Exon  2  18329  18417 (  89 n);  cDNA     73    161 (  89 n); score: 0.663
  Intron  2  18418  18626 ( 209 n); Pd: 0.993 (s: 0.60), Pa: 0.998 (s: 0.84)
 Exon  3  18627  18734 ( 108 n);  cDNA    162    269 ( 108 n); score: 0.843
  Intron  3  18735  18859 ( 125 n); Pd: 0.980 (s: 0.86), Pa: 0.787 (s: 0.80)
 Exon  4  18860  18967 ( 108 n);  cDNA    270    377 ( 108 n); score: 0.769
  Intron  4  18968  19270 ( 303 n); Pd: 0.000 (s: 0.72), Pa: 0.000 (s: 0.88)
 Exon  5  19271  19323 (  53 n);  cDNA    378    430 (  53 n); score: 0.887
  Intron  5  19324  20843 (1520 n); Pd: 0.770 (s: 0.88), Pa: 0.962 (s: 0.88)
 Exon  6  20844  20906 (  63 n);  cDNA    431    493 (  63 n); score: 0.889
  Intron  6  20907  21626 ( 720 n); Pd: 0.929 (s: 0.92), Pa: 0.999 (s: 0.80)
 Exon  7  21627  21671 (  45 n);  cDNA    494    538 (  45 n); score: 0.800

MATCH	21326110+	13607727+	0.796	520	0.862	C
PGS_21326110+_13607727+	(18165  18218,18329  18417,18627  18734,18860  18967,19271  19323,20844  20906,21627  21671)

Alignment (genomic DNA sequence = upper lines):

ACAGTGTTAC CAGAGAGGAT CCTTCCACCA AGTACGAGCT GCTCCATGAG CTTGGTGCGC    18224
||||||| ||  || || ||| ||||  || | |||| ||  | |||||| ||| || |       
ACAGTGTGAC TAGGGAAGAT CCTTGTACTA AGTATGAATT GCTCCACGAG CTAG......       72


CTCTTGCTCT GGAATTATTG TTTCATTAGT TCTGTATGTC TACTTGTAGA ATGGCTGAAG    18284
                                                                  
.......... .......... .......... .......... .......... ..........       72


CTTTGAGCTG TTTTGCGAAA TGCAAAATTC AATTGGGAAT GCAGGGAAAG GCTCATATGG    18344
                                                |||||| | |||||||| 
.......... .......... .......... .......... ....GGAAAG GTTCATATGG       88


TGCAGTGTAC AAAGCAAGGG ATCTCAGAAC GCAGGAGCTT GTGGCTGTCA AGATTATCTC    18404
 || || ||  |||||  | | |  | || ||     ||  |  || ||  ||| |  | || || 
GGCTGTTTAT AAAGCTTGAG ACTTGAGGAC TTCAGAAATG GTTGCCATCA AAGTCATATC      148


ACTAACAGAA GGGGTTAGTT TCTAATTTTC TATTACAAAG TTCTGTGAAT ATTCTGAAAG    18464
  || | ||| |||                                                    
GTTATCTGAA GGG....... .......... .......... .......... ..........      161


GCCACCCGAG ACATATTTCA TATTTGGCAA CCATATTGCT TTTGTTGTGA GCATTTTGTT    18524
                                                                  
.......... .......... .......... .......... .......... ..........      161


TGCATGGGCT CAATTGTGAG AGAATCTCAT AAATGTGGTT GCTGTCTGTT TTCCGAGTCG    18584
                                                                  
.......... .......... .......... .......... .......... ..........      161


TTGCATTTTT CCAAAATATA AGTATGTATC TTTGGTTTTC AGGAAGAAGG ATATGAAGAC    18644
                                              || |||||  ||||||||  
.......... .......... .......... .......... ..GAGGAAGG CTATGAAGAA      179


ATACGGGGAG AAATTGAGAT GCTGCAGCAG TGTAGCCATC CAAATGTTGT CCGCTACTTT    18704
|| || || | |||||||||| | | |||||| || || |||| ||||||||||  |||||  || 
ATTCGAGGTG AAATTGAGAT GTTACAGCAG TGCAGTCATC CAAATGTTGT TCGCTATCTT      239


GGAAGCTACC AAGGAGAGGA CTACCTATGG GTACAATCAA ATAGCCTGAT AGTATCCATT    18764
|| ||||||| ||||||| ||  ||||| |||                                  
GGGAGCTACC AAGGAGAAGA GTACCTTTGG .......... .......... ..........      269


TTATTAACAT TAAGAAATAA CTATCATTGG GAGATTTCTC TACTTCTTGA GTCATTTAAC    18824
                                                                  
.......... .......... .......... .......... .......... ..........      269


ATGGGCTTGA TGCAAATGCG ATTCTCAACT TACAGATAGT TATGGAGTAC TGTGGTGGTG    18884
                                      |||||  ||||||||  ||||| |||| 
.......... .......... .......... .....ATAGT AATGGAGTAT TGTGGGGGTG      294


GAAGTGTTGC TGATTTGATA GGCATCACAG AGGAGCCTCT TGATGAATCC CAAATAGCTT    18944
|||||||||| ||| || ||      |||||| | ||| || |  || || |   |||||||| | 
GAAGTGTTGC TGACTTAATG AATGTCACAG ATGAGGCTTT AGAGGAGTAT CAAATAGCAT      354


ATATATGTAG AGAAGCACTA AAGGTTCTAA CATAGTTGCA TCAGATTTGA AGTATTTGCT    19004
 ||| ||| | ||| ||| |  |||                                         
TTATTTGTCG AGAGGCATTG AAG....... .......... .......... ..........      377


GCCTTGTTGG GCAACTAAAT GTATTTGGAT ATTGAACTTT TGCGTGCTTA TTTTCTTCCA    19064
                                                                  
.......... .......... .......... .......... .......... ..........      377


GGGCCTTGCT TACCTGCACT CCATTTTTAA AGTTCATAGA GATATTAAGG GTGGCAACAT    19124
                                                                  
.......... .......... .......... .......... .......... ..........      377


TCTTCTAACT GAGCAAGGCG AGGTGAAGTT GGGTAAGCAC ATTTGTTTTC TTCAAAAGTT    19184
                                                                  
.......... .......... .......... .......... .......... ..........      377


TTAGTTTGCA TTCTTAGCAC CCATATTTCT GCATGTCCTG ACTCTGTGGT CGGCATGCTG    19244
                                                                  
.......... .......... .......... .......... .......... ..........      377


TGGCGCCACA ACAATGTGCA AAACAGGTGA TTTTGGTGTA GCTGCCCAGC TGACAAGAAC    19304
                            |||| |||||||||  ||||| |||| |||| ||||| 
.......... .......... ......GTGA TTTTGGTGTT GCTGCGCAGC TGACTAGAAC      411


CATGTCAAAG CGCAACACGG TATTCTAAAC AGTGTTTGTT TTGCCATTCA AATCCATAGT    19364
|||||| ||  || ||||||                                              
CATGTCCAAA CGTAACACG. .......... .......... .......... ..........      430


TCAAGAAACT TCACATCGAT GTAACAAACA AAATGAAGTG GCAGATGAAA CTTGTCCATG    19424
                                                                  
.......... .......... .......... .......... .......... ..........      430


CCAGTTTACC ATAAGCGGAC CCATTTGTGC TTGTGCATAG TTCTTCAATG TGATGGTACT    19484
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTTATGGGAA CTTGAAGCAA GTCTGTGTTG GAAAATGATT GCTGTGAAGT CCTAACTGTT    19544
                                                                  
.......... .......... .......... .......... .......... ..........      430


TCTTTAAGTG TCATACTGCA AGTGCATTAT GGTCTATTAG GTTTAAAATG AAAAATAAGA    19604
                                                                  
.......... .......... .......... .......... .......... ..........      430


AAGTATATAT TTGTTATCTA GTATGCCTCG CCTAATTCCT TGGCATTTCT TCCATTCTTT    19664
                                                                  
.......... .......... .......... .......... .......... ..........      430


GAAACCCATA CTGGTGGAAC CTAGTTGAAG TGGTTCCTGT ACAAATACTC TCTGCACTGC    19724
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTCTTCTCCC TTTCTTGTCG TGACAGCCTC TAGTCCCCAT ATATCCCATT ATGAATCTGC    19784
                                                                  
.......... .......... .......... .......... .......... ..........      430


TCACTCCCCC ATTTGGCTTC TTCCTAGGCC ACCACTCAAC AATTCTTCTG TTCTTGATGA    19844
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTGCGATGCT CCATTCGATC TGGCAAATTG CTGCCTTGCT GGAGCTATTC AAGAACGTAG    19904
                                                                  
.......... .......... .......... .......... .......... ..........      430


AGGGTTACTG TGACATTAGC ATATCAAACC AACAGGTCTG TTGGAAATCA TAATCACAAT    19964
                                                                  
.......... .......... .......... .......... .......... ..........      430


GAACCTCCAA GTGGGAAATA TTATCCAGGG CGTCATCTTA CCTCCAAGTT ATGGACTCTG    20024
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTTGACACTA GAGGAAGAGT TAGTGCACAG GGAGTCCAAA TCAGGTAGGA TAGTTGATAG    20084
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTCATAATTG GCTAGATCTA GGAGGAGGTA TGTGAGTGAG AGTTTGGAAA ATCAGGGTAG    20144
                                                                  
.......... .......... .......... .......... .......... ..........      430


AATACAAGTT CAGGTTCCCT AGGACGATGA TATAATGTAG TACCATACTA CAAGAATTGA    20204
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTATGGAATT TATTAATATC TAGCTAGAAA CCAATATAAA AAAACAATCT ACTCCCCTTT    20264
                                                                  
.......... .......... .......... .......... .......... ..........      430


CTACTGCTGC TGATACTTCT ACTCTTTTTT TTTTCTCTCT TGTACACCTT CTTGGCTGCT    20324
                                                                  
.......... .......... .......... .......... .......... ..........      430


ACACTTCTCT AGTTTCCAAT CATGACAATA CATAAATGCT TGAGGAGCCC ATAACAAATA    20384
                                                                  
.......... .......... .......... .......... .......... ..........      430


GTTCTACCCC ACCCACCCAC ACCCTTTCGT AGTAAAGTGT GCCGACAACA GTTGGTGCCC    20444
                                                                  
.......... .......... .......... .......... .......... ..........      430


TCTTCTCGAT GGTATCCATT GCTTTTCTGC ATGCACACAC AAACAAACAC TTCTAAATAC    20504
                                                                  
.......... .......... .......... .......... .......... ..........      430


ACATACTGAC TTGTCGTATT GGCATGCAGT CATGCATTGA GACCAAATCC ATCAGGACTG    20564
                                                                  
.......... .......... .......... .......... .......... ..........      430


CATCCGCACA ACACAAAATC TCACCATACA TGCATACGGT GTCTTGGATG TTTCTGTTGT    20624
                                                                  
.......... .......... .......... .......... .......... ..........      430


TGGGGCGCTA ATATGTACTT CTACCAAAAT GCAAGGACAA ACTGTCCCAA TTTTACAGTA    20684
                                                                  
.......... .......... .......... .......... .......... ..........      430


AAATAACTAT CATTGTGAAA CAGACTGTCA GCATCGCTCT CTAAGCTCAG TCTGTACAGC    20744
                                                                  
.......... .......... .......... .......... .......... ..........      430


TTTTACCAAA TAAAAATAAT GCAATGGTTT TTGGAAAGAA TAAAGGTTTT AGTGGCACAC    20804
                                                                  
.......... .......... .......... .......... .......... ..........      430


TAATTTCCAT AATTTGACCC TTCATGTTTA TGCTTTCAGT TCATTGGTAC TCCACATTGG    20864
                                          | | || || || ||| |||||| 
.......... .......... .......... .........T TTATCGGCAC TCCCCATTGG      451


ATGGCACCAG AGGTCATTCA AGAAAGTCGT TATGATGGAA AGGTATCATG CTATCATCTC    20924
|||||||||| | || ||||| |||||||||| |||||||| | ||                    
ATGGCACCAG AAGTTATTCA AGAAAGTCGT TATGATGGGA AG........ ..........      493


TACGGTGTTC AGCTATGGAA TTGTTCATTT TAGCAGCTTT TGTGGATGTT GCCATTTTAC    20984
                                                                  
.......... .......... .......... .......... .......... ..........      493


TCTAAAGACT TGGTGGCCGT AAATTTATGA TTGGGTTTTC AGTGAACAGG ATTTCTTTAA    21044
                                                                  
.......... .......... .......... .......... .......... ..........      493


TATTTTGTTT CTTTGGGTGT GGAATGTCCT TGCATATGGC AGAACAAGGT TACACGTAAA    21104
                                                                  
.......... .......... .......... .......... .......... ..........      493


TTCATAAAAG CCATTAAATA ATTGTTATGG AACCCCTGCC AGTGCCAAAA CATGTTTATT    21164
                                                                  
.......... .......... .......... .......... .......... ..........      493


TCTTTTCCTT GTCTCTTGAT GGTTCCTCAA GCAAAAAAAA AATAAAATAA AATCATTACC    21224
                                                                  
.......... .......... .......... .......... .......... ..........      493


TACTACTAAG CCTCCAAAAC AAGTCTACTG GTTGCAATTA GGGATGAAAA CGGATCGGAT    21284
                                                                  
.......... .......... .......... .......... .......... ..........      493


ACGGACGGAT ATCATCGATA TCATATTTGT TTTCGTATTT CTGGTCGAAT TCGGATTCGA    21344
                                                                  
.......... .......... .......... .......... .......... ..........      493


ATACGGATAA TGTCAACTAT ATCGGATAAG ATACGATTGG ATGTCGACAT CATAAATATA    21404
                                                                  
.......... .......... .......... .......... .......... ..........      493


TGATTTAAGT ACTCGGATAC GGATACGGTA TCGGATGTAG AACATTCGAA CTCGGATACG    21464
                                                                  
.......... .......... .......... .......... .......... ..........      493


AACTGGTCTG AATCCCTCTA AACGAATTCG GTCTCAAATA CGGTCGGAAA ATATCCGTAC    21524
                                                                  
.......... .......... .......... .......... .......... ..........      493


CGTTTTCATC CCTAGTTGCA ATGTTGAGAA AATTATTTTG GCAGCTGGAA TTCTTCCTTT    21584
                                                                  
.......... .......... .......... .......... .......... ..........      493


AGTTTGTCTT ACCAAAACAT TTGTTCTTGT TTCCTGCACC AGGTAGATGT TTGGGCATTA    21644
                                              ||||||||  |||||  |  
.......... .......... .......... .......... ..GTAGATGT ATGGGCTCTT      511


GGTGTATCTG CAATTGAGAT GGCAGAG    21671
|| || |||| | ||||| || ||| |||
GGAGTGTCTG CTATTGAAAT GGCGGAG      538





********************************************************************************
EST sequence   91 +strand (File: 13613476+)

     1  GGGTACATTG AGGCCACAGG GCAGTAAGGT GTCGTCGAGT TCAATACCGG ACAGTGTGAC
    61  TAGGGAAGAT CCTTGTACTA AGTATGAATT GCTCCACGAG CTAGGGAAGG GTTCATATGG
   121  GGCTGTTTAT AAAGCTCGAG ACTTGAGGAC TTCAGAAATG GTTGCCATCA AAGTCATATC
   181  ATTATCTGAA GGGGAGGAAG GCTATGAAGA AATTCGAGGT GAAATTGAGA TGTTGCAGCA
   241  GTGCAGTCAT CCAAATGTTG TTCGCTATCT TGGGAGCTAC CAAGGAGAAG AGTACCTTTG
   301  GATAGTAATG GAGTATTGTG GGGGTGGAAG TGTTGCTGAC TTAATGAATG TCACAGATGA
   361  GGCTTTAGAG GAGTATCAAA TAGCATTTAT TTGTCGAGAG GCATTGAAGG GCCTCTCCTA
   421  TCTGCACTCG ATTTTTAAAG TACACAGAGA TATTAAAGGT GGCAATATCT TACTGACTGA
   481  TCAAGGAGAG GTTAAGTTAG GTGATTTTGG TGTTGCTGCG CAGCTGACTA GAACCATGTC
   541  CAAACGT

Predicted gene structure (within gDNA segment 17254 to 19758):

 Exon  1  18165  18218 (  54 n);  cDNA     51    104 (  54 n); score: 0.778
  Intron  1  18219  18328 ( 110 n); Pd: 0.941 (s: 0.76), Pa: 0.878 (s: 0.66)
 Exon  2  18329  18417 (  89 n);  cDNA    105    193 (  89 n); score: 0.663
  Intron  2  18418  18626 ( 209 n); Pd: 0.993 (s: 0.62), Pa: 0.998 (s: 0.86)
 Exon  3  18627  18734 ( 108 n);  cDNA    194    301 ( 108 n); score: 0.852
  Intron  3  18735  18859 ( 125 n); Pd: 0.980 (s: 0.86), Pa: 0.787 (s: 0.80)
 Exon  4  18860  18967 ( 108 n);  cDNA    302    409 ( 108 n); score: 0.769
  Intron  4  18968  19065 (  98 n); Pd: 0.000 (s: 0.72), Pa: 0.953 (s: 0.84)
 Exon  5  19066  19156 (  91 n);  cDNA    410    500 (  91 n); score: 0.813
  Intron  5  19157  19270 ( 114 n); Pd: 0.984 (s: 0.80), Pa: 0.000 (s: 0.87)
 Exon  6  19271  19317 (  47 n);  cDNA    501    547 (  47 n); score: 0.872

MATCH	21326110+	13613476+	0.778	497	0.909	C
PGS_21326110+_13613476+	(18165  18218,18329  18417,18627  18734,18860  18967,19066  19156,19271  19317)

Alignment (genomic DNA sequence = upper lines):

ACAGTGTTAC CAGAGAGGAT CCTTCCACCA AGTACGAGCT GCTCCATGAG CTTGGTGCGC    18224
||||||| ||  || || ||| ||||  || | |||| ||  | |||||| ||| || |       
ACAGTGTGAC TAGGGAAGAT CCTTGTACTA AGTATGAATT GCTCCACGAG CTAG......      104


CTCTTGCTCT GGAATTATTG TTTCATTAGT TCTGTATGTC TACTTGTAGA ATGGCTGAAG    18284
                                                                  
.......... .......... .......... .......... .......... ..........      104


CTTTGAGCTG TTTTGCGAAA TGCAAAATTC AATTGGGAAT GCAGGGAAAG GCTCATATGG    18344
                                                |||| | | |||||||| 
.......... .......... .......... .......... ....GGAAGG GTTCATATGG      120


TGCAGTGTAC AAAGCAAGGG ATCTCAGAAC GCAGGAGCTT GTGGCTGTCA AGATTATCTC    18404
 || || ||  |||||  | | |  | || ||     ||  |  || ||  ||| |  | || || 
GGCTGTTTAT AAAGCTCGAG ACTTGAGGAC TTCAGAAATG GTTGCCATCA AAGTCATATC      180


ACTAACAGAA GGGGTTAGTT TCTAATTTTC TATTACAAAG TTCTGTGAAT ATTCTGAAAG    18464
| || | ||| |||                                                    
ATTATCTGAA GGG....... .......... .......... .......... ..........      193


GCCACCCGAG ACATATTTCA TATTTGGCAA CCATATTGCT TTTGTTGTGA GCATTTTGTT    18524
                                                                  
.......... .......... .......... .......... .......... ..........      193


TGCATGGGCT CAATTGTGAG AGAATCTCAT AAATGTGGTT GCTGTCTGTT TTCCGAGTCG    18584
                                                                  
.......... .......... .......... .......... .......... ..........      193


TTGCATTTTT CCAAAATATA AGTATGTATC TTTGGTTTTC AGGAAGAAGG ATATGAAGAC    18644
                                              || |||||  ||||||||  
.......... .......... .......... .......... ..GAGGAAGG CTATGAAGAA      211


ATACGGGGAG AAATTGAGAT GCTGCAGCAG TGTAGCCATC CAAATGTTGT CCGCTACTTT    18704
|| || || | |||||||||| | |||||||| || || |||| ||||||||||  |||||  || 
ATTCGAGGTG AAATTGAGAT GTTGCAGCAG TGCAGTCATC CAAATGTTGT TCGCTATCTT      271


GGAAGCTACC AAGGAGAGGA CTACCTATGG GTACAATCAA ATAGCCTGAT AGTATCCATT    18764
|| ||||||| ||||||| ||  ||||| |||                                  
GGGAGCTACC AAGGAGAAGA GTACCTTTGG .......... .......... ..........      301


TTATTAACAT TAAGAAATAA CTATCATTGG GAGATTTCTC TACTTCTTGA GTCATTTAAC    18824
                                                                  
.......... .......... .......... .......... .......... ..........      301


ATGGGCTTGA TGCAAATGCG ATTCTCAACT TACAGATAGT TATGGAGTAC TGTGGTGGTG    18884
                                      |||||  ||||||||  ||||| |||| 
.......... .......... .......... .....ATAGT AATGGAGTAT TGTGGGGGTG      326


GAAGTGTTGC TGATTTGATA GGCATCACAG AGGAGCCTCT TGATGAATCC CAAATAGCTT    18944
|||||||||| ||| || ||      |||||| | ||| || |  || || |   |||||||| | 
GAAGTGTTGC TGACTTAATG AATGTCACAG ATGAGGCTTT AGAGGAGTAT CAAATAGCAT      386


ATATATGTAG AGAAGCACTA AAGGTTCTAA CATAGTTGCA TCAGATTTGA AGTATTTGCT    19004
 ||| ||| | ||| ||| |  |||                                         
TTATTTGTCG AGAGGCATTG AAG....... .......... .......... ..........      409


GCCTTGTTGG GCAACTAAAT GTATTTGGAT ATTGAACTTT TGCGTGCTTA TTTTCTTCCA    19064
                                                                  
.......... .......... .......... .......... .......... ..........      409


GGGCCTTGCT TACCTGCACT CCATTTTTAA AGTTCATAGA GATATTAAGG GTGGCAACAT    19124
 |||||  |  || ||||||| | |||||||| ||| || ||| |||||||| | ||||||| || 
.GGCCTCTCC TATCTGCACT CGATTTTTAA AGTACACAGA GATATTAAAG GTGGCAATAT      468


TCTTCTAACT GAGCAAGGCG AGGTGAAGTT GGGTAAGCAC ATTTGTTTTC TTCAAAAGTT    19184
  | || ||| || ||||| | |||| |||||  |                               
CTTACTGACT GATCAAGGAG AGGTTAAGTT AG........ .......... ..........      500


TTAGTTTGCA TTCTTAGCAC CCATATTTCT GCATGTCCTG ACTCTGTGGT CGGCATGCTG    19244
                                                                  
.......... .......... .......... .......... .......... ..........      500


TGGCGCCACA ACAATGTGCA AAACAGGTGA TTTTGGTGTA GCTGCCCAGC TGACAAGAAC    19304
                            |||| |||||||||  ||||| |||| |||| ||||| 
.......... .......... ......GTGA TTTTGGTGTT GCTGCGCAGC TGACTAGAAC      534


CATGTCAAAG CGC    19317
|||||| ||  || 
CATGTCCAAA CGT      547





********************************************************************************
EST sequence   96 +strand (File: 21922100+)

     1  GGGTACATTT GAGGCCACAG GGCAGTAAGG TGTCGTCGAG TTCAATACCG GACAGTGTGA
    61  CTAGGGAAGA TCCTTGTACT AAGTATGAAT TGCTCCACGA GCTAGGGAAG GGTTCATATG
   121  GGGCTGTTTA TAAAGCTCGA GACTTGAGGA CTTCAGAAAT GGTTGCCATC AAAGTCATAT
   181  CATTATCTGA AGGGGAGGAA GGCTATGAAG AAATTCGAGG TGAAATTGAG ATGTTGCAGC
   241  AGTGCAGTCA TCCAAATGTT GTTCGCTATC TTGGGAGCTA CCAAGGAGAA GAGTACCTTT
   301  GGATAGTAAT GGAGTATTGT GGGGGTGGAA GTGTTGCTGA CTTAATGAAT GTCACAGATG
   361  AGGCTTTAGA GGAGTATCAA ATAGCATTTA TTTGTCGAGA GGCATTGAAG GGCCTCTCCT
   421  ATCTGCACTC GATTTTTAAA GTACACAGAG ATATTAAAGG TGGCAATATC TTACTGACTG

Predicted gene structure (within gDNA segment 17249 to 19902):

 Exon  1  18165  18218 (  54 n);  cDNA     52    105 (  54 n); score: 0.778
  Intron  1  18219  18328 ( 110 n); Pd: 0.941 (s: 0.76), Pa: 0.878 (s: 0.66)
 Exon  2  18329  18417 (  89 n);  cDNA    106    194 (  89 n); score: 0.663
  Intron  2  18418  18626 ( 209 n); Pd: 0.993 (s: 0.62), Pa: 0.998 (s: 0.86)
 Exon  3  18627  18734 ( 108 n);  cDNA    195    302 ( 108 n); score: 0.852
  Intron  3  18735  18859 ( 125 n); Pd: 0.980 (s: 0.86), Pa: 0.787 (s: 0.80)
 Exon  4  18860  18967 ( 108 n);  cDNA    303    410 ( 108 n); score: 0.769
  Intron  4  18968  19065 (  98 n); Pd: 0.000 (s: 0.72), Pa: 0.953 (s: 0.84)
 Exon  5  19066  19135 (  70 n);  cDNA    411    480 (  70 n); score: 0.814

MATCH	21326110+	21922100+	0.776	429	0.894	C
PGS_21326110+_21922100+	(18165  18218,18329  18417,18627  18734,18860  18967,19066  19135)

Alignment (genomic DNA sequence = upper lines):

ACAGTGTTAC CAGAGAGGAT CCTTCCACCA AGTACGAGCT GCTCCATGAG CTTGGTGCGC    18224
||||||| ||  || || ||| ||||  || | |||| ||  | |||||| ||| || |       
ACAGTGTGAC TAGGGAAGAT CCTTGTACTA AGTATGAATT GCTCCACGAG CTAG......      105


CTCTTGCTCT GGAATTATTG TTTCATTAGT TCTGTATGTC TACTTGTAGA ATGGCTGAAG    18284
                                                                  
.......... .......... .......... .......... .......... ..........      105


CTTTGAGCTG TTTTGCGAAA TGCAAAATTC AATTGGGAAT GCAGGGAAAG GCTCATATGG    18344
                                                |||| | | |||||||| 
.......... .......... .......... .......... ....GGAAGG GTTCATATGG      121


TGCAGTGTAC AAAGCAAGGG ATCTCAGAAC GCAGGAGCTT GTGGCTGTCA AGATTATCTC    18404
 || || ||  |||||  | | |  | || ||     ||  |  || ||  ||| |  | || || 
GGCTGTTTAT AAAGCTCGAG ACTTGAGGAC TTCAGAAATG GTTGCCATCA AAGTCATATC      181


ACTAACAGAA GGGGTTAGTT TCTAATTTTC TATTACAAAG TTCTGTGAAT ATTCTGAAAG    18464
| || | ||| |||                                                    
ATTATCTGAA GGG....... .......... .......... .......... ..........      194


GCCACCCGAG ACATATTTCA TATTTGGCAA CCATATTGCT TTTGTTGTGA GCATTTTGTT    18524
                                                                  
.......... .......... .......... .......... .......... ..........      194


TGCATGGGCT CAATTGTGAG AGAATCTCAT AAATGTGGTT GCTGTCTGTT TTCCGAGTCG    18584
                                                                  
.......... .......... .......... .......... .......... ..........      194


TTGCATTTTT CCAAAATATA AGTATGTATC TTTGGTTTTC AGGAAGAAGG ATATGAAGAC    18644
                                              || |||||  ||||||||  
.......... .......... .......... .......... ..GAGGAAGG CTATGAAGAA      212


ATACGGGGAG AAATTGAGAT GCTGCAGCAG TGTAGCCATC CAAATGTTGT CCGCTACTTT    18704
|| || || | |||||||||| | |||||||| || || |||| ||||||||||  |||||  || 
ATTCGAGGTG AAATTGAGAT GTTGCAGCAG TGCAGTCATC CAAATGTTGT TCGCTATCTT      272


GGAAGCTACC AAGGAGAGGA CTACCTATGG GTACAATCAA ATAGCCTGAT AGTATCCATT    18764
|| ||||||| ||||||| ||  ||||| |||                                  
GGGAGCTACC AAGGAGAAGA GTACCTTTGG .......... .......... ..........      302


TTATTAACAT TAAGAAATAA CTATCATTGG GAGATTTCTC TACTTCTTGA GTCATTTAAC    18824
                                                                  
.......... .......... .......... .......... .......... ..........      302


ATGGGCTTGA TGCAAATGCG ATTCTCAACT TACAGATAGT TATGGAGTAC TGTGGTGGTG    18884
                                      |||||  ||||||||  ||||| |||| 
.......... .......... .......... .....ATAGT AATGGAGTAT TGTGGGGGTG      327


GAAGTGTTGC TGATTTGATA GGCATCACAG AGGAGCCTCT TGATGAATCC CAAATAGCTT    18944
|||||||||| ||| || ||      |||||| | ||| || |  || || |   |||||||| | 
GAAGTGTTGC TGACTTAATG AATGTCACAG ATGAGGCTTT AGAGGAGTAT CAAATAGCAT      387


ATATATGTAG AGAAGCACTA AAGGTTCTAA CATAGTTGCA TCAGATTTGA AGTATTTGCT    19004
 ||| ||| | ||| ||| |  |||                                         
TTATTTGTCG AGAGGCATTG AAG....... .......... .......... ..........      410


GCCTTGTTGG GCAACTAAAT GTATTTGGAT ATTGAACTTT TGCGTGCTTA TTTTCTTCCA    19064
                                                                  
.......... .......... .......... .......... .......... ..........      410


GGGCCTTGCT TACCTGCACT CCATTTTTAA AGTTCATAGA GATATTAAGG GTGGCAACAT    19124
 |||||  |  || ||||||| | |||||||| ||| || ||| |||||||| | ||||||| || 
.GGCCTCTCC TATCTGCACT CGATTTTTAA AGTACACAGA GATATTAAAG GTGGCAATAT      469


TCTTCTAACT G    19135
  | || ||| |
CTTACTGACT G      480





********************************************************************************
EST sequence   94 +strand (File: 17069519+)

     1  GGTGACTAGG GAAGATCCTT GTACTAAGTA TGAATTGCTC CACGAGCTAG GGAAGGGTTC
    61  ATATGGGGCT GTTTATAAAG CTCGAGACTT GAGGACTTCA GAAATGGTTG CCATCAAAGT
   121  CATATCATTA TCTGAAGGGG AGGAAGGCTA TGAAGAAATT CGAGGTGAAA TTGAGATGTT
   181  GCAGCAGTGC AGTCATCCAA ATGTTGTTCG CTATCTTGGG AGCTACCAAG GCGAAGAGTA
   241  CCTTTGGATA GTAATGGAGT ATTGTGGGGG TGGAAGTGTT GCTGACTTAA TGAATGTCAC
   301  AGATGAGGCT TTAGAGGAGT ATCAAATAGC ATTTATTTGT CGAGAGGCAT TGAAGGGCCT
   361  CTCCTATCTG CACTCTATTT TTTAAGTACA CAGAGA

Predicted gene structure (within gDNA segment 17524 to 19757):

 Exon  1  18169  18218 (  50 n);  cDNA      1     50 (  50 n); score: 0.740
  Intron  1  18219  18328 ( 110 n); Pd: 0.941 (s: 0.74), Pa: 0.878 (s: 0.66)
 Exon  2  18329  18417 (  89 n);  cDNA     51    139 (  89 n); score: 0.663
  Intron  2  18418  18626 ( 209 n); Pd: 0.993 (s: 0.62), Pa: 0.998 (s: 0.86)
 Exon  3  18627  18734 ( 108 n);  cDNA    140    247 ( 108 n); score: 0.843
  Intron  3  18735  18859 ( 125 n); Pd: 0.980 (s: 0.84), Pa: 0.787 (s: 0.80)
 Exon  4  18860  18967 ( 108 n);  cDNA    248    355 ( 108 n); score: 0.769
  Intron  4  18968  19065 (  98 n); Pd: 0.000 (s: 0.72), Pa: 0.953 (s: 0.80)
 Exon  5  19066  19106 (  41 n);  cDNA    356    396 (  41 n); score: 0.805

MATCH	21326110+	17069519+	0.761	396	1.000	C
PGS_21326110+_17069519+	(18169  18218,18329  18417,18627  18734,18860  18967,19066  19106)

Alignment (genomic DNA sequence = upper lines):

TGTTACCAGA GAGGATCCTT CCACCAAGTA CGAGCTGCTC CATGAGCTTG GTGCGCCTCT    18228
 || || ||  || |||||||   || |||||  ||  ||||| || ||||| |            
GGTGACTAGG GAAGATCCTT GTACTAAGTA TGAATTGCTC CACGAGCTAG ..........       50


TGCTCTGGAA TTATTGTTTC ATTAGTTCTG TATGTCTACT TGTAGAATGG CTGAAGCTTT    18288
                                                                  
.......... .......... .......... .......... .......... ..........       50


GAGCTGTTTT GCGAAATGCA AAATTCAATT GGGAATGCAG GGAAAGGCTC ATATGGTGCA    18348
                                            |||| || || |||||| ||  
.......... .......... .......... .......... GGAAGGGTTC ATATGGGGCT       70


GTGTACAAAG CAAGGGATCT CAGAACGCAG GAGCTTGTGG CTGTCAAGAT TATCTCACTA    18408
|| || |||| |  | ||  |  || ||     ||  | || | |  ||||  |  || ||| || 
GTTTATAAAG CTCGAGACTT GAGGACTTCA GAAATGGTTG CCATCAAAGT CATATCATTA      130


ACAGAAGGGG TTAGTTTCTA ATTTTCTATT ACAAAGTTCT GTGAATATTC TGAAAGGCCA    18468
 | ||||||                                                         
TCTGAAGGG. .......... .......... .......... .......... ..........      139


CCCGAGACAT ATTTCATATT TGGCAACCAT ATTGCTTTTG TTGTGAGCAT TTTGTTTGCA    18528
                                                                  
.......... .......... .......... .......... .......... ..........      139


TGGGCTCAAT TGTGAGAGAA TCTCATAAAT GTGGTTGCTG TCTGTTTTCC GAGTCGTTGC    18588
                                                                  
.......... .......... .......... .......... .......... ..........      139


ATTTTTCCAA AATATAAGTA TGTATCTTTG GTTTTCAGGA AGAAGGATAT GAAGACATAC    18648
                                         ||  ||||| ||| ||||| || | 
.......... .......... .......... ........GA GGAAGGCTAT GAAGAAATTC      161


GGGGAGAAAT TGAGATGCTG CAGCAGTGTA GCCATCCAAA TGTTGTCCGC TACTTTGGAA    18708
| || ||||| ||||||| || |||||||| | | |||||||| |||||| ||| ||  |||| | 
GAGGTGAAAT TGAGATGTTG CAGCAGTGCA GTCATCCAAA TGTTGTTCGC TATCTTGGGA      221


GCTACCAAGG AGAGGACTAC CTATGGGTAC AATCAAATAG CCTGATAGTA TCCATTTTAT    18768
||||||||||  || || ||| || |||                                      
GCTACCAAGG CGAAGAGTAC CTTTGG.... .......... .......... ..........      247


TAACATTAAG AAATAACTAT CATTGGGAGA TTTCTCTACT TCTTGAGTCA TTTAACATGG    18828
                                                                  
.......... .......... .......... .......... .......... ..........      247


GCTTGATGCA AATGCGATTC TCAACTTACA GATAGTTATG GAGTACTGTG GTGGTGGAAG    18888
                                  ||||| ||| ||||| |||| | |||||||| 
.......... .......... .......... .ATAGTAATG GAGTATTGTG GGGGTGGAAG      276


TGTTGCTGAT TTGATAGGCA TCACAGAGGA GCCTCTTGAT GAATCCCAAA TAGCTTATAT    18948
|||||||||  || ||      ||||||| || | || | ||  || |  |||| |||| | ||| 
TGTTGCTGAC TTAATGAATG TCACAGATGA GGCTTTAGAG GAGTATCAAA TAGCATTTAT      336


ATGTAGAGAA GCACTAAAGG TTCTAACATA GTTGCATCAG ATTTGAAGTA TTTGCTGCCT    19008
 ||| ||||  ||| | |||                                              
TTGTCGAGAG GCATTGAAG. .......... .......... .......... ..........      355


TGTTGGGCAA CTAAATGTAT TTGGATATTG AACTTTTGCG TGCTTATTTT CTTCCAGGGC    19068
                                                              ||| 
.......... .......... .......... .......... .......... .......GGC      358


CTTGCTTACC TGCACTCCAT TTTTAAAGTT CATAGAGA    19106
||  | || | ||||||| || |||| ||||  || |||||
CTCTCCTATC TGCACTCTAT TTTTTAAGTA CACAGAGA      396





********************************************************************************
EST sequence   81 +strand (File: 22136893+)

     1  ATGGATCATA ACTCGCCGAA ATCTCGTCGG AGCCGGAAAC CGGAGCCCAA ACCTGACATA
    61  TACTCCACTT TCGTAGTCCA CTCCGACTCT GATTCTGATC AAGGTCGAGA TCGAGACAAA
   121  CGTAAAGCCA AACCTGAGGA AGACGAAAAT GTCGATTTAT ACGCTACAAT GGTCTACAAA
   181  GGCGATAGTG ACGGAGAAGG AGAGGAAGAT GATGATGACG ATTCTATGCT TCCTCCTCTT
   241  CTCAAGCGTC TTCCCAAGGA TTTCGGAGGC GGCGCGTCGC TCGATTACGA CGACGACGAC
   301  GGTGATGAAT CTGGAGATTT CGGTACGATG ATTGTGAAAA CAGATCGGAG TAGTCATAGT
   361  AAGAAGAACA GTCCGTACTC GTCCAAACCG CGAATGGGAG TTAGTCCTAG GAGGAGAGCG
   421  AGAGGCGGAG ATGAGGAATC TTCTGATGAA GAAGACGAAG AAGAAGATGA TGATGACGAC
   481  GACGGAGACT ACGGTACGTT TGTTGTGAAA TCTAAGGATA AAAAGGGAAA GAAGAAAGAC
   541  AAGGAGATTG ATATGACAAC TATGGGAAGA GCTGTTGCGA GTATGCAGAA ATCAAATTTT
   601  GGTGGTAAGA CTCGGAAATT GGATCCTTCC TCTTCTTCTT CGAAACTTCA CGGTGAAGAT
   661  AATCGGAAAA TGCAGCAGCA AAACAGGAAA GGATCATATG GATCTGTATA CAAGGCAAGA
   721  GATTTGAAAA CATCAGAGAT TGTTGCTGTG AAAGTCATAT CACTTACTGA AGGGGAGGAG
   781  GGGTATGAAG AGATCCGGGG AGAAATTGAG ATGCTGCAGC AATGTAATCA TCCTAATGTT
   841  GTCCGCTACC TAGGGAGTTA CCAAGGAGAA GATTATCTTT GGATAGTGAT GGAGTATTGT
   901  GGAGGTGGAA GTGTTGCTGA TCTTATGAAT GTTACTGAGG AGGCGTTAGA GGAGTATCAG
   961  ATAGCATATA TATGTCGGGA GGCGTTGAAG GGCCTTGCAT ACTTGCACTC AATATATAAA
  1021  GTCCATAGAG ACATTAAAGG TGGAAATATC TTGTTAACTG AACAAGGAGA GGTCAAGTTG
  1081  GGTGACTTTG GGGTTGCAGC TCAACTTACT CGCACTATGT CGAAGCGAAA CACGTTCATT
  1141  GGGACTCCAC ATTGGATGGC CCCAGAGGTT ATTCAGGAAA ATCGTTATGA TGGGAAGGTT
  1201  GATGTATGGG CTCTTGGTGT TTCAGCTATT GAGATGGCAG AGGGGCTCCC TCCAAGATCA
  1261  TCAGTTCATC CGATGAGGGT TTTGTTCATG ATATCCATCG AGCCAGCTCC AATGCTCGAG
  1321  GATAAAGAAA AATGGTCCCT GGTCTTTCAT GATTTTGTTG CAAAGTGCCT CACAAAGGAA
  1381  CCACGTCTTC GCCCAACTGC AGCTGAGATG CTTAAGCACA AATTTGTTGA GAGATGTAAA
  1441  ACTGGGGCTT CTGCAATGTC GCCAAAGATT GAGAAGTCCA GACAAATCAG AGCTACAATG
  1501  GCTCTGCAAG CGCAAAGTGT TGTCGCACCT TCTTTGGAGG ACACTTCAAC ACTGGGTCCA
  1561  AAATCAAGCG AGGAGCTTGG AATTACTGTT CCATCTAAAC CTCCTCAAAA TTCGACCGAA
  1621  GCACCTCTAA CCAGCACCCT GAATCGGCAG CATATTACTG GCAACACTGT GTTGGCTGGA
  1681  GAAGGTGGTG ACTTCGGAAC TATGATCGTT CATGGTGAGG ATGAGACAGA GGAGAGTGAC
  1741  TCCAGGTCTC AGCTTGTCAG AGAAAAAGAA TCTTCATCTT CTCAGTTTGA AGGTGTTCCT
  1801  CGCGAATTCC CAGGAGAAGA ATTACCTGAC TCATGGATAC ATGACAAAAA GAAGCCTCCG
  1861  GCTATTGATC TTCCAGTTGA AGCTTCGATT TCACAGAGCA TGCAGGCAAG TTCATCTCAT
  1921  GAGCATAGAA CCAAGCTACA TAACATAGCT GGAACACAGA TGGAAGGTGG CAGTGATGCA
  1981  AGTGGTAGTA CCTTGAAAAA TGAAACTGTT GGCAGGAAAG CTTTTGCTTT GCAAGATAAG
  2041  TTATGGTCAA TCTACGCAGC TGGAAACACA GTACCGATAC CGTTCTTGAG AGCAACAGAT
  2101  ATATCCCCAA TCGCACTCTT GTCAGAGAAC ATGATCGGAG GCATGCAACA AGATGGGAAT
  2161  GGAACTGTAG CCGTCGAAGC ACTTCAGGAG CTCTTCACTT CTTCTGATCC CCAATCCAAA
  2221  AAGGGCCGAC GTGGACAAAA CGAGATGCCT CTTCCTCCAA GCGTATACCA AAGACTGACA
  2281  ACAAGCTCTT CTCTGATGAA CCTTGCACAA GTTTTAGCCT ACCACAGAGC GTGTTACGAG
  2341  GAAATGCCGC TGCAGGAATT GCAAGCAACG CAGGAGCAGC AAACCATTCA GAATCTGTGC
  2401  GATACTCTTC GCACTATTCT CCGCCTCTAA ATAGTCTTGT GTTCATATCT GTTGCTCTCT

Predicted gene structure (within gDNA segment 14866 to 22500):

 Exon  1  14866  14879 (  14 n);  cDNA    666    678 (  13 n); score: 0.643
  Intron  1  14880  15135 ( 256 n); Pd: 0.978 (s:    0), Pa: 0.000 (s:    0)
 Exon  2  15136  15142 (   7 n);  cDNA    679    685 (   7 n); score: 0.857
  Intron  2  15143  18328 (3186 n); Pd: 0.635 (s:    0), Pa: 0.878 (s: 0.72)
 Exon  3  18329  18417 (  89 n);  cDNA    686    774 (  89 n); score: 0.742
  Intron  3  18418  18626 ( 209 n); Pd: 0.993 (s: 0.70), Pa: 0.998 (s: 0.88)
 Exon  4  18627  18734 ( 108 n);  cDNA    775    882 ( 108 n); score: 0.843
  Intron  4  18735  18859 ( 125 n); Pd: 0.980 (s: 0.82), Pa: 0.787 (s: 0.80)
 Exon  5  18860  18967 ( 108 n);  cDNA    883    990 ( 108 n); score: 0.741
  Intron  5  18968  19065 (  98 n); Pd: 0.000 (s: 0.68), Pa: 0.953 (s: 0.84)
 Exon  6  19066  19156 (  91 n);  cDNA    991   1081 (  91 n); score: 0.813
  Intron  6  19157  19270 ( 114 n); Pd: 0.984 (s: 0.78), Pa: 0.000 (s: 0.74)
 Exon  7  19271  19323 (  53 n);  cDNA   1082   1134 (  53 n); score: 0.755
  Intron  7  19324  20843 (1520 n); Pd: 0.770 (s: 0.74), Pa: 0.962 (s: 0.90)
 Exon  8  20844  20906 (  63 n);  cDNA   1135   1197 (  63 n); score: 0.905
  Intron  8  20907  21626 ( 720 n); Pd: 0.929 (s: 0.90), Pa: 0.999 (s: 0.82)
 Exon  9  21627  21671 (  45 n);  cDNA   1198   1242 (  45 n); score: 0.822
  Intron  9  21672  21777 ( 106 n); Pd: 0.992 (s: 0.82), Pa: 0.998 (s:    0)
 Exon 10  21778  21813 (  36 n);  cDNA   1243   1278 (  36 n); score: 0.722
  Intron 10  21814  22451 ( 638 n); Pd: 0.596 (s:    0), Pa: 0.894 (s: 0.84)
 Exon 11  22452  22500 (  49 n);  cDNA   1279   1327 (  49 n); score: 0.837

MATCH	21326110+	22136893+	0.797	663	0.270	C
PGS_21326110+_22136893+	(14866  14879,15136  15142,18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)

Alignment (genomic DNA sequence = upper lines):

GATGTTGCTG CCAGGTACGC TACTCCTGTA CTGGGAGCTT GTATGTGACT GCTTCTAAAG    14925
||   ||| |  |||                                                   
GAAAATGCAG -CAG...... .......... .......... .......... ..........      678


ATGGTTCTCT GCGCATTTGG GATGGAGTAT CTGCTGAATG TGTTCGACCT ATTATTGGAG    14985
                                                                  
.......... .......... .......... .......... .......... ..........      678


CACATGGATC TGCAGAAGCT ACTAGCGCAA TTTTCACCAG AGATGAGAGG TAAGCGAGCT    15045
                                                                  
.......... .......... .......... .......... .......... ..........      678


ACCAGCATGT CTAAGGTGCT CTTCCCTCAA GATAAAATCC AGTCATTGTT TGGTTTGAAG    15105
                                                                  
.......... .......... .......... .......... .......... ..........      678


AACAGAGAGA AAGGCATATG CTGTATGATT CAAGACAGTA ACTACTTCAA ACCCTGTTTG    15165
                                 ||| |||                          
.......... .......... .......... CAAAACA... .......... ..........      685


GAATGTGGGA ATCTTGTAGT GATTCTGAAT GATTTATAAC ATGTCCTGGA TAATTTCCTG    15225
                                                                  
.......... .......... .......... .......... .......... ..........      685


TGTTTCAGAC GTGTCGTAAC TTTATAACAC GAATAACTCT TTCTCCTTTA CCCTACTATT    15285
                                                                  
.......... .......... .......... .......... .......... ..........      685


TCACCACTAA ACAACTAACT TGCCTATAAA CACTTTTTAG ACTTCTTCTG AAAGGCCTAG    15345
                                                                  
.......... .......... .......... .......... .......... ..........      685


TGTTTATGTG GTTATATGCA GCGTGAATGC ACTTGCATAT AAGATTGATC TAAAAAATTG    15405
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATGTAGTGAA CTTTGACTAC CCGAAGTATA TGCTTAGATA GTTCATGGAT TTCTTTCATA    15465
                                                                  
.......... .......... .......... .......... .......... ..........      685


AAACTGCACA CTGTATTCTG GTTATCTGTT ATGAAGTTTA CTACGTTCTT TCAGGTATGT    15525
                                                                  
.......... .......... .......... .......... .......... ..........      685


CCTATCTTGT GGGAAAGATT CTTGTGTCAA GTTATGGGAA GTTGGCACTG GACGACTTGT    15585
                                                                  
.......... .......... .......... .......... .......... ..........      685


GAAGCAATAT GCAGGAGCCA TTCGCAGACA ATTTCGTTGT CAGGTTAGTT TCTCTGTGTT    15645
                                                                  
.......... .......... .......... .......... .......... ..........      685


TCTATAAGAT TATTATTTTT TCCTGATTTA AATTTACTCG TGTGCCATAT ATATTATTTT    15705
                                                                  
.......... .......... .......... .......... .......... ..........      685


TACCCAAAAT TTTAGGAAAC AAAATATTGC AATTCTTTAA TTTGAAAATA GGCTGGTTTG    15765
                                                                  
.......... .......... .......... .......... .......... ..........      685


AGCTTGCAGC TTAGGATAAC AACATACCTA ACCTTGCTAT GATAGACAAT AAATATGATA    15825
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATAACTGTTC TTACTATCCA GGCTGTCTTC AATGAAACCG AAGAATTTGT TCTATCAGTT    15885
                                                                  
.......... .......... .......... .......... .......... ..........      685


GATGAACAAA ACAATGAGGT AAATTCCAAA TTGAGAACAG TATATATATT TGTATTTCAG    15945
                                                                  
.......... .......... .......... .......... .......... ..........      685


CAAGCTTAAC TATGATACGT CACTCTTCAG GTTGTCGTCT GGGATGCACT TACTGCAGAA    16005
                                                                  
.......... .......... .......... .......... .......... ..........      685


AAGGTTGCAA GATTGCCCTC TGGCAGCACT GGTGCTCCCA GATGGCTCGA CCACTCCCCA    16065
                                                                  
.......... .......... .......... .......... .......... ..........      685


GTTGAACCAG TTTTTGTTAT TTGTGGAAAT GATAGATCGA TCAGATTCTG GAAACAAACC    16125
                                                                  
.......... .......... .......... .......... .......... ..........      685


GTATAGCTTG TAGATTCAAC CATTCAAATC AAAAGTATGC TTTCAGTATT ACGTTTCAGG    16185
                                                                  
.......... .......... .......... .......... .......... ..........      685


AGGAATGTGC TCATGTAACT TTAGTTGTAT ATGGGAGAAA TTTGCATAAG CATTTTTTTT    16245
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATTGGAAACT GCATAAGCAA TTGATTGATC TAATAGCAAA CCCCAATGAT ATGTTTTTTT    16305
                                                                  
.......... .......... .......... .......... .......... ..........      685


TTTGGCTCTG CATAGCTGAT GACAGTTGTA TGAACCCTTG ACCTGATTCT TATTGGTCAG    16365
                                                                  
.......... .......... .......... .......... .......... ..........      685


GCCCTTTTCG ATGATTTGCT ATTTTATCCC AATTGTGGAT TGCGGAATAT ATTTCTTCTT    16425
                                                                  
.......... .......... .......... .......... .......... ..........      685


CGAATGTAAT GATGGTCTCG CCCTACCACA TGTGTGATAG CCTATAAAAG TTCTACAACA    16485
                                                                  
.......... .......... .......... .......... .......... ..........      685


CATTATTGCA TTTCACTTAG GGCATGTTTA GATTGAAGAT GAAAATTTTT TAGGTCACAT    16545
                                                                  
.......... .......... .......... .......... .......... ..........      685


CGGATATGTC GGAAGGATGT CGGGAGGGGT TTTTAAAAAC TAATAAAAAA AACAAATTAC    16605
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATAACTCGTC AGGAAACTGC AAGACGAATC TATTAAGTAT AATTAATCTA TTATTAGCAC    16665
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATGTGGGTTA CTGTAGCACT TAAGGCTAAT CATGGACTAA CTAGGCTTAA AAAATTCATC    16725
                                                                  
.......... .......... .......... .......... .......... ..........      685


TCGCGATTTT CAACCAAACT GTGTAATTAT TTTTTATCTA CATTTAATGT TTTATGTATG    16785
                                                                  
.......... .......... .......... .......... .......... ..........      685


TGTCTAAAGA TTCAATGTGA TGGATGAAAA TTTTTTAGGT GGGAACTAAA CAGGGCCTTA    16845
                                                                  
.......... .......... .......... .......... .......... ..........      685


TATTTTTTAA AAAAGATGTG CAAGTGTCAG GCCTTGTTTA GTTTCGAAAA CTTTTTGGTT    16905
                                                                  
.......... .......... .......... .......... .......... ..........      685


TTTGAGACTG TAGCACTTTC GTTTTTATTT GACAAATATT GTCTAATCAT AGAGTAACTA    16965
                                                                  
.......... .......... .......... .......... .......... ..........      685


GGTTTAAAAG ATTTATCTCG CGATTTATAG GTAAACTGTG CAATTAGTTT TTATTTTTGT    17025
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATATATTTAA TGCTTCATGC ATGTGTCGTA ATATTTGATG TGTTGAGAAA TTTTGAAAAG    17085
                                                                  
.......... .......... .......... .......... .......... ..........      685


TTTTTGGTTT TTGGGGTGAG TGGAGAAAAA AGAGAAGCTC CTTTCGAGGA AGCTCTCTGC    17145
                                                                  
.......... .......... .......... .......... .......... ..........      685


GGCCTGTGGC TGCGGGTGAC TGGGTGTGGT CGTGTGGGCC TAGCGGGACT GCGGGAAGGA    17205
                                                                  
.......... .......... .......... .......... .......... ..........      685


AGAATTTGAC CGGATTCTCT ATGTCACGTG GGCCTAGAAT GGGATGGCCC ATCCGAGCCC    17265
                                                                  
.......... .......... .......... .......... .......... ..........      685


GACCCATATT TGCCAGATTC GAGTGAACTG GCTCCAACTA AACAATTTTC CCCATTTGCC    17325
                                                                  
.......... .......... .......... .......... .......... ..........      685


ATTCCCGACG AGCACCTTCA CCGTCTCCTC CCACCTCGCG TGGCACGCCA TGGCTTTCTC    17385
                                                                  
.......... .......... .......... .......... .......... ..........      685


CCCGCGCTCG CCGTGGTCGC GTCCCAAGAG AAACGACGTC TACTCAACCT TCGTCGTCCA    17445
                                                                  
.......... .......... .......... .......... .......... ..........      685


CGGCGATGAC GACGAGGACG ACGCCCGCGG CAGCAGGCGC GGCAGGGGCC CGTCCACGCG    17505
                                                                  
.......... .......... .......... .......... .......... ..........      685


GGCGGAGGAA GACGAGGAGG AAGACCCCTC CTCGCTGCCT CCGCTTCTCC AGCGGCTCCC    17565
                                                                  
.......... .......... .......... .......... .......... ..........      685


CAAGGACTTC GGCGGCCCCT CCTTTGACGA AGACGAGGAC GCCTACTCCT CCGACCCCGA    17625
                                                                  
.......... .......... .......... .......... .......... ..........      685


CGATGCTTCC CTCTCCGCTA CGGTGGTCTT CAAGAGCGGC GCCCCGGCCT CCGCTCGATC    17685
                                                                  
.......... .......... .......... .......... .......... ..........      685


TCCGTTCCTG GATCTGCGGC GCTCCAGCCC CCGCGCTACC GATGACGACC CATACTCTAC    17745
                                                                  
.......... .......... .......... .......... .......... ..........      685


CTTCGTCGTC CACTCCACCG CACGCTCGGG GGGGACCTCC TCCAGCCCTC GAGGGTCCGC    17805
                                                                  
.......... .......... .......... .......... .......... ..........      685


CTCAGGCACA TTCATCCGTC GCTCCGGGGG CTCGTCCAGC CCTCACGAAT CCGTCTCTGG    17865
                                                                  
.......... .......... .......... .......... .......... ..........      685


CACATTCATC CGCCGGACTA GCACCCCGTC GAGCCCCCGG GACTCGGTCT CCGGCACATT    17925
                                                                  
.......... .......... .......... .......... .......... ..........      685


CATCCGCCGA CCAGGGAGCC CGTCGAGCCC CCGCGGGTCG TTCTCTGGCA CCTTCATTCG    17985
                                                                  
.......... .......... .......... .......... .......... ..........      685


CCACACCAGC GGGGGTTCCA GTTCCTATGA ATCTGCTTCT GGCGGCGGCG GGGGTTTCGG    18045
                                                                  
.......... .......... .......... .......... .......... ..........      685


GTCCTCTTTC TGGAGTCCAG CGGTGGAGCA GACAGAGGAG CTCCGGCAAC CGTCGCCTCT    18105
                                                                  
.......... .......... .......... .......... .......... ..........      685


GATGCAGCAA CAACAGCAGC AGCATTCAAG GCGGAAGCCA TCAGTGAGCT CGGCGCCAGA    18165
                                                                  
.......... .......... .......... .......... .......... ..........      685


CAGTGTTACC AGAGAGGATC CTTCCACCAA GTACGAGCTG CTCCATGAGC TTGGTGCGCC    18225
                                                                  
.......... .......... .......... .......... .......... ..........      685


TCTTGCTCTG GAATTATTGT TTCATTAGTT CTGTATGTCT ACTTGTAGAA TGGCTGAAGC    18285
                                                                  
.......... .......... .......... .......... .......... ..........      685


TTTGAGCTGT TTTGCGAAAT GCAAAATTCA ATTGGGAATG CAGGGAAAGG CTCATATGGT    18345
                                               |||||||  ||||||||  
.......... .......... .......... .......... ...GGAAAGG ATCATATGGA      702


GCAGTGTACA AAGCAAGGGA TCTCAGAACG CAGGAGCTTG TGGCTGTCAA GATTATCTCA    18405
 | || |||| | ||||| || | | | |||     ||| ||| | ||||| ||   | || ||| 
TCTGTATACA AGGCAAGAGA TTTGAAAACA TCAGAGATTG TTGCTGTGAA AGTCATATCA      762


CTAACAGAAG GGGTTAGTTT CTAATTTTCT ATTACAAAGT TCTGTGAATA TTCTGAAAGG    18465
|| || |||| ||                                                     
CTTACTGAAG GG........ .......... .......... .......... ..........      774


CCACCCGAGA CATATTTCAT ATTTGGCAAC CATATTGCTT TTGTTGTGAG CATTTTGTTT    18525
                                                                  
.......... .......... .......... .......... .......... ..........      774


GCATGGGCTC AATTGTGAGA GAATCTCATA AATGTGGTTG CTGTCTGTTT TCCGAGTCGT    18585
                                                                  
.......... .......... .......... .......... .......... ..........      774


TGCATTTTTC CAAAATATAA GTATGTATCT TTGGTTTTCA GGAAGAAGGA TATGAAGACA    18645
                                             || || ||  |||||||| | 
.......... .......... .......... .......... .GAGGAGGGG TATGAAGAGA      793


TACGGGGAGA AATTGAGATG CTGCAGCAGT GTAGCCATCC AAATGTTGTC CGCTACTTTG    18705
| |||||||| |||||||||| |||||||| | |||  |||||  ||||||||| |||||| | | 
TCCGGGGAGA AATTGAGATG CTGCAGCAAT GTAATCATCC TAATGTTGTC CGCTACCTAG      853


GAAGCTACCA AGGAGAGGAC TACCTATGGG TACAATCAAA TAGCCTGATA GTATCCATTT    18765
| || ||||| |||||| ||  || || |||                                   
GGAGTTACCA AGGAGAAGAT TATCTTTGG. .......... .......... ..........      882


TATTAACATT AAGAAATAAC TATCATTGGG AGATTTCTCT ACTTCTTGAG TCATTTAACA    18825
                                                                  
.......... .......... .......... .......... .......... ..........      882


TGGGCTTGAT GCAAATGCGA TTCTCAACTT ACAGATAGTT ATGGAGTACT GTGGTGGTGG    18885
                                     |||||  |||||||| | |||| ||||| 
.......... .......... .......... ....ATAGTG ATGGAGTATT GTGGAGGTGG      908


AAGTGTTGCT GATTTGATAG GCATCACAGA GGAGCCTCTT GATGAATCCC AAATAGCTTA    18945
|||||||||| ||| | ||      | || || |||| |  |  || || |  | | ||||| || 
AAGTGTTGCT GATCTTATGA ATGTTACTGA GGAGGCGTTA GAGGAGTATC AGATAGCATA      968


TATATGTAGA GAAGCACTAA AGGTTCTAAC ATAGTTGCAT CAGATTTGAA GTATTTGCTG    19005
||||||| |  || ||  | | ||                                          
TATATGTCGG GAGGCGTTGA AG........ .......... .......... ..........      990


CCTTGTTGGG CAACTAAATG TATTTGGATA TTGAACTTTT GCGTGCTTAT TTTCTTCCAG    19065
                                                                  
.......... .......... .......... .......... .......... ..........      990


GGCCTTGCTT ACCTGCACTC CATTTTTAAA GTTCATAGAG ATATTAAGGG TGGCAACATT    19125
|||||||| | || |||||||  || | |||| || ||||||| | ||||| || ||| || ||  
GGCCTTGCAT ACTTGCACTC AATATATAAA GTCCATAGAG ACATTAAAGG TGGAAATATC     1050


CTTCTAACTG AGCAAGGCGA GGTGAAGTTG GGTAAGCACA TTTGTTTTCT TCAAAAGTTT    19185
 |  |||||| | ||||| || ||| |||||| |                                
TTGTTAACTG AACAAGGAGA GGTCAAGTTG G......... .......... ..........     1081


TAGTTTGCAT TCTTAGCACC CATATTTCTG CATGTCCTGA CTCTGTGGTC GGCATGCTGT    19245
                                                                  
.......... .......... .......... .......... .......... ..........     1081


GGCGCCACAA CAATGTGCAA AACAGGTGAT TTTGGTGTAG CTGCCCAGCT GACAAGAACC    19305
                           ||||  ||||| || | | || || ||  ||  | ||  
.......... .......... .....GTGAC TTTGGGGTTG CAGCTCAACT TACTCGCACT     1116


ATGTCAAAGC GCAACACGGT ATTCTAAACA GTGTTTGTTT TGCCATTCAA ATCCATAGTT    19365
||||| |||| | ||||||                                               
ATGTCGAAGC GAAACACG.. .......... .......... .......... ..........     1134


CAAGAAACTT CACATCGATG TAACAAACAA AATGAAGTGG CAGATGAAAC TTGTCCATGC    19425
                                                                  
.......... .......... .......... .......... .......... ..........     1134


CAGTTTACCA TAAGCGGACC CATTTGTGCT TGTGCATAGT TCTTCAATGT GATGGTACTT    19485
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TTATGGGAAC TTGAAGCAAG TCTGTGTTGG AAAATGATTG CTGTGAAGTC CTAACTGTTT    19545
                                                                  
.......... .......... .......... .......... .......... ..........     1134


CTTTAAGTGT CATACTGCAA GTGCATTATG GTCTATTAGG TTTAAAATGA AAAATAAGAA    19605
                                                                  
.......... .......... .......... .......... .......... ..........     1134


AGTATATATT TGTTATCTAG TATGCCTCGC CTAATTCCTT GGCATTTCTT CCATTCTTTG    19665
                                                                  
.......... .......... .......... .......... .......... ..........     1134


AAACCCATAC TGGTGGAACC TAGTTGAAGT GGTTCCTGTA CAAATACTCT CTGCACTGCT    19725
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TCTTCTCCCT TTCTTGTCGT GACAGCCTCT AGTCCCCATA TATCCCATTA TGAATCTGCT    19785
                                                                  
.......... .......... .......... .......... .......... ..........     1134


CACTCCCCCA TTTGGCTTCT TCCTAGGCCA CCACTCAACA ATTCTTCTGT TCTTGATGAC    19845
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TGCGATGCTC CATTCGATCT GGCAAATTGC TGCCTTGCTG GAGCTATTCA AGAACGTAGA    19905
                                                                  
.......... .......... .......... .......... .......... ..........     1134


GGGTTACTGT GACATTAGCA TATCAAACCA ACAGGTCTGT TGGAAATCAT AATCACAATG    19965
                                                                  
.......... .......... .......... .......... .......... ..........     1134


AACCTCCAAG TGGGAAATAT TATCCAGGGC GTCATCTTAC CTCCAAGTTA TGGACTCTGC    20025
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TTGACACTAG AGGAAGAGTT AGTGCACAGG GAGTCCAAAT CAGGTAGGAT AGTTGATAGT    20085
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TCATAATTGG CTAGATCTAG GAGGAGGTAT GTGAGTGAGA GTTTGGAAAA TCAGGGTAGA    20145
                                                                  
.......... .......... .......... .......... .......... ..........     1134


ATACAAGTTC AGGTTCCCTA GGACGATGAT ATAATGTAGT ACCATACTAC AAGAATTGAC    20205
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TATGGAATTT ATTAATATCT AGCTAGAAAC CAATATAAAA AAACAATCTA CTCCCCTTTC    20265
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TACTGCTGCT GATACTTCTA CTCTTTTTTT TTTCTCTCTT GTACACCTTC TTGGCTGCTA    20325
                                                                  
.......... .......... .......... .......... .......... ..........     1134


CACTTCTCTA GTTTCCAATC ATGACAATAC ATAAATGCTT GAGGAGCCCA TAACAAATAG    20385
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TTCTACCCCA CCCACCCACA CCCTTTCGTA GTAAAGTGTG CCGACAACAG TTGGTGCCCT    20445
                                                                  
.......... .......... .......... .......... .......... ..........     1134


CTTCTCGATG GTATCCATTG CTTTTCTGCA TGCACACACA AACAAACACT TCTAAATACA    20505
                                                                  
.......... .......... .......... .......... .......... ..........     1134


CATACTGACT TGTCGTATTG GCATGCAGTC ATGCATTGAG ACCAAATCCA TCAGGACTGC    20565
                                                                  
.......... .......... .......... .......... .......... ..........     1134


ATCCGCACAA CACAAAATCT CACCATACAT GCATACGGTG TCTTGGATGT TTCTGTTGTT    20625
                                                                  
.......... .......... .......... .......... .......... ..........     1134


GGGGCGCTAA TATGTACTTC TACCAAAATG CAAGGACAAA CTGTCCCAAT TTTACAGTAA    20685
                                                                  
.......... .......... .......... .......... .......... ..........     1134


AATAACTATC ATTGTGAAAC AGACTGTCAG CATCGCTCTC TAAGCTCAGT CTGTACAGCT    20745
                                                                  
.......... .......... .......... .......... .......... ..........     1134


TTTACCAAAT AAAAATAATG CAATGGTTTT TGGAAAGAAT AAAGGTTTTA GTGGCACACT    20805
                                                                  
.......... .......... .......... .......... .......... ..........     1134


AATTTCCATA ATTTGACCCT TCATGTTTAT GCTTTCAGTT CATTGGTACT CCACATTGGA    20865
                                         || |||||| ||| |||||||||| 
.......... .......... .......... ........TT CATTGGGACT CCACATTGGA     1156


TGGCACCAGA GGTCATTCAA GAAAGTCGTT ATGATGGAAA GGTATCATGC TATCATCTCT    20925
|||| ||||| ||| |||||  |||| ||||| ||||||| || |                     
TGGCCCCAGA GGTTATTCAG GAAAATCGTT ATGATGGGAA G......... ..........     1197


ACGGTGTTCA GCTATGGAAT TGTTCATTTT AGCAGCTTTT GTGGATGTTG CCATTTTACT    20985
                                                                  
.......... .......... .......... .......... .......... ..........     1197


CTAAAGACTT GGTGGCCGTA AATTTATGAT TGGGTTTTCA GTGAACAGGA TTTCTTTAAT    21045
                                                                  
.......... .......... .......... .......... .......... ..........     1197


ATTTTGTTTC TTTGGGTGTG GAATGTCCTT GCATATGGCA GAACAAGGTT ACACGTAAAT    21105
                                                                  
.......... .......... .......... .......... .......... ..........     1197


TCATAAAAGC CATTAAATAA TTGTTATGGA ACCCCTGCCA GTGCCAAAAC ATGTTTATTT    21165
                                                                  
.......... .......... .......... .......... .......... ..........     1197


CTTTTCCTTG TCTCTTGATG GTTCCTCAAG CAAAAAAAAA ATAAAATAAA ATCATTACCT    21225
                                                                  
.......... .......... .......... .......... .......... ..........     1197


ACTACTAAGC CTCCAAAACA AGTCTACTGG TTGCAATTAG GGATGAAAAC GGATCGGATA    21285
                                                                  
.......... .......... .......... .......... .......... ..........     1197


CGGACGGATA TCATCGATAT CATATTTGTT TTCGTATTTC TGGTCGAATT CGGATTCGAA    21345
                                                                  
.......... .......... .......... .......... .......... ..........     1197


TACGGATAAT GTCAACTATA TCGGATAAGA TACGATTGGA TGTCGACATC ATAAATATAT    21405
                                                                  
.......... .......... .......... .......... .......... ..........     1197


GATTTAAGTA CTCGGATACG GATACGGTAT CGGATGTAGA ACATTCGAAC TCGGATACGA    21465
                                                                  
.......... .......... .......... .......... .......... ..........     1197


ACTGGTCTGA ATCCCTCTAA ACGAATTCGG TCTCAAATAC GGTCGGAAAA TATCCGTACC    21525
                                                                  
.......... .......... .......... .......... .......... ..........     1197


GTTTTCATCC CTAGTTGCAA TGTTGAGAAA ATTATTTTGG CAGCTGGAAT TCTTCCTTTA    21585
                                                                  
.......... .......... .......... .......... .......... ..........     1197


GTTTGTCTTA CCAAAACATT TGTTCTTGTT TCCTGCACCA GGTAGATGTT TGGGCATTAG    21645
                                             || |||||  |||||  | | 
.......... .......... .......... .......... .GTTGATGTA TGGGCTCTTG     1216


GTGTATCTGC AATTGAGATG GCAGAGGTAG ACATTGTTCC TTGCTTCTTT CTTTTTTTGA    21705
|||| || ||  ||||||||| ||||||                                      
GTGTTTCAGC TATTGAGATG GCAGAG.... .......... .......... ..........     1242


CTGTACACTT TTGTTTTTAA TTTTGTGTCG TGACAATGCT TTTTAATATT TATTTTGTAT    21765
                                                                  
.......... .......... .......... .......... .......... ..........     1242


CTCTGACTGT AGGGCATGCC ACCAAGATCC ACTGTACATC CAATGAGAGT AAGAGATGCT    21825
             ||  | ||  ||||||||   | || |||| | |||||               
.......... ..GGGCTCCC TCCAAGATCA TCAGTTCATC CGATGAGG.. ..........     1278


TCTCAATGCC TGTTAGTATC TGCAGTTAAT GAGGCTAATA GGTTATAACA GAATTAAAAA    21885
                                                                  
.......... .......... .......... .......... .......... ..........     1278


AATCTGCTCT ATCTTTGGTG CACTGTACTT TTTATCTCTT TACTGTCAAG GGCGTCGAGG    21945
                                                                  
.......... .......... .......... .......... .......... ..........     1278


GACAGGGTAG GAGGATCCCG GCTACGTAGT TCATAGACCA ATCTGTGGTG TGGGGCGGAG    22005
                                                                  
.......... .......... .......... .......... .......... ..........     1278


GTTTTACCCC TCAGTGCCCG ATTGTTTCAG CAAAGGTAGA TTAGGGAATT GGGATAATTG    22065
                                                                  
.......... .......... .......... .......... .......... ..........     1278


TTCTTTCTTG ATTATCATCA TACGAGTACA AGAATATATA GGCCATTCGG CCATAACAGC    22125
                                                                  
.......... .......... .......... .......... .......... ..........     1278


TTGGAGCCAA TTGCTCCTAA ATCTAAGGCC ATTATCGGCT CTCCTGCCTT CTAGGCTCTC    22185
                                                                  
.......... .......... .......... .......... .......... ..........     1278


GCCTGTTCAG TGTGCTCTGC ATGCGTGGTG ACCGCGCCTA CGGTTCTGCT GGTGCGCCAT    22245
                                                                  
.......... .......... .......... .......... .......... ..........     1278


CTGCGGCTCT GCGAGCATCC TGGGCGTGCC GTTTCCTTGT GTAGGCGCGG TCCCACATGA    22305
                                                                  
.......... .......... .......... .......... .......... ..........     1278


CATTTACTTT CTTTCTGATG CATTTGCTTC TTTACTTTGC CTTGGTAAAT ATTTGGTATA    22365
                                                                  
.......... .......... .......... .......... .......... ..........     1278


CATATCAATA TATTGTTTCA TCTTCGTTTA GCATGAATGC TTGATAGACC GACTAACGAT    22425
                                                                  
.......... .......... .......... .......... .......... ..........     1278


CTCTCTTCCC CCTTCCCTTA TCTCAGGTTA TCTTCATGAT ATCCAGTGAA CCAGCACCAA    22485
                            |||  | |||||||| |||||  ||  ||||| |||| 
.......... .......... ......GTTT TGTTCATGAT ATCCATCGAG CCAGCTCCAA     1312


TGCTGGAGGA TAAGG    22500
|||| ||||| ||| |
TGCTCGAGGA TAAAG     1327





********************************************************************************
EST sequence   80 +strand (File: 18176307+)

     1  GCCTGACTCT CTTTCTCTCT CTCCCGGCGA CGACGGTTTA GAGTCGCCAT AGATGGATCA
    61  TAACTCGCCG AAATCTCGTC GGAGCCGGAA ACCGGAGCCC AAACCTGACA TATACTCCAC
   121  TTTCGTAGTC CACTCCGACT CTGATTCTGA TCAAGGTCGA GATCGAGACA AACGTAAAGC
   181  CAAACCTGAG GAAGACGAAA ATGTCGATTT ATACGCTACA ATGGTCTACA AAGGCGATAG
   241  TGACGGAGAA GGAGAGGAAG ATGATGATGA CGATTCTATG CTTCCTCCTC TTCTCAAGCG
   301  TCTTCCCAAG GATTTCGGAG GCGGCGCGTC GCTCGATTAC GACGACGACG ACGGTGATGA
   361  ATCTGGAGAT TTCGGTACGA TGATTGTGAA AACAGATCGG AGTAGTCATA GTAAGAAGAA
   421  CAGTCCGTAC TCGTCCAAAC CGCGAATGGG AGTTAGTCCT AGGAGGAGAG CGAGAGGCGG
   481  AGATGAGGAA TCTTCTGATG AAGAAGACGA AGAAGAAGAT GATGATGACG ACGACGGAGA
   541  CTACGGTACG TTTGTTGTGA AATCTAAGGA TAAAAAGGGA AAGAAGAAAG ACAAGGAGAT
   601  TGATATGACA ACTATGGGAA GAGCTGTTGC GAGTATGCAG AAATCAAATT TTGGTGGTAA
   661  GACTCGGAAA TTGGATCCTT CCTCTTCTTC TTCGAAACTT CACGGTGAAG ATAATCGGAA
   721  AATGCAGCAG CAAAACAGGA AAGGATCATA TGGATCTGTA TACAAGGCAA GAGATTTGAA
   781  AACATCAGAG ATTGTTGCTG TGAAAGTCAT ATCACTTACT GAAGGGGAGG AGGGGTATGA
   841  AGAGATCCGG GGAGAAATTG AGATGCTGCA GCAATGTAAT CATCCTAATG TTGTCCGCTA
   901  CCTAGGGAGT TACCAAGGAG AAGATTATCT TTGGATAGTG ATGGAGTATT GTGGAGGTGG
   961  AAGTGTTGCT GATCTTATGA ATGTTACTGA GGAGGCGTTA GAGGAGTATC AGATAGCATA
  1021  TATATGTCGG GAGGCGTTGA AGGGCCTTGC ATACTTGCAC TCAATATATA AAGTCCATAG
  1081  AGACATTAAA GGTGGAAATA TCTTGTTAAC TGAACAAGGA GAGGTCAAGT TGGGTGACTT
  1141  TGGGGTTGCA GCTCAACTTA CTCGCACTAT GTCGAAGCGA AACACGTTCA TTGGGACTCC
  1201  ACATTGGATG GCCCCAGAGG TTATTCAGGA AAATCGTTAT GATGGGAAGG TTGATGTATG
  1261  GGCTCTTGGT GTTTCAGCTA TTGAGATGGC AGAGGGGCTC CCTCCAAGAT CATCAGTTCA
  1321  TCCGATGAGG GTTTTGTTCA TGATATCCAT CGAGCCAGCT CCAATGCTCG AGGATAAAGA
  1381  AAAATGGTCC CTGGTCTTTC ATGATTTTGT TGCAAAGTGC CTCACAAAGG AACCACGTCT
  1441  TCGCCCAACT GCAGCTGAGA TGCTTAAGCA CAAATTTGTT GAGAGATGTA AAACTGGGGC
  1501  TTCTGCAATG TCGCCAAAGA TTGAGAAGTC CAGACAAATC AGAGCTACAA TGGCTCTGCA
  1561  AGCGCAAAGT GTTGTCGCAC CTTCTTTGGA GGACACTTCA ACACTGGGTC CAAAATCAAG
  1621  CGAGGAGCTT GGAATTACTG TTCCATCTAA ACCTCCTCAA AATTCGACCG AAGCACCTCT
  1681  AACCAGCACC CTGAATCGGC AGCATATTAC TGGCAACACT GTGTTGGCTG GAGAAGGTGG
  1741  TGACTTCGGA ACTATGATCG TTCATGGTGA GGATGAGACA GAGGAGAGTG ACTCCAGGTC
  1801  TCAGCTTGTC AGAGAAAAAG AATCTTCATC TTCTCAGTTT GAAGGTGTTC CTCGCGAATT
  1861  CCCAGGAGAA GAATTACCTG ACTCATGGAT ACATGACAAA AAGAAGCCTC CGGCTATTGA
  1921  TCTTCCAGTT GAAGCTTCGA TTTCACAGAG CATGCAGGCA AGTTCATCTC ATGAGCATAG
  1981  AACCAAGCTA CATAACATAG CTGGAACACA GATGGAAGGT GGCAGTGATG CAAGTGGTAG
  2041  TACCTTGAAA AATGAAACTG TTGGCAGGAA AGCTTTTGCT TTGCAAGATA AGTTATGGTC
  2101  AATCTACGCA GCTGGAAACA CAGTACCGAT ACCGTTCTTG AGAGCAACAG ATATATCCCC
  2161  AATCGCACTC TTGTCAGAGA ACATGATCGG AGGCATGCAA CAAGATGGGA ATGGAACTGT
  2221  AGCCGTCGAA GCACTTCAGG AGCTCTTCAC TTCTTCTGAT CCCCAATCCA AAAAGGGCCG
  2281  ACGTGGACAA AACGAGATGC CTCTTCCTCC AAGCGTATAC CAAAGACTGA CAACAAGCTC
  2341  TTCTCTGATG AACCTTGCAC AAGTTTTAGC CTACCACAGA GCGTGTTACG AGGAAATGCC
  2401  GCTGCAGGAA TTGCAAGCAA CGCAGGAGCA GCAAACCATT CAGAATCTGT GCGATACTCT
  2461  TCGCACTATT CTCCGCCTCT AAATAGTCTT GTGTTCATAT CTGTTGCTAC TCTTGTATTA
  2521  GTATAGGTCG TCTCAGCAAG TACATGTTTA TTTTCCTAGA AGTTTTTATT AAAAACCAAT
  2581  CAATTTTGTC TCAAAAAAAA AAAAAAAA

Predicted gene structure (within gDNA segment 14898 to 22500):

 Exon  1  18329  18417 (  89 n);  cDNA    738    826 (  89 n); score: 0.742
  Intron  1  18418  18626 ( 209 n); Pd: 0.993 (s: 0.70), Pa: 0.998 (s: 0.88)
 Exon  2  18627  18734 ( 108 n);  cDNA    827    934 ( 108 n); score: 0.843
  Intron  2  18735  18859 ( 125 n); Pd: 0.980 (s: 0.82), Pa: 0.787 (s: 0.80)
 Exon  3  18860  18967 ( 108 n);  cDNA    935   1042 ( 108 n); score: 0.741
  Intron  3  18968  19065 (  98 n); Pd: 0.000 (s: 0.68), Pa: 0.953 (s: 0.84)
 Exon  4  19066  19156 (  91 n);  cDNA   1043   1133 (  91 n); score: 0.813
  Intron  4  19157  19270 ( 114 n); Pd: 0.984 (s: 0.78), Pa: 0.000 (s: 0.74)
 Exon  5  19271  19323 (  53 n);  cDNA   1134   1186 (  53 n); score: 0.755
  Intron  5  19324  20843 (1520 n); Pd: 0.770 (s: 0.74), Pa: 0.962 (s: 0.90)
 Exon  6  20844  20906 (  63 n);  cDNA   1187   1249 (  63 n); score: 0.905
  Intron  6  20907  21626 ( 720 n); Pd: 0.929 (s: 0.90), Pa: 0.999 (s: 0.82)
 Exon  7  21627  21671 (  45 n);  cDNA   1250   1294 (  45 n); score: 0.822
  Intron  7  21672  21777 ( 106 n); Pd: 0.992 (s: 0.82), Pa: 0.998 (s:    0)
 Exon  8  21778  21813 (  36 n);  cDNA   1295   1330 (  36 n); score: 0.722
  Intron  8  21814  22451 ( 638 n); Pd: 0.596 (s:    0), Pa: 0.894 (s: 0.84)
 Exon  9  22452  22500 (  49 n);  cDNA   1331   1379 (  49 n); score: 0.837
 PPA                              cDNA   2593   2608

MATCH	21326110+	18176307+	0.797	642	0.246	C
PGS_21326110+_18176307+	(18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)

Alignment (genomic DNA sequence = upper lines):

GGAAAGGCTC ATATGGTGCA GTGTACAAAG CAAGGGATCT CAGAACGCAG GAGCTTGTGG    18388
||||||| || ||||||  |  || ||||| | |||| ||| |  | |||     ||| |||| | 
GGAAAGGATC ATATGGATCT GTATACAAGG CAAGAGATTT GAAAACATCA GAGATTGTTG      797


CTGTCAAGAT TATCTCACTA ACAGAAGGGG TTAGTTTCTA ATTTTCTATT ACAAAGTTCT    18448
|||| ||  |  || |||||  || ||||||                                   
CTGTGAAAGT CATATCACTT ACTGAAGGG. .......... .......... ..........      826


GTGAATATTC TGAAAGGCCA CCCGAGACAT ATTTCATATT TGGCAACCAT ATTGCTTTTG    18508
                                                                  
.......... .......... .......... .......... .......... ..........      826


TTGTGAGCAT TTTGTTTGCA TGGGCTCAAT TGTGAGAGAA TCTCATAAAT GTGGTTGCTG    18568
                                                                  
.......... .......... .......... .......... .......... ..........      826


TCTGTTTTCC GAGTCGTTGC ATTTTTCCAA AATATAAGTA TGTATCTTTG GTTTTCAGGA    18628
                                                               || 
.......... .......... .......... .......... .......... ........GA      828


AGAAGGATAT GAAGACATAC GGGGAGAAAT TGAGATGCTG CAGCAGTGTA GCCATCCAAA    18688
 || || ||| ||||| || | |||||||||| |||||||||| ||||| ||||   ||||| || 
GGAGGGGTAT GAAGAGATCC GGGGAGAAAT TGAGATGCTG CAGCAATGTA ATCATCCTAA      888


TGTTGTCCGC TACTTTGGAA GCTACCAAGG AGAGGACTAC CTATGGGTAC AATCAAATAG    18748
|||||||||| ||| | || | | |||||||| ||| || ||  || |||                
TGTTGTCCGC TACCTAGGGA GTTACCAAGG AGAAGATTAT CTTTGG.... ..........      934


CCTGATAGTA TCCATTTTAT TAACATTAAG AAATAACTAT CATTGGGAGA TTTCTCTACT    18808
                                                                  
.......... .......... .......... .......... .......... ..........      934


TCTTGAGTCA TTTAACATGG GCTTGATGCA AATGCGATTC TCAACTTACA GATAGTTATG    18868
                                                        ||||| ||| 
.......... .......... .......... .......... .......... .ATAGTGATG      943


GAGTACTGTG GTGGTGGAAG TGTTGCTGAT TTGATAGGCA TCACAGAGGA GCCTCTTGAT    18928
||||| |||| | |||||||| ||||||||||  | ||      | || ||||| | |  | ||  
GAGTATTGTG GAGGTGGAAG TGTTGCTGAT CTTATGAATG TTACTGAGGA GGCGTTAGAG     1003


GAATCCCAAA TAGCTTATAT ATGTAGAGAA GCACTAAAGG TTCTAACATA GTTGCATCAG    18988
|| |  || | |||| ||||| |||| | ||  ||  | |||                        
GAGTATCAGA TAGCATATAT ATGTCGGGAG GCGTTGAAG. .......... ..........     1042


ATTTGAAGTA TTTGCTGCCT TGTTGGGCAA CTAAATGTAT TTGGATATTG AACTTTTGCG    19048
                                                                  
.......... .......... .......... .......... .......... ..........     1042


TGCTTATTTT CTTCCAGGGC CTTGCTTACC TGCACTCCAT TTTTAAAGTT CATAGAGATA    19108
                  ||| ||||| |||  ||||||| ||  | ||||||  |||||||| | 
.......... .......GGC CTTGCATACT TGCACTCAAT ATATAAAGTC CATAGAGACA     1085


TTAAGGGTGG CAACATTCTT CTAACTGAGC AAGGCGAGGT GAAGTTGGGT AAGCACATTT    19168
|||| |||||  || ||  |   ||||||| | |||| |||||  |||||||              
TTAAAGGTGG AAATATCTTG TTAACTGAAC AAGGAGAGGT CAAGTTGG.. ..........     1133


GTTTTCTTCA AAAGTTTTAG TTTGCATTCT TAGCACCCAT ATTTCTGCAT GTCCTGACTC    19228
                                                                  
.......... .......... .......... .......... .......... ..........     1133


TGTGGTCGGC ATGCTGTGGC GCCACAACAA TGTGCAAAAC AGGTGATTTT GGTGTAGCTG    19288
                                              |||| ||| || || || | 
.......... .......... .......... .......... ..GTGACTTT GGGGTTGCAG     1151


CCCAGCTGAC AAGAACCATG TCAAAGCGCA ACACGGTATT CTAAACAGTG TTTGTTTTGC    19348
| || || ||   | || ||| || ||||| | |||||                            
CTCAACTTAC TCGCACTATG TCGAAGCGAA ACACG..... .......... ..........     1186


CATTCAAATC CATAGTTCAA GAAACTTCAC ATCGATGTAA CAAACAAAAT GAAGTGGCAG    19408
                                                                  
.......... .......... .......... .......... .......... ..........     1186


ATGAAACTTG TCCATGCCAG TTTACCATAA GCGGACCCAT TTGTGCTTGT GCATAGTTCT    19468
                                                                  
.......... .......... .......... .......... .......... ..........     1186


TCAATGTGAT GGTACTTTTA TGGGAACTTG AAGCAAGTCT GTGTTGGAAA ATGATTGCTG    19528
                                                                  
.......... .......... .......... .......... .......... ..........     1186


TGAAGTCCTA ACTGTTTCTT TAAGTGTCAT ACTGCAAGTG CATTATGGTC TATTAGGTTT    19588
                                                                  
.......... .......... .......... .......... .......... ..........     1186


AAAATGAAAA ATAAGAAAGT ATATATTTGT TATCTAGTAT GCCTCGCCTA ATTCCTTGGC    19648
                                                                  
.......... .......... .......... .......... .......... ..........     1186


ATTTCTTCCA TTCTTTGAAA CCCATACTGG TGGAACCTAG TTGAAGTGGT TCCTGTACAA    19708
                                                                  
.......... .......... .......... .......... .......... ..........     1186


ATACTCTCTG CACTGCTTCT TCTCCCTTTC TTGTCGTGAC AGCCTCTAGT CCCCATATAT    19768
                                                                  
.......... .......... .......... .......... .......... ..........     1186


CCCATTATGA ATCTGCTCAC TCCCCCATTT GGCTTCTTCC TAGGCCACCA CTCAACAATT    19828
                                                                  
.......... .......... .......... .......... .......... ..........     1186


CTTCTGTTCT TGATGACTGC GATGCTCCAT TCGATCTGGC AAATTGCTGC CTTGCTGGAG    19888
                                                                  
.......... .......... .......... .......... .......... ..........     1186


CTATTCAAGA ACGTAGAGGG TTACTGTGAC ATTAGCATAT CAAACCAACA GGTCTGTTGG    19948
                                                                  
.......... .......... .......... .......... .......... ..........     1186


AAATCATAAT CACAATGAAC CTCCAAGTGG GAAATATTAT CCAGGGCGTC ATCTTACCTC    20008
                                                                  
.......... .......... .......... .......... .......... ..........     1186


CAAGTTATGG ACTCTGCTTG ACACTAGAGG AAGAGTTAGT GCACAGGGAG TCCAAATCAG    20068
                                                                  
.......... .......... .......... .......... .......... ..........     1186


GTAGGATAGT TGATAGTTCA TAATTGGCTA GATCTAGGAG GAGGTATGTG AGTGAGAGTT    20128
                                                                  
.......... .......... .......... .......... .......... ..........     1186


TGGAAAATCA GGGTAGAATA CAAGTTCAGG TTCCCTAGGA CGATGATATA ATGTAGTACC    20188
                                                                  
.......... .......... .......... .......... .......... ..........     1186


ATACTACAAG AATTGACTAT GGAATTTATT AATATCTAGC TAGAAACCAA TATAAAAAAA    20248
                                                                  
.......... .......... .......... .......... .......... ..........     1186


CAATCTACTC CCCTTTCTAC TGCTGCTGAT ACTTCTACTC TTTTTTTTTT CTCTCTTGTA    20308
                                                                  
.......... .......... .......... .......... .......... ..........     1186


CACCTTCTTG GCTGCTACAC TTCTCTAGTT TCCAATCATG ACAATACATA AATGCTTGAG    20368
                                                                  
.......... .......... .......... .......... .......... ..........     1186


GAGCCCATAA CAAATAGTTC TACCCCACCC ACCCACACCC TTTCGTAGTA AAGTGTGCCG    20428
                                                                  
.......... .......... .......... .......... .......... ..........     1186


ACAACAGTTG GTGCCCTCTT CTCGATGGTA TCCATTGCTT TTCTGCATGC ACACACAAAC    20488
                                                                  
.......... .......... .......... .......... .......... ..........     1186


AAACACTTCT AAATACACAT ACTGACTTGT CGTATTGGCA TGCAGTCATG CATTGAGACC    20548
                                                                  
.......... .......... .......... .......... .......... ..........     1186


AAATCCATCA GGACTGCATC CGCACAACAC AAAATCTCAC CATACATGCA TACGGTGTCT    20608
                                                                  
.......... .......... .......... .......... .......... ..........     1186


TGGATGTTTC TGTTGTTGGG GCGCTAATAT GTACTTCTAC CAAAATGCAA GGACAAACTG    20668
                                                                  
.......... .......... .......... .......... .......... ..........     1186


TCCCAATTTT ACAGTAAAAT AACTATCATT GTGAAACAGA CTGTCAGCAT CGCTCTCTAA    20728
                                                                  
.......... .......... .......... .......... .......... ..........     1186


GCTCAGTCTG TACAGCTTTT ACCAAATAAA AATAATGCAA TGGTTTTTGG AAAGAATAAA    20788
                                                                  
.......... .......... .......... .......... .......... ..........     1186


GGTTTTAGTG GCACACTAAT TTCCATAATT TGACCCTTCA TGTTTATGCT TTCAGTTCAT    20848
                                                            ||||| 
.......... .......... .......... .......... .......... .....TTCAT     1191


TGGTACTCCA CATTGGATGG CACCAGAGGT CATTCAAGAA AGTCGTTATG ATGGAAAGGT    20908
||| |||||| |||||||||| | ||||||||  ||||| ||| | |||||||| |||| |||   
TGGGACTCCA CATTGGATGG CCCCAGAGGT TATTCAGGAA AATCGTTATG ATGGGAAG..     1249


ATCATGCTAT CATCTCTACG GTGTTCAGCT ATGGAATTGT TCATTTTAGC AGCTTTTGTG    20968
                                                                  
.......... .......... .......... .......... .......... ..........     1249


GATGTTGCCA TTTTACTCTA AAGACTTGGT GGCCGTAAAT TTATGATTGG GTTTTCAGTG    21028
                                                                  
.......... .......... .......... .......... .......... ..........     1249


AACAGGATTT CTTTAATATT TTGTTTCTTT GGGTGTGGAA TGTCCTTGCA TATGGCAGAA    21088
                                                                  
.......... .......... .......... .......... .......... ..........     1249


CAAGGTTACA CGTAAATTCA TAAAAGCCAT TAAATAATTG TTATGGAACC CCTGCCAGTG    21148
                                                                  
.......... .......... .......... .......... .......... ..........     1249


CCAAAACATG TTTATTTCTT TTCCTTGTCT CTTGATGGTT CCTCAAGCAA AAAAAAAATA    21208
                                                                  
.......... .......... .......... .......... .......... ..........     1249


AAATAAAATC ATTACCTACT ACTAAGCCTC CAAAACAAGT CTACTGGTTG CAATTAGGGA    21268
                                                                  
.......... .......... .......... .......... .......... ..........     1249


TGAAAACGGA TCGGATACGG ACGGATATCA TCGATATCAT ATTTGTTTTC GTATTTCTGG    21328
                                                                  
.......... .......... .......... .......... .......... ..........     1249


TCGAATTCGG ATTCGAATAC GGATAATGTC AACTATATCG GATAAGATAC GATTGGATGT    21388
                                                                  
.......... .......... .......... .......... .......... ..........     1249


CGACATCATA AATATATGAT TTAAGTACTC GGATACGGAT ACGGTATCGG ATGTAGAACA    21448
                                                                  
.......... .......... .......... .......... .......... ..........     1249


TTCGAACTCG GATACGAACT GGTCTGAATC CCTCTAAACG AATTCGGTCT CAAATACGGT    21508
                                                                  
.......... .......... .......... .......... .......... ..........     1249


CGGAAAATAT CCGTACCGTT TTCATCCCTA GTTGCAATGT TGAGAAAATT ATTTTGGCAG    21568
                                                                  
.......... .......... .......... .......... .......... ..........     1249


CTGGAATTCT TCCTTTAGTT TGTCTTACCA AAACATTTGT TCTTGTTTCC TGCACCAGGT    21628
                                                               || 
.......... .......... .......... .......... .......... ........GT     1251


AGATGTTTGG GCATTAGGTG TATCTGCAAT TGAGATGGCA GAGGTAGACA TTGTTCCTTG    21688
 ||||| ||| ||  | |||| | || || || |||||||||| |||                   
TGATGTATGG GCTCTTGGTG TTTCAGCTAT TGAGATGGCA GAG....... ..........     1294


CTTCTTTCTT TTTTTGACTG TACACTTTTG TTTTTAATTT TGTGTCGTGA CAATGCTTTT    21748
                                                                  
.......... .......... .......... .......... .......... ..........     1294


TAATATTTAT TTTGTATCTC TGACTGTAGG GCATGCCACC AAGATCCACT GTACATCCAA    21808
                               | |  | || || ||||||  |  || ||||| | 
.......... .......... .........G GGCTCCCTCC AAGATCATCA GTTCATCCGA     1325


TGAGAGTAAG AGATGCTTCT CAATGCCTGT TAGTATCTGC AGTTAATGAG GCTAATAGGT    21868
||||                                                              
TGAGG..... .......... .......... .......... .......... ..........     1330


TATAACAGAA TTAAAAAAAT CTGCTCTATC TTTGGTGCAC TGTACTTTTT ATCTCTTTAC    21928
                                                                  
.......... .......... .......... .......... .......... ..........     1330


TGTCAAGGGC GTCGAGGGAC AGGGTAGGAG GATCCCGGCT ACGTAGTTCA TAGACCAATC    21988
                                                                  
.......... .......... .......... .......... .......... ..........     1330


TGTGGTGTGG GGCGGAGGTT TTACCCCTCA GTGCCCGATT GTTTCAGCAA AGGTAGATTA    22048
                                                                  
.......... .......... .......... .......... .......... ..........     1330


GGGAATTGGG ATAATTGTTC TTTCTTGATT ATCATCATAC GAGTACAAGA ATATATAGGC    22108
                                                                  
.......... .......... .......... .......... .......... ..........     1330


CATTCGGCCA TAACAGCTTG GAGCCAATTG CTCCTAAATC TAAGGCCATT ATCGGCTCTC    22168
                                                                  
.......... .......... .......... .......... .......... ..........     1330


CTGCCTTCTA GGCTCTCGCC TGTTCAGTGT GCTCTGCATG CGTGGTGACC GCGCCTACGG    22228
                                                                  
.......... .......... .......... .......... .......... ..........     1330


TTCTGCTGGT GCGCCATCTG CGGCTCTGCG AGCATCCTGG GCGTGCCGTT TCCTTGTGTA    22288
                                                                  
.......... .......... .......... .......... .......... ..........     1330


GGCGCGGTCC CACATGACAT TTACTTTCTT TCTGATGCAT TTGCTTCTTT ACTTTGCCTT    22348
                                                                  
.......... .......... .......... .......... .......... ..........     1330


GGTAAATATT TGGTATACAT ATCAATATAT TGTTTCATCT TCGTTTAGCA TGAATGCTTG    22408
                                                                  
.......... .......... .......... .......... .......... ..........     1330


ATAGACCGAC TAACGATCTC TCTTCCCCCT TCCCTTATCT CAGGTTATCT TCATGATATC    22468
                                               ||| | | |||||||||| 
.......... .......... .......... .......... ...GTTTTGT TCATGATATC     1347


CAGTGAACCA GCACCAATGC TGGAGGATAA GG    22500
||  || ||| || ||||||| | ||||||||  |
CATCGAGCCA GCTCCAATGC TCGAGGATAA AG     1379





********************************************************************************
EST sequence   93 +strand (File: 13615373+)

     1  GAGATGTTGC AGCAGTGCAG TCATCCAAAT GTTGTTCGCT ATCTTGGGAG CTACCAAGGC
    61  GAAGAGTACC TTTGGATAGT AATGGAGTAT TGTGGGGGTG GAAGTGTTGC TGACTTAATG
   121  AATGTCACAG ATGAGGCTTT AGAGGAGTAT CAAATAGCAT TTATTTGTCG AGAGGCATTG
   181  AAGGGCCTCT CCTATCTGCA CTCTATTTTT AAAGTACACA GAGATATTAA AGGTGGCAAT
   241  ATCTTACTGA CTGATCAAGG AGAGGTTAAG TTAGGTGATT TTGGTGTTGC TGCGCAGCTG
   301  ACTAGAACCA TGTCCAAACG TAACACGTTT ATCGGCACTC CCCATTGGAT GGCACCAGAA
   361  GTTATTCAAG AAAGTCGTTA TGATGGGAAG GTAGATGTAT GGGCTCTCGG AGTGTCTGCT
   421  ATTGAAATGG CGGAGGGTCT TCCTCCTAGG GCAACAGTGC ATCCAATGAG GGTGCTATTT
   481  ATGATATCCA TTGAACCAGC TCCAATGCTT GAGGATAAAG AGAAATGGTC TCTTGTATTC
   541  CATGATTTTG TTGCCAAGTG CCTTACAAAA GACACCCGAC TTCGTCCAAC TGCCTTCGAG
   601  ATGCTAAAGC ACAAATTCAT CGAAAAATTC AAGCAGGAGC TTTCTGTATG ATGCCGAAGA
   661  TT

Predicted gene structure (within gDNA segment 18276 to 22500):

 Exon  1  18660  18734 (  75 n);  cDNA      1     75 (  75 n); score: 0.853
  Intron  1  18735  18859 ( 125 n); Pd: 0.980 (s: 0.84), Pa: 0.787 (s: 0.80)
 Exon  2  18860  18967 ( 108 n);  cDNA     76    183 ( 108 n); score: 0.769
  Intron  2  18968  19065 (  98 n); Pd: 0.000 (s: 0.72), Pa: 0.953 (s: 0.84)
 Exon  3  19066  19156 (  91 n);  cDNA    184    274 (  91 n); score: 0.813
  Intron  3  19157  19270 ( 114 n); Pd: 0.984 (s: 0.80), Pa: 0.000 (s: 0.88)
 Exon  4  19271  19323 (  53 n);  cDNA    275    327 (  53 n); score: 0.887
  Intron  4  19324  20843 (1520 n); Pd: 0.770 (s: 0.88), Pa: 0.962 (s: 0.88)
 Exon  5  20844  20906 (  63 n);  cDNA    328    390 (  63 n); score: 0.889
  Intron  5  20907  21626 ( 720 n); Pd: 0.929 (s: 0.92), Pa: 0.999 (s: 0.80)
 Exon  6  21627  21671 (  45 n);  cDNA    391    435 (  45 n); score: 0.800
  Intron  6  21672  21777 ( 106 n); Pd: 0.992 (s: 0.80), Pa: 0.998 (s:    0)
 Exon  7  21778  21813 (  36 n);  cDNA    436    471 (  36 n); score: 0.694
  Intron  7  21814  22451 ( 638 n); Pd: 0.596 (s:    0), Pa: 0.894 (s: 0.84)
 Exon  8  22452  22500 (  49 n);  cDNA    472    520 (  49 n); score: 0.837

MATCH	21326110+	13615373+	0.831	520	0.785	C
PGS_21326110+_13615373+	(18660  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)

Alignment (genomic DNA sequence = upper lines):

GAGATGCTGC AGCAGTGTAG CCATCCAAAT GTTGTCCGCT ACTTTGGAAG CTACCAAGGA    18719
|||||| ||| ||||||| ||  ||||||||| ||||| |||| |  |||| || |||||||||  
GAGATGTTGC AGCAGTGCAG TCATCCAAAT GTTGTTCGCT ATCTTGGGAG CTACCAAGGC       60


GAGGACTACC TATGGGTACA ATCAAATAGC CTGATAGTAT CCATTTTATT AACATTAAGA    18779
|| || |||| | |||                                                  
GAAGAGTACC TTTGG..... .......... .......... .......... ..........       75


AATAACTATC ATTGGGAGAT TTCTCTACTT CTTGAGTCAT TTAACATGGG CTTGATGCAA    18839
                                                                  
.......... .......... .......... .......... .......... ..........       75


ATGCGATTCT CAACTTACAG ATAGTTATGG AGTACTGTGG TGGTGGAAGT GTTGCTGATT    18899
                      ||||| |||| |||| |||||  ||||||||| |||||||| | 
.......... .......... ATAGTAATGG AGTATTGTGG GGGTGGAAGT GTTGCTGACT      115


TGATAGGCAT CACAGAGGAG CCTCTTGATG AATCCCAAAT AGCTTATATA TGTAGAGAAG    18959
| ||     | |||||| |||  || | || | | |  ||||| ||| | |||  ||| |||| | 
TAATGAATGT CACAGATGAG GCTTTAGAGG AGTATCAAAT AGCATTTATT TGTCGAGAGG      175


CACTAAAGGT TCTAACATAG TTGCATCAGA TTTGAAGTAT TTGCTGCCTT GTTGGGCAAC    19019
|| | |||                                                          
CATTGAAG.. .......... .......... .......... .......... ..........      183


TAAATGTATT TGGATATTGA ACTTTTGCGT GCTTATTTTC TTCCAGGGCC TTGCTTACCT    19079
                                                  |||| |  | || || 
.......... .......... .......... .......... ......GGCC TCTCCTATCT      197


GCACTCCATT TTTAAAGTTC ATAGAGATAT TAAGGGTGGC AACATTCTTC TAACTGAGCA    19139
|||||| ||| |||||||| | | |||||||| ||| |||||| || ||  | | | ||||| || 
GCACTCTATT TTTAAAGTAC ACAGAGATAT TAAAGGTGGC AATATCTTAC TGACTGATCA      257


AGGCGAGGTG AAGTTGGGTA AGCACATTTG TTTTCTTCAA AAGTTTTAGT TTGCATTCTT    19199
||| |||||  ||||| |                                                
AGGAGAGGTT AAGTTAG... .......... .......... .......... ..........      274


AGCACCCATA TTTCTGCATG TCCTGACTCT GTGGTCGGCA TGCTGTGGCG CCACAACAAT    19259
                                                                  
.......... .......... .......... .......... .......... ..........      274


GTGCAAAACA GGTGATTTTG GTGTAGCTGC CCAGCTGACA AGAACCATGT CAAAGCGCAA    19319
            ||||||||| |||| |||||  ||||||||  |||||||||| | || || || 
.......... .GTGATTTTG GTGTTGCTGC GCAGCTGACT AGAACCATGT CCAAACGTAA      323


CACGGTATTC TAAACAGTGT TTGTTTTGCC ATTCAAATCC ATAGTTCAAG AAACTTCACA    19379
||||                                                              
CACG...... .......... .......... .......... .......... ..........      327


TCGATGTAAC AAACAAAATG AAGTGGCAGA TGAAACTTGT CCATGCCAGT TTACCATAAG    19439
                                                                  
.......... .......... .......... .......... .......... ..........      327


CGGACCCATT TGTGCTTGTG CATAGTTCTT CAATGTGATG GTACTTTTAT GGGAACTTGA    19499
                                                                  
.......... .......... .......... .......... .......... ..........      327


AGCAAGTCTG TGTTGGAAAA TGATTGCTGT GAAGTCCTAA CTGTTTCTTT AAGTGTCATA    19559
                                                                  
.......... .......... .......... .......... .......... ..........      327


CTGCAAGTGC ATTATGGTCT ATTAGGTTTA AAATGAAAAA TAAGAAAGTA TATATTTGTT    19619
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATCTAGTATG CCTCGCCTAA TTCCTTGGCA TTTCTTCCAT TCTTTGAAAC CCATACTGGT    19679
                                                                  
.......... .......... .......... .......... .......... ..........      327


GGAACCTAGT TGAAGTGGTT CCTGTACAAA TACTCTCTGC ACTGCTTCTT CTCCCTTTCT    19739
                                                                  
.......... .......... .......... .......... .......... ..........      327


TGTCGTGACA GCCTCTAGTC CCCATATATC CCATTATGAA TCTGCTCACT CCCCCATTTG    19799
                                                                  
.......... .......... .......... .......... .......... ..........      327


GCTTCTTCCT AGGCCACCAC TCAACAATTC TTCTGTTCTT GATGACTGCG ATGCTCCATT    19859
                                                                  
.......... .......... .......... .......... .......... ..........      327


CGATCTGGCA AATTGCTGCC TTGCTGGAGC TATTCAAGAA CGTAGAGGGT TACTGTGACA    19919
                                                                  
.......... .......... .......... .......... .......... ..........      327


TTAGCATATC AAACCAACAG GTCTGTTGGA AATCATAATC ACAATGAACC TCCAAGTGGG    19979
                                                                  
.......... .......... .......... .......... .......... ..........      327


AAATATTATC CAGGGCGTCA TCTTACCTCC AAGTTATGGA CTCTGCTTGA CACTAGAGGA    20039
                                                                  
.......... .......... .......... .......... .......... ..........      327


AGAGTTAGTG CACAGGGAGT CCAAATCAGG TAGGATAGTT GATAGTTCAT AATTGGCTAG    20099
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATCTAGGAGG AGGTATGTGA GTGAGAGTTT GGAAAATCAG GGTAGAATAC AAGTTCAGGT    20159
                                                                  
.......... .......... .......... .......... .......... ..........      327


TCCCTAGGAC GATGATATAA TGTAGTACCA TACTACAAGA ATTGACTATG GAATTTATTA    20219
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATATCTAGCT AGAAACCAAT ATAAAAAAAC AATCTACTCC CCTTTCTACT GCTGCTGATA    20279
                                                                  
.......... .......... .......... .......... .......... ..........      327


CTTCTACTCT TTTTTTTTTC TCTCTTGTAC ACCTTCTTGG CTGCTACACT TCTCTAGTTT    20339
                                                                  
.......... .......... .......... .......... .......... ..........      327


CCAATCATGA CAATACATAA ATGCTTGAGG AGCCCATAAC AAATAGTTCT ACCCCACCCA    20399
                                                                  
.......... .......... .......... .......... .......... ..........      327


CCCACACCCT TTCGTAGTAA AGTGTGCCGA CAACAGTTGG TGCCCTCTTC TCGATGGTAT    20459
                                                                  
.......... .......... .......... .......... .......... ..........      327


CCATTGCTTT TCTGCATGCA CACACAAACA AACACTTCTA AATACACATA CTGACTTGTC    20519
                                                                  
.......... .......... .......... .......... .......... ..........      327


GTATTGGCAT GCAGTCATGC ATTGAGACCA AATCCATCAG GACTGCATCC GCACAACACA    20579
                                                                  
.......... .......... .......... .......... .......... ..........      327


AAATCTCACC ATACATGCAT ACGGTGTCTT GGATGTTTCT GTTGTTGGGG CGCTAATATG    20639
                                                                  
.......... .......... .......... .......... .......... ..........      327


TACTTCTACC AAAATGCAAG GACAAACTGT CCCAATTTTA CAGTAAAATA ACTATCATTG    20699
                                                                  
.......... .......... .......... .......... .......... ..........      327


TGAAACAGAC TGTCAGCATC GCTCTCTAAG CTCAGTCTGT ACAGCTTTTA CCAAATAAAA    20759
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATAATGCAAT GGTTTTTGGA AAGAATAAAG GTTTTAGTGG CACACTAATT TCCATAATTT    20819
                                                                  
.......... .......... .......... .......... .......... ..........      327


GACCCTTCAT GTTTATGCTT TCAGTTCATT GGTACTCCAC ATTGGATGGC ACCAGAGGTC    20879
                          || ||  || ||||| | |||||||||| |||||| ||  
.......... .......... ....TTTATC GGCACTCCCC ATTGGATGGC ACCAGAAGTT      363


ATTCAAGAAA GTCGTTATGA TGGAAAGGTA TCATGCTATC ATCTCTACGG TGTTCAGCTA    20939
|||||||||| |||||||||| ||| |||                                     
ATTCAAGAAA GTCGTTATGA TGGGAAG... .......... .......... ..........      390


TGGAATTGTT CATTTTAGCA GCTTTTGTGG ATGTTGCCAT TTTACTCTAA AGACTTGGTG    20999
                                                                  
.......... .......... .......... .......... .......... ..........      390


GCCGTAAATT TATGATTGGG TTTTCAGTGA ACAGGATTTC TTTAATATTT TGTTTCTTTG    21059
                                                                  
.......... .......... .......... .......... .......... ..........      390


GGTGTGGAAT GTCCTTGCAT ATGGCAGAAC AAGGTTACAC GTAAATTCAT AAAAGCCATT    21119
                                                                  
.......... .......... .......... .......... .......... ..........      390


AAATAATTGT TATGGAACCC CTGCCAGTGC CAAAACATGT TTATTTCTTT TCCTTGTCTC    21179
                                                                  
.......... .......... .......... .......... .......... ..........      390


TTGATGGTTC CTCAAGCAAA AAAAAAATAA AATAAAATCA TTACCTACTA CTAAGCCTCC    21239
                                                                  
.......... .......... .......... .......... .......... ..........      390


AAAACAAGTC TACTGGTTGC AATTAGGGAT GAAAACGGAT CGGATACGGA CGGATATCAT    21299
                                                                  
.......... .......... .......... .......... .......... ..........      390


CGATATCATA TTTGTTTTCG TATTTCTGGT CGAATTCGGA TTCGAATACG GATAATGTCA    21359
                                                                  
.......... .......... .......... .......... .......... ..........      390


ACTATATCGG ATAAGATACG ATTGGATGTC GACATCATAA ATATATGATT TAAGTACTCG    21419
                                                                  
.......... .......... .......... .......... .......... ..........      390


GATACGGATA CGGTATCGGA TGTAGAACAT TCGAACTCGG ATACGAACTG GTCTGAATCC    21479
                                                                  
.......... .......... .......... .......... .......... ..........      390


CTCTAAACGA ATTCGGTCTC AAATACGGTC GGAAAATATC CGTACCGTTT TCATCCCTAG    21539
                                                                  
.......... .......... .......... .......... .......... ..........      390


TTGCAATGTT GAGAAAATTA TTTTGGCAGC TGGAATTCTT CCTTTAGTTT GTCTTACCAA    21599
                                                                  
.......... .......... .......... .......... .......... ..........      390


AACATTTGTT CTTGTTTCCT GCACCAGGTA GATGTTTGGG CATTAGGTGT ATCTGCAATT    21659
                             ||| ||||| |||| |  | || ||  ||||| ||| 
.......... .......... .......GTA GATGTATGGG CTCTCGGAGT GTCTGCTATT      423


GAGATGGCAG AGGTAGACAT TGTTCCTTGC TTCTTTCTTT TTTTGACTGT ACACTTTTGT    21719
|| ||||| | ||                                                     
GAAATGGCGG AG........ .......... .......... .......... ..........      435


TTTTAATTTT GTGTCGTGAC AATGCTTTTT AATATTTATT TTGTATCTCT GACTGTAGGG    21779
                                                               || 
.......... .......... .......... .......... .......... ........GG      437


CATGCCACCA AGATCCACTG TACATCCAAT GAGAGTAAGA GATGCTTCTC AATGCCTGTT    21839
  | || ||  ||  | || | | |||||||| |||                              
TCTTCCTCCT AGGGCAACAG TGCATCCAAT GAGG...... .......... ..........      471


AGTATCTGCA GTTAATGAGG CTAATAGGTT ATAACAGAAT TAAAAAAATC TGCTCTATCT    21899
                                                                  
.......... .......... .......... .......... .......... ..........      471


TTGGTGCACT GTACTTTTTA TCTCTTTACT GTCAAGGGCG TCGAGGGACA GGGTAGGAGG    21959
                                                                  
.......... .......... .......... .......... .......... ..........      471


ATCCCGGCTA CGTAGTTCAT AGACCAATCT GTGGTGTGGG GCGGAGGTTT TACCCCTCAG    22019
                                                                  
.......... .......... .......... .......... .......... ..........      471


TGCCCGATTG TTTCAGCAAA GGTAGATTAG GGAATTGGGA TAATTGTTCT TTCTTGATTA    22079
                                                                  
.......... .......... .......... .......... .......... ..........      471


TCATCATACG AGTACAAGAA TATATAGGCC ATTCGGCCAT AACAGCTTGG AGCCAATTGC    22139
                                                                  
.......... .......... .......... .......... .......... ..........      471


TCCTAAATCT AAGGCCATTA TCGGCTCTCC TGCCTTCTAG GCTCTCGCCT GTTCAGTGTG    22199
                                                                  
.......... .......... .......... .......... .......... ..........      471


CTCTGCATGC GTGGTGACCG CGCCTACGGT TCTGCTGGTG CGCCATCTGC GGCTCTGCGA    22259
                                                                  
.......... .......... .......... .......... .......... ..........      471


GCATCCTGGG CGTGCCGTTT CCTTGTGTAG GCGCGGTCCC ACATGACATT TACTTTCTTT    22319
                                                                  
.......... .......... .......... .......... .......... ..........      471


CTGATGCATT TGCTTCTTTA CTTTGCCTTG GTAAATATTT GGTATACATA TCAATATATT    22379
                                                                  
.......... .......... .......... .......... .......... ..........      471


GTTTCATCTT CGTTTAGCAT GAATGCTTGA TAGACCGACT AACGATCTCT CTTCCCCCTT    22439
                                                                  
.......... .......... .......... .......... .......... ..........      471


CCCTTATCTC AGGTTATCTT CATGATATCC AGTGAACCAG CACCAATGCT GGAGGATAAG    22499
             ||  | ||  ||||||||| | |||||||| | ||||||||  ||||||||  
.......... ..GTGCTATT TATGATATCC ATTGAACCAG CTCCAATGCT TGAGGATAAA      519


G    22500
|
G      520





********************************************************************************
EST sequence   98 +strand (File: 13610520+)

     1  GAGATGTTGC AGCAGTGCAG TCATCCAAAT GTTGTTCGCT ATCTTGGGAG CTACCAAGGC
    61  GAAGAGTACC TTTGGATAGT AATGGAGTAT TGTGGGGGTG GAAGTGTTGC TGACTTAATG
   121  AATGTCACAG ATGAGGCTTT AGAGGAGTAT CAAATAGCAT TTATTTGTCG AGAGGCATTG
   181  AAGGGCCTCT CCTATCTGCA CTCTATTTTT AAAGTACACA GAGATATTAA AGGTGGCAAT
   241  ATCTTACTGA CTGATCAAGG AGAGGTTAAG TTAGGTGATT TTGGTGTTGC TGCGCAGCTG
   301  ACTAGAACCA TGTCCAAACG TAACACGTTT ATCGGCACTC CCCATTGGAT GGCACCAGAA
   361  GTTATTCAAG AAAGTCGTTA TGATGGGAAG GTAGATGTAT GGGCTCTCGG AGTGTCTGCT
   421  ATTGAAATGG CGGAGGGTCT TCCTCCTAGG GCAACAGTGC ATCCAATGAG GGTGCTATTT
   481  ATGATATCCA TTGAACCAGC TCCAATGCTT GAGGATAAAG AGAAATGGTC TCTTGTATTC
   541  CATGATTTTG TTGCCAAGTG CCTTACAAAA GACACCCGAC TTCGTCCAAC TGCCTCCGAG
   601  ATGCTAAAGC ACAAATTCAT CGAAAAATTC AAAGCAGGAG CTTCTGTAAT GATGCCGAAG
   661  ATTGAGAAGG CCAAACAAAT TAGGGCATCA ATGGCCTTGG AAGCGCCAAA TATTGTTTCC
   721  GAGACTCCCC GAGTATTTGG AGTCC

Predicted gene structure (within gDNA segment 18276 to 22500):

 Exon  1  18660  18734 (  75 n);  cDNA      1     75 (  75 n); score: 0.853
  Intron  1  18735  18859 ( 125 n); Pd: 0.980 (s: 0.84), Pa: 0.787 (s: 0.80)
 Exon  2  18860  18967 ( 108 n);  cDNA     76    183 ( 108 n); score: 0.769
  Intron  2  18968  19065 (  98 n); Pd: 0.000 (s: 0.72), Pa: 0.953 (s: 0.84)
 Exon  3  19066  19156 (  91 n);  cDNA    184    274 (  91 n); score: 0.813
  Intron  3  19157  19270 ( 114 n); Pd: 0.984 (s: 0.80), Pa: 0.000 (s: 0.88)
 Exon  4  19271  19323 (  53 n);  cDNA    275    327 (  53 n); score: 0.887
  Intron  4  19324  20843 (1520 n); Pd: 0.770 (s: 0.88), Pa: 0.962 (s: 0.88)
 Exon  5  20844  20906 (  63 n);  cDNA    328    390 (  63 n); score: 0.889
  Intron  5  20907  21626 ( 720 n); Pd: 0.929 (s: 0.92), Pa: 0.999 (s: 0.80)
 Exon  6  21627  21671 (  45 n);  cDNA    391    435 (  45 n); score: 0.800
  Intron  6  21672  21777 ( 106 n); Pd: 0.992 (s: 0.80), Pa: 0.998 (s:    0)
 Exon  7  21778  21813 (  36 n);  cDNA    436    471 (  36 n); score: 0.694
  Intron  7  21814  22451 ( 638 n); Pd: 0.596 (s:    0), Pa: 0.894 (s: 0.84)
 Exon  8  22452  22500 (  49 n);  cDNA    472    520 (  49 n); score: 0.837

MATCH	21326110+	13610520+	0.831	520	0.698	C
PGS_21326110+_13610520+	(18660  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)

Alignment (genomic DNA sequence = upper lines):

GAGATGCTGC AGCAGTGTAG CCATCCAAAT GTTGTCCGCT ACTTTGGAAG CTACCAAGGA    18719
|||||| ||| ||||||| ||  ||||||||| ||||| |||| |  |||| || |||||||||  
GAGATGTTGC AGCAGTGCAG TCATCCAAAT GTTGTTCGCT ATCTTGGGAG CTACCAAGGC       60


GAGGACTACC TATGGGTACA ATCAAATAGC CTGATAGTAT CCATTTTATT AACATTAAGA    18779
|| || |||| | |||                                                  
GAAGAGTACC TTTGG..... .......... .......... .......... ..........       75


AATAACTATC ATTGGGAGAT TTCTCTACTT CTTGAGTCAT TTAACATGGG CTTGATGCAA    18839
                                                                  
.......... .......... .......... .......... .......... ..........       75


ATGCGATTCT CAACTTACAG ATAGTTATGG AGTACTGTGG TGGTGGAAGT GTTGCTGATT    18899
                      ||||| |||| |||| |||||  ||||||||| |||||||| | 
.......... .......... ATAGTAATGG AGTATTGTGG GGGTGGAAGT GTTGCTGACT      115


TGATAGGCAT CACAGAGGAG CCTCTTGATG AATCCCAAAT AGCTTATATA TGTAGAGAAG    18959
| ||     | |||||| |||  || | || | | |  ||||| ||| | |||  ||| |||| | 
TAATGAATGT CACAGATGAG GCTTTAGAGG AGTATCAAAT AGCATTTATT TGTCGAGAGG      175


CACTAAAGGT TCTAACATAG TTGCATCAGA TTTGAAGTAT TTGCTGCCTT GTTGGGCAAC    19019
|| | |||                                                          
CATTGAAG.. .......... .......... .......... .......... ..........      183


TAAATGTATT TGGATATTGA ACTTTTGCGT GCTTATTTTC TTCCAGGGCC TTGCTTACCT    19079
                                                  |||| |  | || || 
.......... .......... .......... .......... ......GGCC TCTCCTATCT      197


GCACTCCATT TTTAAAGTTC ATAGAGATAT TAAGGGTGGC AACATTCTTC TAACTGAGCA    19139
|||||| ||| |||||||| | | |||||||| ||| |||||| || ||  | | | ||||| || 
GCACTCTATT TTTAAAGTAC ACAGAGATAT TAAAGGTGGC AATATCTTAC TGACTGATCA      257


AGGCGAGGTG AAGTTGGGTA AGCACATTTG TTTTCTTCAA AAGTTTTAGT TTGCATTCTT    19199
||| |||||  ||||| |                                                
AGGAGAGGTT AAGTTAG... .......... .......... .......... ..........      274


AGCACCCATA TTTCTGCATG TCCTGACTCT GTGGTCGGCA TGCTGTGGCG CCACAACAAT    19259
                                                                  
.......... .......... .......... .......... .......... ..........      274


GTGCAAAACA GGTGATTTTG GTGTAGCTGC CCAGCTGACA AGAACCATGT CAAAGCGCAA    19319
            ||||||||| |||| |||||  ||||||||  |||||||||| | || || || 
.......... .GTGATTTTG GTGTTGCTGC GCAGCTGACT AGAACCATGT CCAAACGTAA      323


CACGGTATTC TAAACAGTGT TTGTTTTGCC ATTCAAATCC ATAGTTCAAG AAACTTCACA    19379
||||                                                              
CACG...... .......... .......... .......... .......... ..........      327


TCGATGTAAC AAACAAAATG AAGTGGCAGA TGAAACTTGT CCATGCCAGT TTACCATAAG    19439
                                                                  
.......... .......... .......... .......... .......... ..........      327


CGGACCCATT TGTGCTTGTG CATAGTTCTT CAATGTGATG GTACTTTTAT GGGAACTTGA    19499
                                                                  
.......... .......... .......... .......... .......... ..........      327


AGCAAGTCTG TGTTGGAAAA TGATTGCTGT GAAGTCCTAA CTGTTTCTTT AAGTGTCATA    19559
                                                                  
.......... .......... .......... .......... .......... ..........      327


CTGCAAGTGC ATTATGGTCT ATTAGGTTTA AAATGAAAAA TAAGAAAGTA TATATTTGTT    19619
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATCTAGTATG CCTCGCCTAA TTCCTTGGCA TTTCTTCCAT TCTTTGAAAC CCATACTGGT    19679
                                                                  
.......... .......... .......... .......... .......... ..........      327


GGAACCTAGT TGAAGTGGTT CCTGTACAAA TACTCTCTGC ACTGCTTCTT CTCCCTTTCT    19739
                                                                  
.......... .......... .......... .......... .......... ..........      327


TGTCGTGACA GCCTCTAGTC CCCATATATC CCATTATGAA TCTGCTCACT CCCCCATTTG    19799
                                                                  
.......... .......... .......... .......... .......... ..........      327


GCTTCTTCCT AGGCCACCAC TCAACAATTC TTCTGTTCTT GATGACTGCG ATGCTCCATT    19859
                                                                  
.......... .......... .......... .......... .......... ..........      327


CGATCTGGCA AATTGCTGCC TTGCTGGAGC TATTCAAGAA CGTAGAGGGT TACTGTGACA    19919
                                                                  
.......... .......... .......... .......... .......... ..........      327


TTAGCATATC AAACCAACAG GTCTGTTGGA AATCATAATC ACAATGAACC TCCAAGTGGG    19979
                                                                  
.......... .......... .......... .......... .......... ..........      327


AAATATTATC CAGGGCGTCA TCTTACCTCC AAGTTATGGA CTCTGCTTGA CACTAGAGGA    20039
                                                                  
.......... .......... .......... .......... .......... ..........      327


AGAGTTAGTG CACAGGGAGT CCAAATCAGG TAGGATAGTT GATAGTTCAT AATTGGCTAG    20099
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATCTAGGAGG AGGTATGTGA GTGAGAGTTT GGAAAATCAG GGTAGAATAC AAGTTCAGGT    20159
                                                                  
.......... .......... .......... .......... .......... ..........      327


TCCCTAGGAC GATGATATAA TGTAGTACCA TACTACAAGA ATTGACTATG GAATTTATTA    20219
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATATCTAGCT AGAAACCAAT ATAAAAAAAC AATCTACTCC CCTTTCTACT GCTGCTGATA    20279
                                                                  
.......... .......... .......... .......... .......... ..........      327


CTTCTACTCT TTTTTTTTTC TCTCTTGTAC ACCTTCTTGG CTGCTACACT TCTCTAGTTT    20339
                                                                  
.......... .......... .......... .......... .......... ..........      327


CCAATCATGA CAATACATAA ATGCTTGAGG AGCCCATAAC AAATAGTTCT ACCCCACCCA    20399
                                                                  
.......... .......... .......... .......... .......... ..........      327


CCCACACCCT TTCGTAGTAA AGTGTGCCGA CAACAGTTGG TGCCCTCTTC TCGATGGTAT    20459
                                                                  
.......... .......... .......... .......... .......... ..........      327


CCATTGCTTT TCTGCATGCA CACACAAACA AACACTTCTA AATACACATA CTGACTTGTC    20519
                                                                  
.......... .......... .......... .......... .......... ..........      327


GTATTGGCAT GCAGTCATGC ATTGAGACCA AATCCATCAG GACTGCATCC GCACAACACA    20579
                                                                  
.......... .......... .......... .......... .......... ..........      327


AAATCTCACC ATACATGCAT ACGGTGTCTT GGATGTTTCT GTTGTTGGGG CGCTAATATG    20639
                                                                  
.......... .......... .......... .......... .......... ..........      327


TACTTCTACC AAAATGCAAG GACAAACTGT CCCAATTTTA CAGTAAAATA ACTATCATTG    20699
                                                                  
.......... .......... .......... .......... .......... ..........      327


TGAAACAGAC TGTCAGCATC GCTCTCTAAG CTCAGTCTGT ACAGCTTTTA CCAAATAAAA    20759
                                                                  
.......... .......... .......... .......... .......... ..........      327


ATAATGCAAT GGTTTTTGGA AAGAATAAAG GTTTTAGTGG CACACTAATT TCCATAATTT    20819
                                                                  
.......... .......... .......... .......... .......... ..........      327


GACCCTTCAT GTTTATGCTT TCAGTTCATT GGTACTCCAC ATTGGATGGC ACCAGAGGTC    20879
                          || ||  || ||||| | |||||||||| |||||| ||  
.......... .......... ....TTTATC GGCACTCCCC ATTGGATGGC ACCAGAAGTT      363


ATTCAAGAAA GTCGTTATGA TGGAAAGGTA TCATGCTATC ATCTCTACGG TGTTCAGCTA    20939
|||||||||| |||||||||| ||| |||                                     
ATTCAAGAAA GTCGTTATGA TGGGAAG... .......... .......... ..........      390


TGGAATTGTT CATTTTAGCA GCTTTTGTGG ATGTTGCCAT TTTACTCTAA AGACTTGGTG    20999
                                                                  
.......... .......... .......... .......... .......... ..........      390


GCCGTAAATT TATGATTGGG TTTTCAGTGA ACAGGATTTC TTTAATATTT TGTTTCTTTG    21059
                                                                  
.......... .......... .......... .......... .......... ..........      390


GGTGTGGAAT GTCCTTGCAT ATGGCAGAAC AAGGTTACAC GTAAATTCAT AAAAGCCATT    21119
                                                                  
.......... .......... .......... .......... .......... ..........      390


AAATAATTGT TATGGAACCC CTGCCAGTGC CAAAACATGT TTATTTCTTT TCCTTGTCTC    21179
                                                                  
.......... .......... .......... .......... .......... ..........      390


TTGATGGTTC CTCAAGCAAA AAAAAAATAA AATAAAATCA TTACCTACTA CTAAGCCTCC    21239
                                                                  
.......... .......... .......... .......... .......... ..........      390


AAAACAAGTC TACTGGTTGC AATTAGGGAT GAAAACGGAT CGGATACGGA CGGATATCAT    21299
                                                                  
.......... .......... .......... .......... .......... ..........      390


CGATATCATA TTTGTTTTCG TATTTCTGGT CGAATTCGGA TTCGAATACG GATAATGTCA    21359
                                                                  
.......... .......... .......... .......... .......... ..........      390


ACTATATCGG ATAAGATACG ATTGGATGTC GACATCATAA ATATATGATT TAAGTACTCG    21419
                                                                  
.......... .......... .......... .......... .......... ..........      390


GATACGGATA CGGTATCGGA TGTAGAACAT TCGAACTCGG ATACGAACTG GTCTGAATCC    21479
                                                                  
.......... .......... .......... .......... .......... ..........      390


CTCTAAACGA ATTCGGTCTC AAATACGGTC GGAAAATATC CGTACCGTTT TCATCCCTAG    21539
                                                                  
.......... .......... .......... .......... .......... ..........      390


TTGCAATGTT GAGAAAATTA TTTTGGCAGC TGGAATTCTT CCTTTAGTTT GTCTTACCAA    21599
                                                                  
.......... .......... .......... .......... .......... ..........      390


AACATTTGTT CTTGTTTCCT GCACCAGGTA GATGTTTGGG CATTAGGTGT ATCTGCAATT    21659
                             ||| ||||| |||| |  | || ||  ||||| ||| 
.......... .......... .......GTA GATGTATGGG CTCTCGGAGT GTCTGCTATT      423


GAGATGGCAG AGGTAGACAT TGTTCCTTGC TTCTTTCTTT TTTTGACTGT ACACTTTTGT    21719
|| ||||| | ||                                                     
GAAATGGCGG AG........ .......... .......... .......... ..........      435


TTTTAATTTT GTGTCGTGAC AATGCTTTTT AATATTTATT TTGTATCTCT GACTGTAGGG    21779
                                                               || 
.......... .......... .......... .......... .......... ........GG      437


CATGCCACCA AGATCCACTG TACATCCAAT GAGAGTAAGA GATGCTTCTC AATGCCTGTT    21839
  | || ||  ||  | || | | |||||||| |||                              
TCTTCCTCCT AGGGCAACAG TGCATCCAAT GAGG...... .......... ..........      471


AGTATCTGCA GTTAATGAGG CTAATAGGTT ATAACAGAAT TAAAAAAATC TGCTCTATCT    21899
                                                                  
.......... .......... .......... .......... .......... ..........      471


TTGGTGCACT GTACTTTTTA TCTCTTTACT GTCAAGGGCG TCGAGGGACA GGGTAGGAGG    21959
                                                                  
.......... .......... .......... .......... .......... ..........      471


ATCCCGGCTA CGTAGTTCAT AGACCAATCT GTGGTGTGGG GCGGAGGTTT TACCCCTCAG    22019
                                                                  
.......... .......... .......... .......... .......... ..........      471


TGCCCGATTG TTTCAGCAAA GGTAGATTAG GGAATTGGGA TAATTGTTCT TTCTTGATTA    22079
                                                                  
.......... .......... .......... .......... .......... ..........      471


TCATCATACG AGTACAAGAA TATATAGGCC ATTCGGCCAT AACAGCTTGG AGCCAATTGC    22139
                                                                  
.......... .......... .......... .......... .......... ..........      471


TCCTAAATCT AAGGCCATTA TCGGCTCTCC TGCCTTCTAG GCTCTCGCCT GTTCAGTGTG    22199
                                                                  
.......... .......... .......... .......... .......... ..........      471


CTCTGCATGC GTGGTGACCG CGCCTACGGT TCTGCTGGTG CGCCATCTGC GGCTCTGCGA    22259
                                                                  
.......... .......... .......... .......... .......... ..........      471


GCATCCTGGG CGTGCCGTTT CCTTGTGTAG GCGCGGTCCC ACATGACATT TACTTTCTTT    22319
                                                                  
.......... .......... .......... .......... .......... ..........      471


CTGATGCATT TGCTTCTTTA CTTTGCCTTG GTAAATATTT GGTATACATA TCAATATATT    22379
                                                                  
.......... .......... .......... .......... .......... ..........      471


GTTTCATCTT CGTTTAGCAT GAATGCTTGA TAGACCGACT AACGATCTCT CTTCCCCCTT    22439
                                                                  
.......... .......... .......... .......... .......... ..........      471


CCCTTATCTC AGGTTATCTT CATGATATCC AGTGAACCAG CACCAATGCT GGAGGATAAG    22499
             ||  | ||  ||||||||| | |||||||| | ||||||||  ||||||||  
.......... ..GTGCTATT TATGATATCC ATTGAACCAG CTCCAATGCT TGAGGATAAA      519


G    22500
|
G      520





********************************************************************************
EST sequence   49 +strand (File: 13316811+)

     1  GCACGAGGTA GTTATGGAGT ACTGTGGTGG TGGAAGTGTT GCTGATTTGA TAGGCATCAC
    61  AGAGGAGCCT CTTGATGAAT CCCAAATAGC TTATATATGT AGAGAAGCAC TAAAGGGCCT
   121  TGCTTACCTG CACTCCATTT TTAAAGTTCA TAGAGATATT AAGGGTGGCA ACATTCTTCT
   181  AACTGAGCAA GGCGAGGTGA AGTTGGGTGA TTTTGGTGTA GCTGCCCAGC TGACAAGAAC
   241  CATGTCAAAG CGCAACACGT TCATTGGTAC TCCACATTGG ATGGCACCAG AGGTCATTCA
   301  AGAAAGTCGT TATGATGGAA AGGTAGATGT TTGGGCATTA CGTGTATC

Predicted gene structure (within gDNA segment 18521 to 21989):

 Exon  1  18854  18967 ( 114 n);  cDNA      1    115 ( 115 n); score: 0.956
  Intron  1  18968  19065 (  98 n); Pd: 0.000 (s: 1.00), Pa: 0.953 (s: 1.00)
 Exon  2  19066  19156 (  91 n);  cDNA    116    206 (  91 n); score: 1.000
  Intron  2  19157  19270 ( 114 n); Pd: 0.984 (s: 1.00), Pa: 0.000 (s: 1.00)
 Exon  3  19271  19323 (  53 n);  cDNA    207    259 (  53 n); score: 1.000
  Intron  3  19324  20843 (1520 n); Pd: 0.770 (s: 1.00), Pa: 0.962 (s: 1.00)
 Exon  4  20844  20906 (  63 n);  cDNA    260    322 (  63 n); score: 1.000
  Intron  4  20907  21626 ( 720 n); Pd: 0.929 (s: 1.00), Pa: 0.999 (s:    0)
 Exon  5  21627  21652 (  26 n);  cDNA    323    348 (  26 n); score: 0.962

MATCH	21326110+	13316811+	0.984	347	0.997	C
PGS_21326110+_13316811+	(18854  18967,19066  19156,19271  19323,20844  20906,21627  21652)

Alignment (genomic DNA sequence = upper lines):

TTAC-AGATA GTTATGGAGT ACTGTGGTGG TGGAAGTGTT GCTGATTTGA TAGGCATCAC    18912
  || || || |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GCACGAGGTA GTTATGGAGT ACTGTGGTGG TGGAAGTGTT GCTGATTTGA TAGGCATCAC       60


AGAGGAGCCT CTTGATGAAT CCCAAATAGC TTATATATGT AGAGAAGCAC TAAAGGTTCT    18972
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||      
AGAGGAGCCT CTTGATGAAT CCCAAATAGC TTATATATGT AGAGAAGCAC TAAAG.....      115


AACATAGTTG CATCAGATTT GAAGTATTTG CTGCCTTGTT GGGCAACTAA ATGTATTTGG    19032
                                                                  
.......... .......... .......... .......... .......... ..........      115


ATATTGAACT TTTGCGTGCT TATTTTCTTC CAGGGCCTTG CTTACCTGCA CTCCATTTTT    19092
                                    ||||||| |||||||||| |||||||||| 
.......... .......... .......... ...GGCCTTG CTTACCTGCA CTCCATTTTT      142


AAAGTTCATA GAGATATTAA GGGTGGCAAC ATTCTTCTAA CTGAGCAAGG CGAGGTGAAG    19152
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
AAAGTTCATA GAGATATTAA GGGTGGCAAC ATTCTTCTAA CTGAGCAAGG CGAGGTGAAG      202


TTGGGTAAGC ACATTTGTTT TCTTCAAAAG TTTTAGTTTG CATTCTTAGC ACCCATATTT    19212
||||                                                              
TTGG...... .......... .......... .......... .......... ..........      206


CTGCATGTCC TGACTCTGTG GTCGGCATGC TGTGGCGCCA CAACAATGTG CAAAACAGGT    19272
                                                               || 
.......... .......... .......... .......... .......... ........GT      208


GATTTTGGTG TAGCTGCCCA GCTGACAAGA ACCATGTCAA AGCGCAACAC GGTATTCTAA    19332
|||||||||| |||||||||| |||||||||| |||||||||| |||||||||| |          
GATTTTGGTG TAGCTGCCCA GCTGACAAGA ACCATGTCAA AGCGCAACAC G.........      259


ACAGTGTTTG TTTTGCCATT CAAATCCATA GTTCAAGAAA CTTCACATCG ATGTAACAAA    19392
                                                                  
.......... .......... .......... .......... .......... ..........      259


CAAAATGAAG TGGCAGATGA AACTTGTCCA TGCCAGTTTA CCATAAGCGG ACCCATTTGT    19452
                                                                  
.......... .......... .......... .......... .......... ..........      259


GCTTGTGCAT AGTTCTTCAA TGTGATGGTA CTTTTATGGG AACTTGAAGC AAGTCTGTGT    19512
                                                                  
.......... .......... .......... .......... .......... ..........      259


TGGAAAATGA TTGCTGTGAA GTCCTAACTG TTTCTTTAAG TGTCATACTG CAAGTGCATT    19572
                                                                  
.......... .......... .......... .......... .......... ..........      259


ATGGTCTATT AGGTTTAAAA TGAAAAATAA GAAAGTATAT ATTTGTTATC TAGTATGCCT    19632
                                                                  
.......... .......... .......... .......... .......... ..........      259


CGCCTAATTC CTTGGCATTT CTTCCATTCT TTGAAACCCA TACTGGTGGA ACCTAGTTGA    19692
                                                                  
.......... .......... .......... .......... .......... ..........      259


AGTGGTTCCT GTACAAATAC TCTCTGCACT GCTTCTTCTC CCTTTCTTGT CGTGACAGCC    19752
                                                                  
.......... .......... .......... .......... .......... ..........      259


TCTAGTCCCC ATATATCCCA TTATGAATCT GCTCACTCCC CCATTTGGCT TCTTCCTAGG    19812
                                                                  
.......... .......... .......... .......... .......... ..........      259


CCACCACTCA ACAATTCTTC TGTTCTTGAT GACTGCGATG CTCCATTCGA TCTGGCAAAT    19872
                                                                  
.......... .......... .......... .......... .......... ..........      259


TGCTGCCTTG CTGGAGCTAT TCAAGAACGT AGAGGGTTAC TGTGACATTA GCATATCAAA    19932
                                                                  
.......... .......... .......... .......... .......... ..........      259


CCAACAGGTC TGTTGGAAAT CATAATCACA ATGAACCTCC AAGTGGGAAA TATTATCCAG    19992
                                                                  
.......... .......... .......... .......... .......... ..........      259


GGCGTCATCT TACCTCCAAG TTATGGACTC TGCTTGACAC TAGAGGAAGA GTTAGTGCAC    20052
                                                                  
.......... .......... .......... .......... .......... ..........      259


AGGGAGTCCA AATCAGGTAG GATAGTTGAT AGTTCATAAT TGGCTAGATC TAGGAGGAGG    20112
                                                                  
.......... .......... .......... .......... .......... ..........      259


TATGTGAGTG AGAGTTTGGA AAATCAGGGT AGAATACAAG TTCAGGTTCC CTAGGACGAT    20172
                                                                  
.......... .......... .......... .......... .......... ..........      259


GATATAATGT AGTACCATAC TACAAGAATT GACTATGGAA TTTATTAATA TCTAGCTAGA    20232
                                                                  
.......... .......... .......... .......... .......... ..........      259


AACCAATATA AAAAAACAAT CTACTCCCCT TTCTACTGCT GCTGATACTT CTACTCTTTT    20292
                                                                  
.......... .......... .......... .......... .......... ..........      259


TTTTTTCTCT CTTGTACACC TTCTTGGCTG CTACACTTCT CTAGTTTCCA ATCATGACAA    20352
                                                                  
.......... .......... .......... .......... .......... ..........      259


TACATAAATG CTTGAGGAGC CCATAACAAA TAGTTCTACC CCACCCACCC ACACCCTTTC    20412
                                                                  
.......... .......... .......... .......... .......... ..........      259


GTAGTAAAGT GTGCCGACAA CAGTTGGTGC CCTCTTCTCG ATGGTATCCA TTGCTTTTCT    20472
                                                                  
.......... .......... .......... .......... .......... ..........      259


GCATGCACAC ACAAACAAAC ACTTCTAAAT ACACATACTG ACTTGTCGTA TTGGCATGCA    20532
                                                                  
.......... .......... .......... .......... .......... ..........      259


GTCATGCATT GAGACCAAAT CCATCAGGAC TGCATCCGCA CAACACAAAA TCTCACCATA    20592
                                                                  
.......... .......... .......... .......... .......... ..........      259


CATGCATACG GTGTCTTGGA TGTTTCTGTT GTTGGGGCGC TAATATGTAC TTCTACCAAA    20652
                                                                  
.......... .......... .......... .......... .......... ..........      259


ATGCAAGGAC AAACTGTCCC AATTTTACAG TAAAATAACT ATCATTGTGA AACAGACTGT    20712
                                                                  
.......... .......... .......... .......... .......... ..........      259


CAGCATCGCT CTCTAAGCTC AGTCTGTACA GCTTTTACCA AATAAAAATA ATGCAATGGT    20772
                                                                  
.......... .......... .......... .......... .......... ..........      259


TTTTGGAAAG AATAAAGGTT TTAGTGGCAC ACTAATTTCC ATAATTTGAC CCTTCATGTT    20832
                                                                  
.......... .......... .......... .......... .......... ..........      259


TATGCTTTCA GTTCATTGGT ACTCCACATT GGATGGCACC AGAGGTCATT CAAGAAAGTC    20892
            ||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
.......... .TTCATTGGT ACTCCACATT GGATGGCACC AGAGGTCATT CAAGAAAGTC      308


GTTATGATGG AAAGGTATCA TGCTATCATC TCTACGGTGT TCAGCTATGG AATTGTTCAT    20952
|||||||||| ||||                                                   
GTTATGATGG AAAG...... .......... .......... .......... ..........      322


TTTAGCAGCT TTTGTGGATG TTGCCATTTT ACTCTAAAGA CTTGGTGGCC GTAAATTTAT    21012
                                                                  
.......... .......... .......... .......... .......... ..........      322


GATTGGGTTT TCAGTGAACA GGATTTCTTT AATATTTTGT TTCTTTGGGT GTGGAATGTC    21072
                                                                  
.......... .......... .......... .......... .......... ..........      322


CTTGCATATG GCAGAACAAG GTTACACGTA AATTCATAAA AGCCATTAAA TAATTGTTAT    21132
                                                                  
.......... .......... .......... .......... .......... ..........      322


GGAACCCCTG CCAGTGCCAA AACATGTTTA TTTCTTTTCC TTGTCTCTTG ATGGTTCCTC    21192
                                                                  
.......... .......... .......... .......... .......... ..........      322


AAGCAAAAAA AAAATAAAAT AAAATCATTA CCTACTACTA AGCCTCCAAA ACAAGTCTAC    21252
                                                                  
.......... .......... .......... .......... .......... ..........      322


TGGTTGCAAT TAGGGATGAA AACGGATCGG ATACGGACGG ATATCATCGA TATCATATTT    21312
                                                                  
.......... .......... .......... .......... .......... ..........      322


GTTTTCGTAT TTCTGGTCGA ATTCGGATTC GAATACGGAT AATGTCAACT ATATCGGATA    21372
                                                                  
.......... .......... .......... .......... .......... ..........      322


AGATACGATT GGATGTCGAC ATCATAAATA TATGATTTAA GTACTCGGAT ACGGATACGG    21432
                                                                  
.......... .......... .......... .......... .......... ..........      322


TATCGGATGT AGAACATTCG AACTCGGATA CGAACTGGTC TGAATCCCTC TAAACGAATT    21492
                                                                  
.......... .......... .......... .......... .......... ..........      322


CGGTCTCAAA TACGGTCGGA AAATATCCGT ACCGTTTTCA TCCCTAGTTG CAATGTTGAG    21552
                                                                  
.......... .......... .......... .......... .......... ..........      322


AAAATTATTT TGGCAGCTGG AATTCTTCCT TTAGTTTGTC TTACCAAAAC ATTTGTTCTT    21612
                                                                  
.......... .......... .......... .......... .......... ..........      322


GTTTCCTGCA CCAGGTAGAT GTTTGGGCAT TAGGTGTATC    21652
               |||||| |||||||||| || ||||||| 
.......... ....GTAGAT GTTTGGGCAT TACGTGTATC      348





********************************************************************************
EST sequence   67 +strand (File: 13263258+)

     1  CAGCTCTTGA CGAACCGCGA ATAGCTTATA TATGATCGAG AAACACTAAA GGGTCTTGCT
    61  TACTTGCACA CAATTTTCAA AGTTCATAGA GATATTAAGG GTGGCAACAT TCTACTGACT
   121  GAGCAAGGCG AGGTGAAGTT GGGCGATTTT GGTGTTGCTG CCCAACTGGC GAAGAACCAT
   181  GTCAAAGCGC AACACGTTCA TCGGTACTCC ACACTGGATG GCACCAGAGG TCATTCAAGA
   241  GAGTCGGTTT GATGGGAAGG TAGATGTTTG AGCTCTTGGA GAGACTGCAT TAGAGATGGC
   301  ATAGGGCATG CCACCGAGAT CCACTGTGCA TCCAATGAGA GTGATCTTCA TGATATCTAG
   361  TGAACGTGCA ACGATGCTGG AGGATAAGGA GAAAGGGTCT TTTCTCTTTG CAGAATATAA
   421  TGGCCAAGGC CCTTACAAGG GATGCGGGAC TCCGGGCCGG TGGGATGGAG ATGCTTAGGC
   481  GAAAATTATT TGGAAGTGCG GCACTGGGGG CTTTGAAATT GGTGGGCGAG GATTCGGGGG
   541  CCAAGATCAT GCAAGAAACC GGTGGGCGAA ACAACCTGCG TTGCTTTCAA GGATGAATGG
   601  GAAGCGAACG TTCGAATTTT TTTAAAAATT GGAAAAAATG GTTGTTTTAA CATTGGGGTA
   661  AGTCGATTAG AAAAACAAAT ATATGGTTCA GGAGGTGAAT TTGTGGTAAT TAATGGAAAA
   721  TCTAAAAAAT AGAGAAAAAA AAATTGAAAT TATTAGATTT GTAAAAAGAA AAAATATAAT
   781  TAGTGATTAT GAGATTAAAT TTTATAAATC AAAAATAAAA AAGACAAACA CTTTTTAAAA
   841  TCTCTTAACC GAATAAAACT ATTTTTAATA CCGATAAAGA GCCAAAATAT AGGATAT

Predicted gene structure (within gDNA segment 18542 to 22500):

 Exon  1  18917  18967 (  51 n);  cDNA      1     51 (  51 n); score: 0.804
  Intron  1  18968  19065 (  98 n); Pd: 0.000 (s: 0.82), Pa: 0.953 (s: 0.90)
 Exon  2  19066  19156 (  91 n);  cDNA     52    142 (  91 n); score: 0.923
  Intron  2  19157  19270 ( 114 n); Pd: 0.984 (s: 0.96), Pa: 0.000 (s: 0.88)
 Exon  3  19271  19323 (  53 n);  cDNA    143    196 (  54 n); score: 0.887
  Intron  3  19324  20843 (1520 n); Pd: 0.770 (s: 0.90), Pa: 0.962 (s: 0.94)
 Exon  4  20844  20906 (  63 n);  cDNA    197    259 (  63 n); score: 0.905
  Intron  4  20907  21626 ( 720 n); Pd: 0.929 (s: 0.90), Pa: 0.999 (s: 0.76)
 Exon  5  21627  21671 (  45 n);  cDNA    260    304 (  45 n); score: 0.756
  Intron  5  21672  21777 ( 106 n); Pd: 0.992 (s: 0.76), Pa: 0.998 (s:    0)
 Exon  6  21778  21813 (  36 n);  cDNA    305    340 (  36 n); score: 0.944
  Intron  6  21814  22451 ( 638 n); Pd: 0.596 (s:    0), Pa: 0.894 (s: 0.88)
 Exon  7  22452  22500 (  49 n);  cDNA    341    389 (  49 n); score: 0.878

MATCH	21326110+	13263258+	0.888	388	0.433	C
PGS_21326110+_13263258+	(18917  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)

Alignment (genomic DNA sequence = upper lines):

GAGCCTCTTG ATGAATCCCA AATAGCTTAT ATATG-TAGA GAAGCACTAA AGGTTCTAAC    18975
 || |||||| | ||| | |  |||||||||| ||||| | || ||| |||||| ||         
CAG-CTCTTG ACGAACCGCG AATAGCTTAT ATATGATCGA GAAACACTAA AG........       51


ATAGTTGCAT CAGATTTGAA GTATTTGCTG CCTTGTTGGG CAACTAAATG TATTTGGATA    19035
                                                                  
.......... .......... .......... .......... .......... ..........       51


TTGAACTTTT GCGTGCTTAT TTTCTTCCAG GGCCTTGCTT ACCTGCACTC CATTTTTAAA    19095
                                 || ||||||| || ||||| |  ||||| ||| 
.......... .......... .......... GGTCTTGCTT ACTTGCACAC AATTTTCAAA       81


GTTCATAGAG ATATTAAGGG TGGCAACATT CTTCTAACTG AGCAAGGCGA GGTGAAGTTG    19155
|||||||||| |||||||||| |||||||||| || || |||| |||||||||| |||||||||| 
GTTCATAGAG ATATTAAGGG TGGCAACATT CTACTGACTG AGCAAGGCGA GGTGAAGTTG      141


GGTAAGCACA TTTGTTTTCT TCAAAAGTTT TAGTTTGCAT TCTTAGCACC CATATTTCTG    19215
|                                                                 
G......... .......... .......... .......... .......... ..........      142


CATGTCCTGA CTCTGTGGTC GGCATGCTGT GGCGCCACAA CAATGTGCAA AACAGGTGAT    19275
                                                            | ||| 
.......... .......... .......... .......... .......... .....GCGAT      147


TTTGGTGTAG CTGCCCAGCT GAC-AAGAAC CATGTCAAAG CGCAACACGG TATTCTAAAC    19334
|||||||| | ||||||| || | | |||||| |||||||||| |||||||||             
TTTGGTGTTG CTGCCCAACT GGCGAAGAAC CATGTCAAAG CGCAACACG. ..........      196


AGTGTTTGTT TTGCCATTCA AATCCATAGT TCAAGAAACT TCACATCGAT GTAACAAACA    19394
                                                                  
.......... .......... .......... .......... .......... ..........      196


AAATGAAGTG GCAGATGAAA CTTGTCCATG CCAGTTTACC ATAAGCGGAC CCATTTGTGC    19454
                                                                  
.......... .......... .......... .......... .......... ..........      196


TTGTGCATAG TTCTTCAATG TGATGGTACT TTTATGGGAA CTTGAAGCAA GTCTGTGTTG    19514
                                                                  
.......... .......... .......... .......... .......... ..........      196


GAAAATGATT GCTGTGAAGT CCTAACTGTT TCTTTAAGTG TCATACTGCA AGTGCATTAT    19574
                                                                  
.......... .......... .......... .......... .......... ..........      196


GGTCTATTAG GTTTAAAATG AAAAATAAGA AAGTATATAT TTGTTATCTA GTATGCCTCG    19634
                                                                  
.......... .......... .......... .......... .......... ..........      196


CCTAATTCCT TGGCATTTCT TCCATTCTTT GAAACCCATA CTGGTGGAAC CTAGTTGAAG    19694
                                                                  
.......... .......... .......... .......... .......... ..........      196


TGGTTCCTGT ACAAATACTC TCTGCACTGC TTCTTCTCCC TTTCTTGTCG TGACAGCCTC    19754
                                                                  
.......... .......... .......... .......... .......... ..........      196


TAGTCCCCAT ATATCCCATT ATGAATCTGC TCACTCCCCC ATTTGGCTTC TTCCTAGGCC    19814
                                                                  
.......... .......... .......... .......... .......... ..........      196


ACCACTCAAC AATTCTTCTG TTCTTGATGA CTGCGATGCT CCATTCGATC TGGCAAATTG    19874
                                                                  
.......... .......... .......... .......... .......... ..........      196


CTGCCTTGCT GGAGCTATTC AAGAACGTAG AGGGTTACTG TGACATTAGC ATATCAAACC    19934
                                                                  
.......... .......... .......... .......... .......... ..........      196


AACAGGTCTG TTGGAAATCA TAATCACAAT GAACCTCCAA GTGGGAAATA TTATCCAGGG    19994
                                                                  
.......... .......... .......... .......... .......... ..........      196


CGTCATCTTA CCTCCAAGTT ATGGACTCTG CTTGACACTA GAGGAAGAGT TAGTGCACAG    20054
                                                                  
.......... .......... .......... .......... .......... ..........      196


GGAGTCCAAA TCAGGTAGGA TAGTTGATAG TTCATAATTG GCTAGATCTA GGAGGAGGTA    20114
                                                                  
.......... .......... .......... .......... .......... ..........      196


TGTGAGTGAG AGTTTGGAAA ATCAGGGTAG AATACAAGTT CAGGTTCCCT AGGACGATGA    20174
                                                                  
.......... .......... .......... .......... .......... ..........      196


TATAATGTAG TACCATACTA CAAGAATTGA CTATGGAATT TATTAATATC TAGCTAGAAA    20234
                                                                  
.......... .......... .......... .......... .......... ..........      196


CCAATATAAA AAAACAATCT ACTCCCCTTT CTACTGCTGC TGATACTTCT ACTCTTTTTT    20294
                                                                  
.......... .......... .......... .......... .......... ..........      196


TTTTCTCTCT TGTACACCTT CTTGGCTGCT ACACTTCTCT AGTTTCCAAT CATGACAATA    20354
                                                                  
.......... .......... .......... .......... .......... ..........      196


CATAAATGCT TGAGGAGCCC ATAACAAATA GTTCTACCCC ACCCACCCAC ACCCTTTCGT    20414
                                                                  
.......... .......... .......... .......... .......... ..........      196


AGTAAAGTGT GCCGACAACA GTTGGTGCCC TCTTCTCGAT GGTATCCATT GCTTTTCTGC    20474
                                                                  
.......... .......... .......... .......... .......... ..........      196


ATGCACACAC AAACAAACAC TTCTAAATAC ACATACTGAC TTGTCGTATT GGCATGCAGT    20534
                                                                  
.......... .......... .......... .......... .......... ..........      196


CATGCATTGA GACCAAATCC ATCAGGACTG CATCCGCACA ACACAAAATC TCACCATACA    20594
                                                                  
.......... .......... .......... .......... .......... ..........      196


TGCATACGGT GTCTTGGATG TTTCTGTTGT TGGGGCGCTA ATATGTACTT CTACCAAAAT    20654
                                                                  
.......... .......... .......... .......... .......... ..........      196


GCAAGGACAA ACTGTCCCAA TTTTACAGTA AAATAACTAT CATTGTGAAA CAGACTGTCA    20714
                                                                  
.......... .......... .......... .......... .......... ..........      196


GCATCGCTCT CTAAGCTCAG TCTGTACAGC TTTTACCAAA TAAAAATAAT GCAATGGTTT    20774
                                                                  
.......... .......... .......... .......... .......... ..........      196


TTGGAAAGAA TAAAGGTTTT AGTGGCACAC TAATTTCCAT AATTTGACCC TTCATGTTTA    20834
                                                                  
.......... .......... .......... .......... .......... ..........      196


TGCTTTCAGT TCATTGGTAC TCCACATTGG ATGGCACCAG AGGTCATTCA AGAAAGTCGT    20894
         | |||| ||||| |||||| ||| |||||||||| |||||||||| ||| |||||  
.........T TCATCGGTAC TCCACACTGG ATGGCACCAG AGGTCATTCA AGAGAGTCGG      247


TATGATGGAA AGGTATCATG CTATCATCTC TACGGTGTTC AGCTATGGAA TTGTTCATTT    20954
| |||||| | ||                                                     
TTTGATGGGA AG........ .......... .......... .......... ..........      259


TAGCAGCTTT TGTGGATGTT GCCATTTTAC TCTAAAGACT TGGTGGCCGT AAATTTATGA    21014
                                                                  
.......... .......... .......... .......... .......... ..........      259


TTGGGTTTTC AGTGAACAGG ATTTCTTTAA TATTTTGTTT CTTTGGGTGT GGAATGTCCT    21074
                                                                  
.......... .......... .......... .......... .......... ..........      259


TGCATATGGC AGAACAAGGT TACACGTAAA TTCATAAAAG CCATTAAATA ATTGTTATGG    21134
                                                                  
.......... .......... .......... .......... .......... ..........      259


AACCCCTGCC AGTGCCAAAA CATGTTTATT TCTTTTCCTT GTCTCTTGAT GGTTCCTCAA    21194
                                                                  
.......... .......... .......... .......... .......... ..........      259


GCAAAAAAAA AATAAAATAA AATCATTACC TACTACTAAG CCTCCAAAAC AAGTCTACTG    21254
                                                                  
.......... .......... .......... .......... .......... ..........      259


GTTGCAATTA GGGATGAAAA CGGATCGGAT ACGGACGGAT ATCATCGATA TCATATTTGT    21314
                                                                  
.......... .......... .......... .......... .......... ..........      259


TTTCGTATTT CTGGTCGAAT TCGGATTCGA ATACGGATAA TGTCAACTAT ATCGGATAAG    21374
                                                                  
.......... .......... .......... .......... .......... ..........      259


ATACGATTGG ATGTCGACAT CATAAATATA TGATTTAAGT ACTCGGATAC GGATACGGTA    21434
                                                                  
.......... .......... .......... .......... .......... ..........      259


TCGGATGTAG AACATTCGAA CTCGGATACG AACTGGTCTG AATCCCTCTA AACGAATTCG    21494
                                                                  
.......... .......... .......... .......... .......... ..........      259


GTCTCAAATA CGGTCGGAAA ATATCCGTAC CGTTTTCATC CCTAGTTGCA ATGTTGAGAA    21554
                                                                  
.......... .......... .......... .......... .......... ..........      259


AATTATTTTG GCAGCTGGAA TTCTTCCTTT AGTTTGTCTT ACCAAAACAT TTGTTCTTGT    21614
                                                                  
.......... .......... .......... .......... .......... ..........      259


TTCCTGCACC AGGTAGATGT TTGGGCATTA GGTGTATCTG CAATTGAGAT GGCAGAGGTA    21674
             |||||||| ||| ||  |  || |   ||| || | ||||| |||| ||    
.......... ..GTAGATGT TTGAGCTCTT GGAGAGACTG CATTAGAGAT GGCATAG...      304


GACATTGTTC CTTGCTTCTT TCTTTTTTTG ACTGTACACT TTTGTTTTTA ATTTTGTGTC    21734
                                                                  
.......... .......... .......... .......... .......... ..........      304


GTGACAATGC TTTTTAATAT TTATTTTGTA TCTCTGACTG TAGGGCATGC CACCAAGATC    21794
                                               ||||||| |||| ||||| 
.......... .......... .......... .......... ...GGCATGC CACCGAGATC      321


CACTGTACAT CCAATGAGAG TAAGAGATGC TTCTCAATGC CTGTTAGTAT CTGCAGTTAA    21854
|||||| ||| |||||||||                                              
CACTGTGCAT CCAATGAGA. .......... .......... .......... ..........      340


TGAGGCTAAT AGGTTATAAC AGAATTAAAA AAATCTGCTC TATCTTTGGT GCACTGTACT    21914
                                                                  
.......... .......... .......... .......... .......... ..........      340


TTTTATCTCT TTACTGTCAA GGGCGTCGAG GGACAGGGTA GGAGGATCCC GGCTACGTAG    21974
                                                                  
.......... .......... .......... .......... .......... ..........      340


TTCATAGACC AATCTGTGGT GTGGGGCGGA GGTTTTACCC CTCAGTGCCC GATTGTTTCA    22034
                                                                  
.......... .......... .......... .......... .......... ..........      340


GCAAAGGTAG ATTAGGGAAT TGGGATAATT GTTCTTTCTT GATTATCATC ATACGAGTAC    22094
                                                                  
.......... .......... .......... .......... .......... ..........      340


AAGAATATAT AGGCCATTCG GCCATAACAG CTTGGAGCCA ATTGCTCCTA AATCTAAGGC    22154
                                                                  
.......... .......... .......... .......... .......... ..........      340


CATTATCGGC TCTCCTGCCT TCTAGGCTCT CGCCTGTTCA GTGTGCTCTG CATGCGTGGT    22214
                                                                  
.......... .......... .......... .......... .......... ..........      340


GACCGCGCCT ACGGTTCTGC TGGTGCGCCA TCTGCGGCTC TGCGAGCATC CTGGGCGTGC    22274
                                                                  
.......... .......... .......... .......... .......... ..........      340


CGTTTCCTTG TGTAGGCGCG GTCCCACATG ACATTTACTT TCTTTCTGAT GCATTTGCTT    22334
                                                                  
.......... .......... .......... .......... .......... ..........      340


CTTTACTTTG CCTTGGTAAA TATTTGGTAT ACATATCAAT ATATTGTTTC ATCTTCGTTT    22394
                                                                  
.......... .......... .......... .......... .......... ..........      340


AGCATGAATG CTTGATAGAC CGACTAACGA TCTCTCTTCC CCCTTCCCTT ATCTCAGGTT    22454
                                                              ||  
.......... .......... .......... .......... .......... .......GTG      343


ATCTTCATGA TATCCAGTGA ACCAGCACCA ATGCTGGAGG ATAAGG    22500
|||||||||| |||| ||||| ||  ||| |  |||||||||| ||||||
ATCTTCATGA TATCTAGTGA ACGTGCAACG ATGCTGGAGG ATAAGG      389





********************************************************************************
EST sequence    1 +strand (File: 11931938+)

     1  TAGATTTCTT CTCACACTCT TTGCAGTTTG AAAAAATGGA TCGGGGCTCT TTCTCCCCGC
    61  GAACCCGAAA TACCCGACCC AAATCCGATA TCTACTCTAC TTTCGTAATC CATAACGACG
   121  ACGATGACGA CGGAGAAACC AACCGGCGGC GGAAAACCGC CAGCGCGGAA GCACAGGAAG
   181  ATCCATACGC AACAATGAAG TTCAAAGACA ACGGCCACGA TGACAACGAC GATGATGAAG
   241  ATGAAGATTC CTTTCTCCCT CCGCTTCTCA AACGTCTTCC CAAGGACTTC GGCGGCGGAG
   301  CATCGATGGA TTACGACGAT GACGAAGATG AATCTGGTGA TTTCGGTACT ATGATCGTGA
   361  AAAACGATCG GAGCCGGCAG CGAGATCGGT CTTCTTCCGG TGTGGCTTCA CCGGCGGGAT
   421  TGACGTGGAA GACCGGGAAT TCTTCTCAGG TGACTGCTTT GAACGATGAG GATGATGATG
   481  ACGGAGGTGG ATTTTCGACT TTTGTGATGC GGTCGACGGT GAGGAATAGC GAGAGAGAGT
   541  CTGTGAGTGG AACGATGGTG CGAAGGACCG AGCGGAAATG ATGGCGGTGG TGGTTCGACG
   601  ATGGAGAGAG CGATTGCGAG TGTATGCAAG GTGTGG

Predicted gene structure (within gDNA segment 16839 to 19586):

 Exon  1  17513  17608 (  96 n);  cDNA    228    323 (  96 n); score: 0.677
  Intron  1  17609  18626 (1018 n); Pd: 0.000 (s: 0.66), Pa: 0.998 (s:    0)
 Exon  2  18627  18643 (  17 n);  cDNA    324    340 (  17 n); score: 0.706
  Intron  2  18644  18863 ( 220 n); Pd: 0.000 (s:    0), Pa: 0.519 (s:    0)
 Exon  3  18864  18887 (  24 n);  cDNA    341    362 (  22 n); score: 0.708

MATCH	21326110+	11931938+	0.677	137	0.215	C
PGS_21326110+_11931938+	(17513  17608,18627  18643,18864  18887)

Alignment (genomic DNA sequence = upper lines):

GAAGACGAGG AGGAAGACCC CTCCTCGCTG CCTCCGCTTC TCCAGCGGCT CCCCAAGGAC    17572
|| || || | | || ||     ||||  ||  |||||||||| || | || ||  ||||||||| 
GACGATGATG AAGATGAAGA TTCCTTTCTC CCTCCGCTTC TCAAACGTCT TCCCAAGGAC      287


TTCGGCGGCC CCTCCTTTGA CGAAGACGAG GACGCCTACT CCTCCGACCC CGACGATGCT    17632
|||||||||     | |      ||  ||||  || | |                           
TTCGGCGGCG GAGCATCGAT GGATTACGAC GATGAC.... .......... ..........      323


TCCCTCTCCG CTACGGTGGT CTTCAAGAGC GGCGCCCCGG CCTCCGCTCG ATCTCCGTTC    17692
                                                                  
.......... .......... .......... .......... .......... ..........      323


CTGGATCTGC GGCGCTCCAG CCCCCGCGCT ACCGATGACG ACCCATACTC TACCTTCGTC    17752
                                                                  
.......... .......... .......... .......... .......... ..........      323


GTCCACTCCA CCGCACGCTC GGGGGGGACC TCCTCCAGCC CTCGAGGGTC CGCCTCAGGC    17812
                                                                  
.......... .......... .......... .......... .......... ..........      323


ACATTCATCC GTCGCTCCGG GGGCTCGTCC AGCCCTCACG AATCCGTCTC TGGCACATTC    17872
                                                                  
.......... .......... .......... .......... .......... ..........      323


ATCCGCCGGA CTAGCACCCC GTCGAGCCCC CGGGACTCGG TCTCCGGCAC ATTCATCCGC    17932
                                                                  
.......... .......... .......... .......... .......... ..........      323


CGACCAGGGA GCCCGTCGAG CCCCCGCGGG TCGTTCTCTG GCACCTTCAT TCGCCACACC    17992
                                                                  
.......... .......... .......... .......... .......... ..........      323


AGCGGGGGTT CCAGTTCCTA TGAATCTGCT TCTGGCGGCG GCGGGGGTTT CGGGTCCTCT    18052
                                                                  
.......... .......... .......... .......... .......... ..........      323


TTCTGGAGTC CAGCGGTGGA GCAGACAGAG GAGCTCCGGC AACCGTCGCC TCTGATGCAG    18112
                                                                  
.......... .......... .......... .......... .......... ..........      323


CAACAACAGC AGCAGCATTC AAGGCGGAAG CCATCAGTGA GCTCGGCGCC AGACAGTGTT    18172
                                                                  
.......... .......... .......... .......... .......... ..........      323


ACCAGAGAGG ATCCTTCCAC CAAGTACGAG CTGCTCCATG AGCTTGGTGC GCCTCTTGCT    18232
                                                                  
.......... .......... .......... .......... .......... ..........      323


CTGGAATTAT TGTTTCATTA GTTCTGTATG TCTACTTGTA GAATGGCTGA AGCTTTGAGC    18292
                                                                  
.......... .......... .......... .......... .......... ..........      323


TGTTTTGCGA AATGCAAAAT TCAATTGGGA ATGCAGGGAA AGGCTCATAT GGTGCAGTGT    18352
                                                                  
.......... .......... .......... .......... .......... ..........      323


ACAAAGCAAG GGATCTCAGA ACGCAGGAGC TTGTGGCTGT CAAGATTATC TCACTAACAG    18412
                                                                  
.......... .......... .......... .......... .......... ..........      323


AAGGGGTTAG TTTCTAATTT TCTATTACAA AGTTCTGTGA ATATTCTGAA AGGCCACCCG    18472
                                                                  
.......... .......... .......... .......... .......... ..........      323


AGACATATTT CATATTTGGC AACCATATTG CTTTTGTTGT GAGCATTTTG TTTGCATGGG    18532
                                                                  
.......... .......... .......... .......... .......... ..........      323


CTCAATTGTG AGAGAATCTC ATAAATGTGG TTGCTGTCTG TTTTCCGAGT CGTTGCATTT    18592
                                                                  
.......... .......... .......... .......... .......... ..........      323


TTCCAAAATA TAAGTATGTA TCTTTGGTTT TCAGGAAGAA GGATATGAAG ACATACGGGG    18652
                                     |||||  | || ||  | |          
.......... .......... .......... ....GAAGAT GAATCTGGTG A.........      340


AGAAATTGAG ATGCTGCAGC AGTGTAGCCA TCCAAATGTT GTCCGCTACT TTGGAAGCTA    18712
                                                                  
.......... .......... .......... .......... .......... ..........      340


CCAAGGAGAG GACTACCTAT GGGTACAATC AAATAGCCTG ATAGTATCCA TTTTATTAAC    18772
                                                                  
.......... .......... .......... .......... .......... ..........      340


ATTAAGAAAT AACTATCATT GGGAGATTTC TCTACTTCTT GAGTCATTTA ACATGGGCTT    18832
                                                                  
.......... .......... .......... .......... .......... ..........      340


GATGCAAATG CGATTCTCAA CTTACAGATA GTTATGGAGT ACTGTGGTGG TGGAA    18887
                                  || | | || ||| || | | || ||
.......... .......... .......... .TT-TCG-GT ACTATGATCG TGAAA      362





********************************************************************************
EST sequence    3 +strand (File: 10698690+)

     1  TGGATCGGGG CTCTTTCTCC CCGCGAACCC GAAATACCCG ACCCAAATCC GATATCTACT
    61  CTACTTTCGT AATCCATAAC GACGACGATG ACGACGGAGA AACCAACCGG CGGCGGAAAA
   121  CCGCCAGCGC GGAAGCACAG GAAGATCCAT ACGCAACAAT GAAGTTCAAA GACAACGGCC
   181  ACGATGACAA CGACGATGAT GAAGATGAAG ATTCCTTTCT CCCTCCGCTT CTCAAACGTC
   241  TTCCCAAGGA CTTCGGCGGC GGAGCATCGA TGGATTACGA CGATGACGAA GATGAATCTG
   301  GTGATTTCGG TACTATGATC GTGAAAAACG ATCGGAGCCG GCAGCGAGAT CGGTCTTCTT
   361  CCGGTGTGGC TTCACCGGCG GGATTGACGT GGAAGACCGG GAATTCTTCT CAGGTGACTG
   421  CTTTGAACGA TGAGGATGAT GATGACGGAG GTGGATTTTC GACTTTTGTG ATGCGGTCGA
   481  CGGTGAGGAA TAGCGAGAGA GAGTCTGTGA GTGGAACGAT GGTGCGAAGG ACGAGCGGAA
   541  ATGATGGCGG TGGTGGTTCG ACGATGGAGA GAGCGATT

Predicted gene structure (within gDNA segment 17019 to 19476):

 Exon  1  17513  17608 (  96 n);  cDNA    192    287 (  96 n); score: 0.677
  Intron  1  17609  18626 (1018 n); Pd: 0.000 (s: 0.66), Pa: 0.998 (s:    0)
 Exon  2  18627  18643 (  17 n);  cDNA    288    304 (  17 n); score: 0.706
  Intron  2  18644  18863 ( 220 n); Pd: 0.000 (s:    0), Pa: 0.519 (s:    0)
 Exon  3  18864  18887 (  24 n);  cDNA    305    326 (  22 n); score: 0.708

MATCH	21326110+	10698690+	0.677	137	0.237	C
PGS_21326110+_10698690+	(17513  17608,18627  18643,18864  18887)

Alignment (genomic DNA sequence = upper lines):

GAAGACGAGG AGGAAGACCC CTCCTCGCTG CCTCCGCTTC TCCAGCGGCT CCCCAAGGAC    17572
|| || || | | || ||     ||||  ||  |||||||||| || | || ||  ||||||||| 
GACGATGATG AAGATGAAGA TTCCTTTCTC CCTCCGCTTC TCAAACGTCT TCCCAAGGAC      251


TTCGGCGGCC CCTCCTTTGA CGAAGACGAG GACGCCTACT CCTCCGACCC CGACGATGCT    17632
|||||||||     | |      ||  ||||  || | |                           
TTCGGCGGCG GAGCATCGAT GGATTACGAC GATGAC.... .......... ..........      287


TCCCTCTCCG CTACGGTGGT CTTCAAGAGC GGCGCCCCGG CCTCCGCTCG ATCTCCGTTC    17692
                                                                  
.......... .......... .......... .......... .......... ..........      287


CTGGATCTGC GGCGCTCCAG CCCCCGCGCT ACCGATGACG ACCCATACTC TACCTTCGTC    17752
                                                                  
.......... .......... .......... .......... .......... ..........      287


GTCCACTCCA CCGCACGCTC GGGGGGGACC TCCTCCAGCC CTCGAGGGTC CGCCTCAGGC    17812
                                                                  
.......... .......... .......... .......... .......... ..........      287


ACATTCATCC GTCGCTCCGG GGGCTCGTCC AGCCCTCACG AATCCGTCTC TGGCACATTC    17872
                                                                  
.......... .......... .......... .......... .......... ..........      287


ATCCGCCGGA CTAGCACCCC GTCGAGCCCC CGGGACTCGG TCTCCGGCAC ATTCATCCGC    17932
                                                                  
.......... .......... .......... .......... .......... ..........      287


CGACCAGGGA GCCCGTCGAG CCCCCGCGGG TCGTTCTCTG GCACCTTCAT TCGCCACACC    17992
                                                                  
.......... .......... .......... .......... .......... ..........      287


AGCGGGGGTT CCAGTTCCTA TGAATCTGCT TCTGGCGGCG GCGGGGGTTT CGGGTCCTCT    18052
                                                                  
.......... .......... .......... .......... .......... ..........      287


TTCTGGAGTC CAGCGGTGGA GCAGACAGAG GAGCTCCGGC AACCGTCGCC TCTGATGCAG    18112
                                                                  
.......... .......... .......... .......... .......... ..........      287


CAACAACAGC AGCAGCATTC AAGGCGGAAG CCATCAGTGA GCTCGGCGCC AGACAGTGTT    18172
                                                                  
.......... .......... .......... .......... .......... ..........      287


ACCAGAGAGG ATCCTTCCAC CAAGTACGAG CTGCTCCATG AGCTTGGTGC GCCTCTTGCT    18232
                                                                  
.......... .......... .......... .......... .......... ..........      287


CTGGAATTAT TGTTTCATTA GTTCTGTATG TCTACTTGTA GAATGGCTGA AGCTTTGAGC    18292
                                                                  
.......... .......... .......... .......... .......... ..........      287


TGTTTTGCGA AATGCAAAAT TCAATTGGGA ATGCAGGGAA AGGCTCATAT GGTGCAGTGT    18352
                                                                  
.......... .......... .......... .......... .......... ..........      287


ACAAAGCAAG GGATCTCAGA ACGCAGGAGC TTGTGGCTGT CAAGATTATC TCACTAACAG    18412
                                                                  
.......... .......... .......... .......... .......... ..........      287


AAGGGGTTAG TTTCTAATTT TCTATTACAA AGTTCTGTGA ATATTCTGAA AGGCCACCCG    18472
                                                                  
.......... .......... .......... .......... .......... ..........      287


AGACATATTT CATATTTGGC AACCATATTG CTTTTGTTGT GAGCATTTTG TTTGCATGGG    18532
                                                                  
.......... .......... .......... .......... .......... ..........      287


CTCAATTGTG AGAGAATCTC ATAAATGTGG TTGCTGTCTG TTTTCCGAGT CGTTGCATTT    18592
                                                                  
.......... .......... .......... .......... .......... ..........      287


TTCCAAAATA TAAGTATGTA TCTTTGGTTT TCAGGAAGAA GGATATGAAG ACATACGGGG    18652
                                     |||||  | || ||  | |          
.......... .......... .......... ....GAAGAT GAATCTGGTG A.........      304


AGAAATTGAG ATGCTGCAGC AGTGTAGCCA TCCAAATGTT GTCCGCTACT TTGGAAGCTA    18712
                                                                  
.......... .......... .......... .......... .......... ..........      304


CCAAGGAGAG GACTACCTAT GGGTACAATC AAATAGCCTG ATAGTATCCA TTTTATTAAC    18772
                                                                  
.......... .......... .......... .......... .......... ..........      304


ATTAAGAAAT AACTATCATT GGGAGATTTC TCTACTTCTT GAGTCATTTA ACATGGGCTT    18832
                                                                  
.......... .......... .......... .......... .......... ..........      304


GATGCAAATG CGATTCTCAA CTTACAGATA GTTATGGAGT ACTGTGGTGG TGGAA    18887
                                  || | | || ||| || | | || ||
.......... .......... .......... .TT-TCG-GT ACTATGATCG TGAAA      326





********************************************************************************
EST sequence    6 +strand (File: 12047395+)

     1  TGTAGCTGCC CAGCTGACAA GAACAATGTC AAAGCGCAAC ACGTTCATTG GTACTCCACA
    61  TTGGATGGCA CCAGAGGTCA TTCAAGAAAG TCGTTATGAT GGAAAGGTAG

Predicted gene structure (within gDNA segment 18981 to 21219):

 Exon  1  19281  19323 (  43 n);  cDNA      1     43 (  43 n); score: 0.977
  Intron  1  19324  20843 (1520 n); Pd: 0.770 (s: 0.98), Pa: 0.962 (s: 1.00)
 Exon  2  20844  20910 (  67 n);  cDNA     44    110 (  67 n); score: 0.985

MATCH	21326110+	12047395+	0.985	110	1.000	C
PGS_21326110+_12047395+	(19281  19323,20844  20910)

Alignment (genomic DNA sequence = upper lines):

TGTAGCTGCC CAGCTGACAA GAACCATGTC AAAGCGCAAC ACGGTATTCT AAACAGTGTT    19340
|||||||||| |||||||||| |||| ||||| |||||||||| |||                   
TGTAGCTGCC CAGCTGACAA GAACAATGTC AAAGCGCAAC ACG....... ..........       43


TGTTTTGCCA TTCAAATCCA TAGTTCAAGA AACTTCACAT CGATGTAACA AACAAAATGA    19400
                                                                  
.......... .......... .......... .......... .......... ..........       43


AGTGGCAGAT GAAACTTGTC CATGCCAGTT TACCATAAGC GGACCCATTT GTGCTTGTGC    19460
                                                                  
.......... .......... .......... .......... .......... ..........       43


ATAGTTCTTC AATGTGATGG TACTTTTATG GGAACTTGAA GCAAGTCTGT GTTGGAAAAT    19520
                                                                  
.......... .......... .......... .......... .......... ..........       43


GATTGCTGTG AAGTCCTAAC TGTTTCTTTA AGTGTCATAC TGCAAGTGCA TTATGGTCTA    19580
                                                                  
.......... .......... .......... .......... .......... ..........       43


TTAGGTTTAA AATGAAAAAT AAGAAAGTAT ATATTTGTTA TCTAGTATGC CTCGCCTAAT    19640
                                                                  
.......... .......... .......... .......... .......... ..........       43


TCCTTGGCAT TTCTTCCATT CTTTGAAACC CATACTGGTG GAACCTAGTT GAAGTGGTTC    19700
                                                                  
.......... .......... .......... .......... .......... ..........       43


CTGTACAAAT ACTCTCTGCA CTGCTTCTTC TCCCTTTCTT GTCGTGACAG CCTCTAGTCC    19760
                                                                  
.......... .......... .......... .......... .......... ..........       43


CCATATATCC CATTATGAAT CTGCTCACTC CCCCATTTGG CTTCTTCCTA GGCCACCACT    19820
                                                                  
.......... .......... .......... .......... .......... ..........       43


CAACAATTCT TCTGTTCTTG ATGACTGCGA TGCTCCATTC GATCTGGCAA ATTGCTGCCT    19880
                                                                  
.......... .......... .......... .......... .......... ..........       43


TGCTGGAGCT ATTCAAGAAC GTAGAGGGTT ACTGTGACAT TAGCATATCA AACCAACAGG    19940
                                                                  
.......... .......... .......... .......... .......... ..........       43


TCTGTTGGAA ATCATAATCA CAATGAACCT CCAAGTGGGA AATATTATCC AGGGCGTCAT    20000
                                                                  
.......... .......... .......... .......... .......... ..........       43


CTTACCTCCA AGTTATGGAC TCTGCTTGAC ACTAGAGGAA GAGTTAGTGC ACAGGGAGTC    20060
                                                                  
.......... .......... .......... .......... .......... ..........       43


CAAATCAGGT AGGATAGTTG ATAGTTCATA ATTGGCTAGA TCTAGGAGGA GGTATGTGAG    20120
                                                                  
.......... .......... .......... .......... .......... ..........       43


TGAGAGTTTG GAAAATCAGG GTAGAATACA AGTTCAGGTT CCCTAGGACG ATGATATAAT    20180
                                                                  
.......... .......... .......... .......... .......... ..........       43


GTAGTACCAT ACTACAAGAA TTGACTATGG AATTTATTAA TATCTAGCTA GAAACCAATA    20240
                                                                  
.......... .......... .......... .......... .......... ..........       43


TAAAAAAACA ATCTACTCCC CTTTCTACTG CTGCTGATAC TTCTACTCTT TTTTTTTTCT    20300
                                                                  
.......... .......... .......... .......... .......... ..........       43


CTCTTGTACA CCTTCTTGGC TGCTACACTT CTCTAGTTTC CAATCATGAC AATACATAAA    20360
                                                                  
.......... .......... .......... .......... .......... ..........       43


TGCTTGAGGA GCCCATAACA AATAGTTCTA CCCCACCCAC CCACACCCTT TCGTAGTAAA    20420
                                                                  
.......... .......... .......... .......... .......... ..........       43


GTGTGCCGAC AACAGTTGGT GCCCTCTTCT CGATGGTATC CATTGCTTTT CTGCATGCAC    20480
                                                                  
.......... .......... .......... .......... .......... ..........       43


ACACAAACAA ACACTTCTAA ATACACATAC TGACTTGTCG TATTGGCATG CAGTCATGCA    20540
                                                                  
.......... .......... .......... .......... .......... ..........       43


TTGAGACCAA ATCCATCAGG ACTGCATCCG CACAACACAA AATCTCACCA TACATGCATA    20600
                                                                  
.......... .......... .......... .......... .......... ..........       43


CGGTGTCTTG GATGTTTCTG TTGTTGGGGC GCTAATATGT ACTTCTACCA AAATGCAAGG    20660
                                                                  
.......... .......... .......... .......... .......... ..........       43


ACAAACTGTC CCAATTTTAC AGTAAAATAA CTATCATTGT GAAACAGACT GTCAGCATCG    20720
                                                                  
.......... .......... .......... .......... .......... ..........       43


CTCTCTAAGC TCAGTCTGTA CAGCTTTTAC CAAATAAAAA TAATGCAATG GTTTTTGGAA    20780
                                                                  
.......... .......... .......... .......... .......... ..........       43


AGAATAAAGG TTTTAGTGGC ACACTAATTT CCATAATTTG ACCCTTCATG TTTATGCTTT    20840
                                                                  
.......... .......... .......... .......... .......... ..........       43


CAGTTCATTG GTACTCCACA TTGGATGGCA CCAGAGGTCA TTCAAGAAAG TCGTTATGAT    20900
   ||||||| |||||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
...TTCATTG GTACTCCACA TTGGATGGCA CCAGAGGTCA TTCAAGAAAG TCGTTATGAT      100


GGAAAGGTAT    20910
|||||||||  
GGAAAGGTAG      110





********************************************************************************
EST sequence   25 +strand (File: 27547907+)

     1  GGGAGTTGTT CAAGGGTGTG CACAATCACT TCCAAAATGT TGTTCAGCAT GCCAATGCGA
    61  TGGCCACGGC AATGGAGATG TTCAGGGATG CACATGATCA CTTCCAGGGT GCTGTGCAGA
   121  GTGTCAGCAG CGCAGCATCA GCCATCGAAC GGTTCAAAGA CGCACATGAT CGTTTTCAGA
   181  ATATCACTCA CCATGGAAGC ATGGTAGCAG CAGTGATGGA ATGTGGTACC GATCATACAC
   241  AAGAGAAGAA GATGTGCGAG GAACCCCAAC AAAAGGCCAA AGTGACAGCT ATAGCTGAAA
   301  TTCAAAAGCT TGGCCTTACT GGAAGCGAGG TGGTCTTCGC AGCAAGTATT TTCGCAAAGG
   361  AACCAAACCA AATGGAGATG TTTTTAGCAC TCCCAGAAAT CTATAAGAGG GACTACATAG
   421  TCCAAATGCT CAACGGTGGG CAATCTCTCC GGTATTAGCT GAAGCTAGGG ATGAAAACGG
   481  ATCGGAAACG GACGGAAACT AGCTTTATCA TATTCGTTTT CATTTTTTTT TCGGGAATCG
   541  GAATCGAAAA CTCGGATACG GAAATAAAAT CGAATATTAT CGAATACAGA TACAGAGCGA
   601  ATACGAGACG GAACGAATAC AGTTAGCGAA TATTTACCGG GTNTATAAAA AAACCCCCTC
   661  AAATTGAGTT TCTTGATTCA AGGAANAAGA TATCNCTTTA TTATTTTTAG TTCAACATCC
   721  TCCAACANTT TATATTCGGC CAATTTTTGG AAGACTTGGC TCACAAACCG NATTGGGAAA
   781  ANACGATTTT TNATGGGTTG GTTCCTCTTA AAAGATTCCC TNTTGCCAAA TTTGGGTTTT
   841  TCCAAAAAAA AAAAAAAAAA NAAACCGGCC CCCCCNCCGG

Predicted gene structure (within gDNA segment 18638 to 22500):

 Exon  1  21266  21345 (  80 n);  cDNA    469    548 (  80 n); score: 0.775
  Intron  1  21346  21413 (  68 n); Pd: 0.000 (s: 0.68), Pa: 0.000 (s:    0)
 Exon  2  21414  21440 (  27 n);  cDNA    549    575 (  27 n); score: 0.741
  Intron  2  21441  21645 ( 205 n); Pd: 0.000 (s:    0), Pa: 0.848 (s:    0)
 Exon  3  21646  21671 (  26 n);  cDNA    576    597 (  22 n); score: 0.692
 PPA                              cDNA    844    864

MATCH	21326110+	27547907+	0.775	133	0.151	C
PGS_21326110+_27547907+	(21266  21345,21414  21440,21646  21671)

Alignment (genomic DNA sequence = upper lines):

GGATGAAAAC GGATCGGATA CGGACGGATA TCATCGATAT CATATTTGTT TTCGTATTTC    21325
|||||||||| |||||||| | |||||||| |   | |  ||| |||||| ||| ||| | |||  
GGATGAAAAC GGATCGGAAA CGGACGGAAA CTAGCTTTAT CATATTCGTT TTCATTTTTT      528


TGGTCGAATT CGGATTCGAA TACGGATAAT GTCAACTATA TCGGATAAGA TACGATTGGA    21385
|    | | | |||| |||||                                             
TTTCGGGAAT CGGAATCGAA .......... .......... .......... ..........      548


TGTCGACATC ATAAATATAT GATTTAAGTA CTCGGATACG GATACGGTAT CGGATGTAGA    21445
                               | |||||||||| || |    || || ||      
.......... .......... ........AA CTCGGATACG GAAATAAAAT CGAAT.....      575


ACATTCGAAC TCGGATACGA ACTGGTCTGA ATCCCTCTAA ACGAATTCGG TCTCAAATAC    21505
                                                                  
.......... .......... .......... .......... .......... ..........      575


GGTCGGAAAA TATCCGTACC GTTTTCATCC CTAGTTGCAA TGTTGAGAAA ATTATTTTGG    21565
                                                                  
.......... .......... .......... .......... .......... ..........      575


CAGCTGGAAT TCTTCCTTTA GTTTGTCTTA CCAAAACATT TGTTCTTGTT TCCTGCACCA    21625
                                                                  
.......... .......... .......... .......... .......... ..........      575


GGTAGATGTT TGGGCATTAG GTGTATCTGC AATTGAGATG GCAGAG    21671
                       | |||| |  |||  ||||   |||||
.......... .......... AT-TATC-G- AATACAGAT- ACAGAG      597





********************************************************************************
EST sequence  140 -strand (File: 11409274-)

     1  AGATGTTGAA TATTCGGACT CGAATACGGA CAGATCTAAA TCCCTCTAAA CGAATTCCCT
    61  CTAAACGAAT TCGGTCTCGA ATATGGTCGG AAAATATCCG TACCGTTTTC ATCCCTACTT
   121  TTGTGTTATA GAGAGAAAGA GATAGCCTCA ACTTCCAGCA TAGCACAAGC CCATCTTACA
   181  TCCAAAGCAA ACCACCCAGC CACCCAGGTC CTACTCAGCA AAACCACATC TGATGCTTTC
   241  GTCGATGCTA GGCATTTTCC CCTAGTGGCC TCCGTCCGCT AGACCCATTC CATCGTCCGC
   301  GCCTTTACCT CCACAGGACC TTGCAACCGA CTCAAAAAGC TTCTCTATCT CAGGAGCACA
   361  GTGTGTAAAG GATCGAGTCC AGAAGCTGTA GCGTGGGTTC TTTATAAGCT CAATGAAAGT
   421  AATGAGTAAT CCCCAAGGAT GCGGCCGATT GACAATTAAC CTTTCCAGAA GAACCCTTGT
   481  TATCTGCTCT TGGACAATTT CCTGTGTTGC CTCAGCAAAC AAGTACAGAA TGATGAAGGA
   541  AAAGTAGTGG GTATGGCTAT TTGGATAGCG AAGCTGGTTA GCAATCGCAT TGAGAATAAG
   601  GTAGCGACCT TCTGTGTCCA TAGTCATTAC AAGGTTTCTG AACATCTCAG TAGCTGTTTC
   661  AATTTGGGAA TAT

Predicted gene structure (within gDNA segment 20873 to 22500):

 Exon  1  21477  21538 (  62 n);  cDNA     56    117 (  62 n); score: 0.968
  Intron  1  21539  21645 ( 107 n); Pd: 0.000 (s: 0.96), Pa: 0.848 (s:    0)
 Exon  2  21646  21671 (  26 n);  cDNA    118    141 (  24 n); score: 0.615
  Intron  2  21672  21761 (  90 n); Pd: 0.992 (s:    0), Pa: 0.000 (s: 0.60)
 Exon  3  21762  21813 (  52 n);  cDNA    142    190 (  49 n); score: 0.596

MATCH	21326110+	11409274-	0.798	140	0.208	C
PGS_21326110+_11409274-	(21477  21538,21646  21671,21762  21813)

Alignment (genomic DNA sequence = upper lines):

TCCCTCTAAA CGAATTCGGT CTCAAATACG GTCGGAAAAT ATCCGTACCG TTTTCATCCC    21536
|||||||||| |||||||||| ||| |||| | |||||||||| |||||||||| |||||||||| 
TCCCTCTAAA CGAATTCGGT CTCGAATATG GTCGGAAAAT ATCCGTACCG TTTTCATCCC      115


TAGTTGCAAT GTTGAGAAAA TTATTTTGGC AGCTGGAATT CTTCCTTTAG TTTGTCTTAC    21596
||                                                                
TA........ .......... .......... .......... .......... ..........      117


CAAAACATTT GTTCTTGTTT CCTGCACCAG GTAGATGTTT GGGCATTAGG TGTATCTGCA    21656
                                                       | | | ||   
.......... .......... .......... .......... .........C T-TTTGTGTT      127


ATTGAGATGG CAGAGGTAGA CATTGTTCCT TGCTTCTTTC TTTTTTTGAC TGTACACTTT    21716
|| |||| |   ||||                                                  
ATAGAGA-GA AAGAG..... .......... .......... .......... ..........      141


TGTTTTTAAT TTTGTGTCGT GACAATGCTT TTTAATATTT ATTTTGTATC TCTGACTGTA    21776
                                                  || |  || |   |  
.......... .......... .......... .......... .....ATAGC -CTCAACTTC      155


GGGCATGCCA CCAAGATCCA CTGTACATCC AATGAGA    21813
  ||||  ||  ||||  |||    ||||||| || |  |
CAGCATAGCA -CAAG-CCCA TCTTACATCC AAAGCAA      190





********************************************************************************
EST sequence   46 +strand (File: 13239349+)

     1  GCACGAGGAG TTTGAGTTTT GGAGAGTGGC GCCAATGGAA GTTTGAGTTT TGAAATTTGG
    61  ATGCTAATTT TTTGTTGAAA GTCATCTGTA GGGCTTGTAG AAATAAGCGC GGGAAAGAAT
   121  AGTGGGAGCG CGCGAGGAGA CGAGCGGCCG TACCAGACGC GCGAGGAGAC CAGCGTAGGG
   181  CTTGTAGAAA TAAGCGCGGG AAAGAATAGT GGGAGCGCGC GAGGAGACGA GCGGCCGTAC
   241  CAGACGCGCG AGGAGACCAG CGACCACGGA GATTTAGCGG CGTTGGTTAA GTTTACCGCC
   301  TCATTACTCT TGGAACAGCG ATTTAATGAA AAAGGCCATG GGCCTACGTT GCTCCTTGGT
   361  CTCTGGGCTG AGGGTTTAGA TGAGGGAGAC TGATGGACGG AGAGAGTAAT ATCTATATGC
   421  CCTAAGAAAA AACACGCCCT ATGAGTAGAG ATAAAAACAG ATGGAATACG GACGGATATT
   481  ATCGATATCA TATTTGTTTT TATATTTCTG GTTGAATTCA AATTCGAATA CAGATAATGT
   541  TAACCACGTT GGATAAGATA CGATTGAATA TCAACATCAT AAATATACG

Predicted gene structure (within gDNA segment 18658 to 21719):

 Exon  1  21266  21406 ( 141 n);  cDNA    449    589 ( 141 n); score: 0.851

MATCH	21326110+	13239349+	0.851	141	0.239	C
PGS_21326110+_13239349+	(21266  21406)

Alignment (genomic DNA sequence = upper lines):

GGATGAAAAC GGATCGGATA CGGACGGATA TCATCGATAT CATATTTGTT TTCGTATTTC    21325
 ||| |||||  ||| | ||| |||||||||| | |||||||| |||||||||| ||  |||||| 
AGATAAAAAC AGATGGAATA CGGACGGATA TTATCGATAT CATATTTGTT TTTATATTTC      508


TGGTCGAATT CGGATTCGAA TACGGATAAT GTCAACTATA TCGGATAAGA TACGATTGGA    21385
|||| ||||| |  ||||||| ||| |||||| || ||| |   | |||||||| |||||||| | 
TGGTTGAATT CAAATTCGAA TACAGATAAT GTTAACCACG TTGGATAAGA TACGATTGAA      568


TGTCGACATC ATAAATATAT G    21406
| || ||||| |||||||||  |
TATCAACATC ATAAATATAC G      589





********************************************************************************
EST sequence  126 -strand (File: 7217281-)

     1  ACGAACGGAT ATCATTGATA TAATATTTGT TTTTATATTT CTAGTCGGAT TCGGATTCGA
    61  ATACGGATAA TGTCAACCAT ATCGGATAAG ATATGATTTG ATGTCGACAT CATAAATATA
   121  CGATTTAAGT ATTCGGATAC GGTATGTTGA ATATTCGGAC TCGGATACGG ACAGATCTGA
   181  ACCCCTCTAA ACGAATTCGG TCTCAAATAC GGTCGGAAAA TATCCGTACC GTTTTCATCC
   241  TTACCCAGCG CTTTCAAATT CAATGACGAG CCGTCGCCTC TCGACGGCTG GGAACTGGGA
   301  AGTAGTCCAG GACGGAGTAC TCGTGCTCAG GAGTCAGGAC GCACTGCGAG CCACCCGGCC
   361  ATCGCGAGAG ACGCGCGCAG GACAACTTCG CGGTCCTGGT GCACGCCAGG GCCCCCGTTG
   421  GGTTGGGCCC GCCGAGGCGT CGGAGCGCGC ACCACTTGAT CTCGTCACGG TACTCGACGT
   481  CAGCGGAAGC ATGTCTGGCC ACAAACTGGT CCTCCTGAAG CAGGCCATGG ACTGATGGAC
   541  TTCGTCATCG ACCACTTTGG CCCCAGCGAC CGGCTCAGCA TCGTCTCCTT CACATTGGCA
   601  ACCAAAACCA AAATAGATCT CCAACATAAT ACCTATAATC TCCAACAAAG AGCATCTGAC
   661  ACCCATTTTA AGTATCAAGA GAGATATAGC CTAAAT

Predicted gene structure (within gDNA segment 20788 to 22500):

 Exon  1  21285  21538 ( 254 n);  cDNA      1    243 ( 243 n); score: 0.886

MATCH	21326110+	7217281-	0.886	254	0.365	C
PGS_21326110+_7217281-	(21285  21538)

Alignment (genomic DNA sequence = upper lines):

ACGGACGGAT ATCATCGATA TCATATTTGT TTTCGTATTT CTGGTCGAAT TCGGATTCGA    21344
||| |||||| ||||| |||| | |||||||| |||  ||||| || |||| || |||||||||| 
ACGAACGGAT ATCATTGATA TAATATTTGT TTTTATATTT CTAGTCGGAT TCGGATTCGA       60


ATACGGATAA TGTCAACTAT ATCGGATAAG ATACGATTGG ATGTCGACAT CATAAATATA    21404
|||||||||| ||||||| || |||||||||| ||| |||| | |||||||||| |||||||||| 
ATACGGATAA TGTCAACCAT ATCGGATAAG ATATGATTTG ATGTCGACAT CATAAATATA      120


TGATTTAAGT ACTCGGATAC GGATACGGTA TCGGATGTAG AACATTCGAA CTCGGATACG    21464
 ||||||||| | |    | | |||||||||| |  | | | | || ||||| | |||||||||| 
CGATTTAAGT A-T----T-C GGATACGGTA T--G-T-T-G AATATTCGGA CTCGGATACG      169


AACTGGTCTG AATCCCTCTA AACGAATTCG GTCTCAAATA CGGTCGGAAA ATATCCGTAC    21524
 || | |||| || ||||||| |||||||||| |||||||||| |||||||||| |||||||||| 
GACAGATCTG AACCCCTCTA AACGAATTCG GTCTCAAATA CGGTCGGAAA ATATCCGTAC      229


CGTTTTCATC CCTA    21538
|||||||||| | ||
CGTTTTCATC CTTA      243





********************************************************************************
EST sequence  125 -strand (File: 9299315-)

     1  ATATGATTGG ATGTCGACAT CATAAATATA CGATTTAAAT ATTCGGATAC GGATACAGTT
    61  TCGGATGTTA AATATTCGGA CTCGGATACG GACAAATCTG AACCCCTCTA AACGAATTTG
   121  GTCTCGAATA CGGTCGGAAA ATATCTGTAA CGTTTTCATC CCCGCGTGTG AGCGGGGCAA
   181  GAAGCTGTGC AGCGTGCGTC CTAGAAAAGT TGCGTGTCAT CATTTTCACC AACCAGCAAG
   241  CGAGGTTCGT CCCCGGAACC GCCGACCTCG ATGCCTACGC AGAAGTGCGG GCCCGCCGCG
   301  GACAGCACCA CGGCACGCAT CGGCAGTGAA GAACCTACAG ATCTGCTTGC ACCAGGACGG
   361  ATTCTGCTCG ACGCTGAACT AGTAGGTGTG GAGTCCATGG TTGGAGATGA GATTTGAGAA
   421  GAATGGGTGA GGATCAACAG AAGAGACAGG GAAGAAGAAG AAGAAGAAGA GTACAAAGTT
   481  TTATATAAAA TGTGAGTGTT GTTTCGATAG ATTTAATCAA ATTTAAATTT GTTTGAATTC
   541  TTGGAAAATG CAAATTGCAT TCTTTCATAG TAGTATTCGC TAATCATAAA CCACATTGTG
   601  TCTTTGTTTC GTCTTAATTA TATTCCTCGT GC

Predicted gene structure (within gDNA segment 21054 to 22500):

 Exon  1  21375  21535 ( 161 n);  cDNA      1    161 ( 161 n); score: 0.882
  Intron  1  21536  22289 ( 754 n); Pd: 0.000 (s: 0.92), Pa: 0.414 (s:    0)
 Exon  2  22290  22294 (   5 n);  cDNA    162    166 (   5 n); score: 0.800

MATCH	21326110+	9299315-	0.882	166	0.263	C
PGS_21326110+_9299315-	(21375  21535,22290  22294)

Alignment (genomic DNA sequence = upper lines):

ATACGATTGG ATGTCGACAT CATAAATATA TGATTTAAGT ACTCGGATAC GGATACGGTA    21434
||| |||||| |||||||||| ||||||||||  ||||||| | | |||||||| |||||| ||  
ATATGATTGG ATGTCGACAT CATAAATATA CGATTTAAAT ATTCGGATAC GGATACAGTT       60


TCGGATGTAG AACATTCGAA CTCGGATACG AACTGGTCTG AATCCCTCTA AACGAATTCG    21494
||||||||   || ||||| | ||||||||||  ||   |||| || ||||||| |||||||| | 
TCGGATGTTA AATATTCGGA CTCGGATACG GACAAATCTG AACCCCTCTA AACGAATTTG      120


GTCTCAAATA CGGTCGGAAA ATATCCGTAC CGTTTTCATC CCTAGTTGCA ATGTTGAGAA    21554
||||| |||| |||||||||| ||||| |||  |||||||||| |                     
GTCTCGAATA CGGTCGGAAA ATATCTGTAA CGTTTTCATC C......... ..........      161


AATTATTTTG GCAGCTGGAA TTCTTCCTTT AGTTTGTCTT ACCAAAACAT TTGTTCTTGT    21614
                                                                  
.......... .......... .......... .......... .......... ..........      161


TTCCTGCACC AGGTAGATGT TTGGGCATTA GGTGTATCTG CAATTGAGAT GGCAGAGGTA    21674
                                                                  
.......... .......... .......... .......... .......... ..........      161


GACATTGTTC CTTGCTTCTT TCTTTTTTTG ACTGTACACT TTTGTTTTTA ATTTTGTGTC    21734
                                                                  
.......... .......... .......... .......... .......... ..........      161


GTGACAATGC TTTTTAATAT TTATTTTGTA TCTCTGACTG TAGGGCATGC CACCAAGATC    21794
                                                                  
.......... .......... .......... .......... .......... ..........      161


CACTGTACAT CCAATGAGAG TAAGAGATGC TTCTCAATGC CTGTTAGTAT CTGCAGTTAA    21854
                                                                  
.......... .......... .......... .......... .......... ..........      161


TGAGGCTAAT AGGTTATAAC AGAATTAAAA AAATCTGCTC TATCTTTGGT GCACTGTACT    21914
                                                                  
.......... .......... .......... .......... .......... ..........      161


TTTTATCTCT TTACTGTCAA GGGCGTCGAG GGACAGGGTA GGAGGATCCC GGCTACGTAG    21974
                                                                  
.......... .......... .......... .......... .......... ..........      161


TTCATAGACC AATCTGTGGT GTGGGGCGGA GGTTTTACCC CTCAGTGCCC GATTGTTTCA    22034
                                                                  
.......... .......... .......... .......... .......... ..........      161


GCAAAGGTAG ATTAGGGAAT TGGGATAATT GTTCTTTCTT GATTATCATC ATACGAGTAC    22094
                                                                  
.......... .......... .......... .......... .......... ..........      161


AAGAATATAT AGGCCATTCG GCCATAACAG CTTGGAGCCA ATTGCTCCTA AATCTAAGGC    22154
                                                                  
.......... .......... .......... .......... .......... ..........      161


CATTATCGGC TCTCCTGCCT TCTAGGCTCT CGCCTGTTCA GTGTGCTCTG CATGCGTGGT    22214
                                                                  
.......... .......... .......... .......... .......... ..........      161


GACCGCGCCT ACGGTTCTGC TGGTGCGCCA TCTGCGGCTC TGCGAGCATC CTGGGCGTGC    22274
                                                                  
.......... .......... .......... .......... .......... ..........      161


CGTTTCCTTG TGTAGGCGCG    22294
                 |||| 
.......... .....CCGCG      166




Total number of EST alignments reported: 131



________________________________________________________________________________



Predicted gene locations (4):




PGL   1 (+ strand):	  7879   11738


AGS-1 (7879  8058,8339  8720,8849  9045,9698  9839,10516  10669,11330  11738)
SCR   (e 0.950  d 0.338 a 0.581,e 0.956  d 0.857 a 0.962,e 0.883  d 0.980 a 0.977,e 0.831  d 0.994 a 1.000,e 0.968  d 0.961 a 0.992,e 0.800)

  Exon  1   7879   8058 ( 180 n); score: 0.950
   Intron  1   8059   8338 ( 280 n);           Pd: 0.338  Pa: 0.581
  Exon  2   8339   8720 ( 382 n); score: 0.956
   Intron  2   8721   8848 ( 128 n);           Pd: 0.857  Pa: 0.962
  Exon  3   8849   9045 ( 197 n); score: 0.883
   Intron  3   9046   9697 ( 652 n);           Pd: 0.980  Pa: 0.977
  Exon  4   9698   9839 ( 142 n); score: 0.831
   Intron  4   9840  10515 ( 676 n);           Pd: 0.994  Pa: 1.000
  Exon  5  10516  10669 ( 154 n); score: 0.968
   Intron  5  10670  11329 ( 660 n);           Pd: 0.961  Pa: 0.992
  Exon  6  11330  11738 ( 409 n); score: 0.800

  PGS (7879  8058,8339  8700)	13557989+
  PGS (7879  8058,8339  8612)	6626513+
  PGS (7984  8058,8339  8720,8849  8913)	14528354+
  PGS (7984  8058,8339  8720,8849  8895)	25548034+
  PGS (7984  8058,8339  8633)	11549557+
  PGS (7984  8058,8339  8610)	11116044+
  PGS (7984  8058,8339  8565)	21975880+
  PGS (7984  8058,8339  8554)	21973454+
  PGS (7984  8058,8339  8534)	16314143+
  PGS (7988  8058,8339  8664)	13082841+
  PGS (8339  8720,8849  9045)	13778583+
  PGS (8339  8720,8849  8952)	11908994+
  PGS (8459  8720,8849  9029)	16312083+
  PGS (8487  8720,8849  9045)	11207020+
  PGS (8487  8720,8849  9045)	11206955+
  PGS (8487  8720,8849  9045)	18100417+
  PGS (8522  8720,8849  9045,9698  9839,10516  10669)	27547342+
  PGS (8663  8720,8849  9045,9698  9839,10516  10669)	10093099-
  PGS (9708  9839,10516  10669)	14528874-
  PGS (9738  9839,10516  10669,11330  11738)	24768712-
  PGS (10516  10669,11330  11738)	5058681-
  PGS (10516  10669,11330  11355)	4381116+
  PGS (10638  10669)	15853351+
  PGS (11475  11738)	4730326-
  PGS (11503  11630)	13557988-

3-phase translation of AGS-1 (+strand):

        .         .         .         .         .         .         
  7879  CCCGCCCGCCCGCCATTCTTGCCGAATCGAGTCCACGCCACGCCTCCTGCGCCCCCTTCG
         P  A  R  P  P  F  L  P  N  R  V  H  A  T  P  P  A  P  P  S 
          P  P  A  R  H  S  C  R  I  E  S  T  P  R  L  L  R  P  L  R 
           R  P  P  A  I  L  A  E  S  S  P  R  H  A  S  C  A  P  F 


        .         .         .         .         .         .         
  7939  GTTCTCACCTCGGGAGTCGCGGATTGGTGGAGGGGAGGATTTGAGCGGCGCGGCCATGGA
         V  L  T  S  G  V  A  D  W  W  R  G  G  F  E  R  R  G  H  G 
          F  S  P  R  E  S  R  I  G  G  G  E  D  L  S  G  A  A  M  D 
        G  S  H  L  G  S  R  G  L  V  E  G  R  I  -  A  A  R  P  W 


        .         .         .         .         .         .          : 
  7999  TACAACCTCTAGGGCCGCCAAGATCCCGTCGCTCCACCAGACGGAGATCAACTGGGACAA : 
         Y  N  L  -  G  R  Q  D  P  V  A  P  P  D  G  D  Q  L  G  Q  : 
          T  T  S  R  A  A  K  I  P  S  L  H  Q  T  E  I  N  W  D  N :  
        I  Q  P  L  G  P  P  R  S  R  R  S  T  R  R  R  S  T  G  T   :


        .         .         .         .         .         .         
  8339  CCTCGACAAGACCAAGCTCTACGTGGTGGGCGCAGGCATGTTCAGCGGCGTCACCGTGGC
         P  R  Q  D  Q  A  L  R  G  G  R  R  H  V  Q  R  R  H  R  G 
          L  D  K  T  K  L  Y  V  V  G  A  G  M  F  S  G  V  T  V  A 
        T  S  T  R  P  S  S  T  W  W  A  Q  A  C  S  A  A  S  P  W 


        .         .         .         .         .         .         
  8399  GCTGTATCCTGTCTCGGTGGTCAAGACCCGGATGCAGGTTGCCTCTGGGGACGCCATGAG
         A  V  S  C  L  G  G  Q  D  P  D  A  G  C  L  W  G  R  H  E 
          L  Y  P  V  S  V  V  K  T  R  M  Q  V  A  S  G  D  A  M  R 
        R  C  I  L  S  R  W  S  R  P  G  C  R  L  P  L  G  T  P  - 


        .         .         .         .         .         .         
  8459  GAGGAACGCGCTGGCTACCTTCAAGAACATCCTCAAGATGGACGGCGTGCCAGGGCTGTA
         E  E  R  A  G  Y  L  Q  E  H  P  Q  D  G  R  R  A  R  A  V 
          R  N  A  L  A  T  F  K  N  I  L  K  M  D  G  V  P  G  L  Y 
        G  G  T  R  W  L  P  S  R  T  S  S  R  W  T  A  C  Q  G  C 


        .         .         .         .         .         .         
  8519  CCGGGGGTTTGCTACCGTTATCATTGGGGCTGTACCAACTAGGATCATCTTCCTCACAGC
         P  G  V  C  Y  R  Y  H  W  G  C  T  N  -  D  H  L  P  H  S 
          R  G  F  A  T  V  I  I  G  A  V  P  T  R  I  I  F  L  T  A 
        T  G  G  L  L  P  L  S  L  G  L  Y  Q  L  G  S  S  S  S  Q 


        .         .         .         .         .         .         
  8579  GCTTGAGACAACCAAAGCAGCCTCGCTTAAGCTTGTTGAGCCCTTCAAGCTGTCAGAGCC
         A  -  D  N  Q  S  S  L  A  -  A  C  -  A  L  Q  A  V  R  A 
          L  E  T  T  K  A  A  S  L  K  L  V  E  P  F  K  L  S  E  P 
        R  L  R  Q  P  K  Q  P  R  L  S  L  L  S  P  S  S  C  Q  S 


        .         .         .         .         .         .         
  8639  GGTGCGGGCTGCCTTTGCCAATGGCCTTGCTGGTCTGTCAGCGTCTACATGTTCGCAGGC
         G  A  G  C  L  C  Q  W  P  C  W  S  V  S  V  Y  M  F  A  G 
          V  R  A  A  F  A  N  G  L  A  G  L  S  A  S  T  C  S  Q  A 
        R  C  G  L  P  L  P  M  A  L  L  V  C  Q  R  L  H  V  R  R 


        .         .         .  :         .         .         .         
  8699  TATTTTTGTTCCAATTGATGTG : ATTAGCCAGAAATTGATGGTTCAAGGATATTCTGGTAA
         Y  F  C  S  N  -  C   : D  -  P  E  I  D  G  S  R  I  F  W  - 
          I  F  V  P  I  D  V  :  I  S  Q  K  L  M  V  Q  G  Y  S  G  N 
        L  F  L  F  Q  L  M  - :   L  A  R  N  -  W  F  K  D  I  L  V 


        .         .         .         .         .         .         
  8887  TGCCAGATACAAAGGTGGATTAGATGTTGCTCGAAAGGTCATAAAGGCTGATGGCATTAG
         C  Q  I  Q  R  W  I  R  C  C  S  K  G  H  K  G  -  W  H  - 
          A  R  Y  K  G  G  L  D  V  A  R  K  V  I  K  A  D  G  I  R 
        M  P  D  T  K  V  D  -  M  L  L  E  R  S  -  R  L  M  A  L 


        .         .         .         .         .         .         
  8947  GGGGCTGTACAGAGGATTTGGACTGTCTGTTATGACCTATGCTCCATCCAGTGCTGTGTG
         G  A  V  Q  R  I  W  T  V  C  Y  D  L  C  S  I  Q  C  C  V 
          G  L  Y  R  G  F  G  L  S  V  M  T  Y  A  P  S  S  A  V  W 
        G  G  C  T  E  D  L  D  C  L  L  -  P  M  L  H  P  V  L  C 


        .         .         .         .         :  .         .         
  9007  GTGGGCAAGTTATGGTTCCAGCCAGCGCATAATTTGGAG : TGCTCTTGGCCATTTGCATGA
         V  G  K  L  W  F  Q  P  A  H  N  L  E  :  C  S  W  P  F  A  - 
          W  A  S  Y  G  S  S  Q  R  I  I  W  S :   A  L  G  H  L  H  D 
        G  G  Q  V  M  V  P  A  S  A  -  F  G   : V  L  L  A  I  C  M 


        .         .         .         .         .         .         
  9719  CAAAGAAGAGGCTCCTAGCCAATTGAAACTAGTTGGTGTTCAAGCATCAGGGGGGGTTTT
         Q  R  R  G  S  -  P  I  E  T  S  W  C  S  S  I  R  G  G  F 
          K  E  E  A  P  S  Q  L  K  L  V  G  V  Q  A  S  G  G  V  F 
        T  K  K  R  L  L  A  N  -  N  -  L  V  F  K  H  Q  G  G  F 


        .         .         .         .         .         .         
  9779  TGCCGGTGCCGTGACCTCTTTTGTTACGACTCCCATAGATACAATAAAGACCAGGCTGCA
         C  R  C  R  D  L  F  C  Y  D  S  H  R  Y  N  K  D  Q  A  A 
          A  G  A  V  T  S  F  V  T  T  P  I  D  T  I  K  T  R  L  Q 
        L  P  V  P  -  P  L  L  L  R  L  P  -  I  Q  -  R  P  G  C 


        . :          .         .         .         .         .         
  9839  G : GTTATGGATAATGAAAATAAGCCAAAAGCCAGGGAAGTTGTCAAAAGATTGATTGCTGA
          : G  Y  G  -  -  K  -  A  K  S  Q  G  S  C  Q  K  I  D  C  - 
          :  V  M  D  N  E  N  K  P  K  A  R  E  V  V  K  R  L  I  A  E 
        R :   L  W  I  M  K  I  S  Q  K  P  G  K  L  S  K  D  -  L  L 


        .         .         .         .         .         .         
 10575  AGATGGATGGAAAGGTTTGTACAGAGGGTTGGGTCCAAGATTTTTCAGCTCATCAGCTTG
         R  W  M  E  R  F  V  Q  R  V  G  S  K  I  F  Q  L  I  S  L 
          D  G  W  K  G  L  Y  R  G  L  G  P  R  F  F  S  S  S  A  W 
        K  M  D  G  K  V  C  T  E  G  W  V  Q  D  F  S  A  H  Q  L 


        .         .         .         .     :      .         .         
 10635  GGGAACCTCAATGATAGTATGCTACGAGTACCTGA : AGCGCTTGTGTGCTAAAGTTGAAGA
         G  N  L  N  D  S  M  L  R  V  P  E :   A  L  V  C  -  S  -  R 
          G  T  S  M  I  V  C  Y  E  Y  L   : K  R  L  C  A  K  V  E  E 
        G  E  P  Q  -  -  Y  A  T  S  T  -  :  S  A  C  V  L  K  L  K 


        .         .         .         .         .         .         
 11355  GGTCTGATTTCTGAGCTGCCTTAAACTCAGAACGCAATTCCTACAATTCTGGAAGTTTTG
         G  L  I  S  E  L  P  -  T  Q  N  A  I  P  T  I  L  E  V  L 
          V  -  F  L  S  C  L  K  L  R  T  Q  F  L  Q  F  W  K  F  C 
        R  S  D  F  -  A  A  L  N  S  E  R  N  S  Y  N  S  G  S  F 


        .         .         .         .         .         .         
 11415  TATTAGCAGAAGTGTAATAATGCTGTACACCAACGGAAGCTTCAGTTCTTGCTGACATAG
         Y  -  Q  K  C  N  N  A  V  H  Q  R  K  L  Q  F  L  L  T  - 
          I  S  R  S  V  I  M  L  Y  T  N  G  S  F  S  S  C  -  H  R 
        V  L  A  E  V  -  -  C  C  T  P  T  E  A  S  V  L  A  D  I 


        .         .         .         .         .         .         
 11475  GTGAAAGTATTAAACATGGATGTTTGATGGTGTTAAAGACGTCATTTGATGCTAGACAAT
         V  K  V  L  N  M  D  V  -  W  C  -  R  R  H  L  M  L  D  N 
          -  K  Y  -  T  W  M  F  D  G  V  K  D  V  I  -  C  -  T  I 
        G  E  S  I  K  H  G  C  L  M  V  L  K  T  S  F  D  A  R  Q 


        .         .         .         .         .         .         
 11535  AGTCCTTACAAACTTTGGTTCTCTGAGCAGAGTATTCTCAAAAAAATGCAGGGGCCTATA
         S  P  Y  K  L  W  F  S  E  Q  S  I  L  K  K  M  Q  G  P  I 
          V  L  T  N  F  G  S  L  S  R  V  F  S  K  K  C  R  G  L  Y 
        -  S  L  Q  T  L  V  L  -  A  E  Y  S  Q  K  N  A  G  A  Y 


        .         .         .         .         .         .         
 11595  TTTTTTTTTGCCTCTTATGCTGAATATGGATTAGGCTGATCATTTTAGATGAATATAAAC
         F  F  F  A  S  Y  A  E  Y  G  L  G  -  S  F  -  M  N  I  N 
          F  F  L  P  L  M  L  N  M  D  -  A  D  H  F  R  -  I  -  T 
        I  F  F  C  L  L  C  -  I  W  I  R  L  I  I  L  D  E  Y  K 


        .         .         .         .         .         .         
 11655  GAGATCAGATGTACACATTTATCATTCTTTTATACGTGAAGGCTTGTTTTAGCGAGGCTG
         E  I  R  C  T  H  L  S  F  F  Y  T  -  R  L  V  L  A  R  L 
          R  S  D  V  H  I  Y  H  S  F  I  R  E  G  L  F  -  R  G  W 
        R  D  Q  M  Y  T  F  I  I  L  L  Y  V  K  A  C  F  S  E  A 


        .         .         .   
 11715  GATGATTGAGACCAGTTGTAATGA
         D  D  -  D  Q  L  -  - 
          M  I  E  T  S  C  N 
        G  -  L  R  P  V  V  M 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-1_AGS-1_PPS_1 (7880  8058,8339  8720,8849  9045,9698  9839,10516  10669,11330  11361)	(frame '2';  1083 bp,  361 residues) 
     1  PPARHSCRIE STPRLLRPLR FSPRESRIGG GEDLSGAAMD TTSRAAKIPS LHQTEINWDN 
    61  LDKTKLYVVG AGMFSGVTVA LYPVSVVKTR MQVASGDAMR RNALATFKNI LKMDGVPGLY 
   121  RGFATVIIGA VPTRIIFLTA LETTKAASLK LVEPFKLSEP VRAAFANGLA GLSASTCSQA 
   181  IFVPIDVISQ KLMVQGYSGN ARYKGGLDVA RKVIKADGIR GLYRGFGLSV MTYAPSSAVW 
   241  WASYGSSQRI IWSALGHLHD KEEAPSQLKL VGVQASGGVF AGAVTSFVTT PIDTIKTRLQ 
   301  VMDNENKPKA REVVKRLIAE DGWKGLYRGL GPRFFSSSAW GTSMIVCYEY LKRLCAKVEE 
   361  V-

NCBI Blastp




AGS-2 (8598  8720,8849  9045,9438  9477,9729  9839,10516  10669,11330  11355)
SCR   (e 0.699  d 0.857 a 0.962,e 0.772  d 0.980 a 0.936,e 0.450  d 0.869 a 0.000,e 0.667  d 0.994 a 1.000,e 0.708  d 0.961 a 0.992,e 0.731)

  Exon  1   8598   8720 ( 123 n); score: 0.699
   Intron  1   8721   8848 ( 128 n);           Pd: 0.857  Pa: 0.962
  Exon  2   8849   9045 ( 197 n); score: 0.772
   Intron  2   9046   9437 ( 392 n);           Pd: 0.980  Pa: 0.936
  Exon  3   9438   9477 (  40 n); score: 0.450
   Intron  3   9478   9728 ( 251 n);           Pd: 0.869  Pa: 0.000
  Exon  4   9729   9839 ( 111 n); score: 0.667
   Intron  4   9840  10515 ( 676 n);           Pd: 0.994  Pa: 1.000
  Exon  5  10516  10669 ( 154 n); score: 0.708
   Intron  5  10670  11329 ( 660 n);           Pd: 0.961  Pa: 0.992
  Exon  6  11330  11355 (  26 n); score: 0.731

  PGS (8598  8720,8849  9045,9438  9477,9729  9839,10516  10669)	17074557+
  PGS (8878  9045,9438  9477,9729  9839,10516  10669,11330  11355)	18260535+

3-phase translation of AGS-2 (+strand):

        .         .         .         .         .         .         
  8598  GCCTCGCTTAAGCTTGTTGAGCCCTTCAAGCTGTCAGAGCCGGTGCGGGCTGCCTTTGCC
         A  S  L  K  L  V  E  P  F  K  L  S  E  P  V  R  A  A  F  A 
          P  R  L  S  L  L  S  P  S  S  C  Q  S  R  C  G  L  P  L  P 
           L  A  -  A  C  -  A  L  Q  A  V  R  A  G  A  G  C  L  C 


        .         .         .         .         .         .         
  8658  AATGGCCTTGCTGGTCTGTCAGCGTCTACATGTTCGCAGGCTATTTTTGTTCCAATTGAT
         N  G  L  A  G  L  S  A  S  T  C  S  Q  A  I  F  V  P  I  D 
          M  A  L  L  V  C  Q  R  L  H  V  R  R  L  F  L  F  Q  L  M 
        Q  W  P  C  W  S  V  S  V  Y  M  F  A  G  Y  F  C  S  N  - 


        .   :        .         .         .         .         .         
  8718  GTG : ATTAGCCAGAAATTGATGGTTCAAGGATATTCTGGTAATGCCAGATACAAAGGTGGA
         V  :  I  S  Q  K  L  M  V  Q  G  Y  S  G  N  A  R  Y  K  G  G 
          - :   L  A  R  N  -  W  F  K  D  I  L  V  M  P  D  T  K  V  D 
        C   : D  -  P  E  I  D  G  S  R  I  F  W  -  C  Q  I  Q  R  W 


        .         .         .         .         .         .         
  8906  TTAGATGTTGCTCGAAAGGTCATAAAGGCTGATGGCATTAGGGGGCTGTACAGAGGATTT
         L  D  V  A  R  K  V  I  K  A  D  G  I  R  G  L  Y  R  G  F 
          -  M  L  L  E  R  S  -  R  L  M  A  L  G  G  C  T  E  D  L 
        I  R  C  C  S  K  G  H  K  G  -  W  H  -  G  A  V  Q  R  I 


        .         .         .         .         .         .         
  8966  GGACTGTCTGTTATGACCTATGCTCCATCCAGTGCTGTGTGGTGGGCAAGTTATGGTTCC
         G  L  S  V  M  T  Y  A  P  S  S  A  V  W  W  A  S  Y  G  S 
          D  C  L  L  -  P  M  L  H  P  V  L  C  G  G  Q  V  M  V  P 
        W  T  V  C  Y  D  L  C  S  I  Q  C  C  V  V  G  K  L  W  F 


        .         .          : .         .         .         .          : 
  9026  AGCCAGCGCATAATTTGGAG : CTTAGAGAACTTAATTACCAACCTGAAACAATGTGATGAA : 
         S  Q  R  I  I  W  S :   L  E  N  L  I  T  N  L  K  Q  C  D  E  : 
          A  S  A  -  F  G   : A  -  R  T  -  L  P  T  -  N  N  V  M  K :  
        Q  P  A  H  N  L  E  :  L  R  E  L  N  Y  Q  P  E  T  M  -  -   :


        .         .         .         .         .         .         
  9729  GCTCCTAGCCAATTGAAACTAGTTGGTGTTCAAGCATCAGGGGGGGTTTTTGCCGGTGCC
         A  P  S  Q  L  K  L  V  G  V  Q  A  S  G  G  V  F  A  G  A 
          L  L  A  N  -  N  -  L  V  F  K  H  Q  G  G  F  L  P  V  P 
        S  S  -  P  I  E  T  S  W  C  S  S  I  R  G  G  F  C  R  C 


        .         .         .         .         .         . :          
  9789  GTGACCTCTTTTGTTACGACTCCCATAGATACAATAAAGACCAGGCTGCAG : GTTATGGAT
         V  T  S  F  V  T  T  P  I  D  T  I  K  T  R  L  Q  :  V  M  D 
          -  P  L  L  L  R  L  P  -  I  Q  -  R  P  G  C  R :   L  W  I 
        R  D  L  F  C  Y  D  S  H  R  Y  N  K  D  Q  A  A   : G  Y  G 


        .         .         .         .         .         .         
 10525  AATGAAAATAAGCCAAAAGCCAGGGAAGTTGTCAAAAGATTGATTGCTGAAGATGGATGG
         N  E  N  K  P  K  A  R  E  V  V  K  R  L  I  A  E  D  G  W 
          M  K  I  S  Q  K  P  G  K  L  S  K  D  -  L  L  K  M  D  G 
        -  -  K  -  A  K  S  Q  G  S  C  Q  K  I  D  C  -  R  W  M 


        .         .         .         .         .         .         
 10585  AAAGGTTTGTACAGAGGGTTGGGTCCAAGATTTTTCAGCTCATCAGCTTGGGGAACCTCA
         K  G  L  Y  R  G  L  G  P  R  F  F  S  S  S  A  W  G  T  S 
          K  V  C  T  E  G  W  V  Q  D  F  S  A  H  Q  L  G  E  P  Q 
        E  R  F  V  Q  R  V  G  S  K  I  F  Q  L  I  S  L  G  N  L 


        .         .         .     :      .         .         .
 10645  ATGATAGTATGCTACGAGTACCTGA : AGCGCTTGTGTGCTAAAGTTGAAGAG
         M  I  V  C  Y  E  Y  L   : K  R  L  C  A  K  V  E  E 
          -  -  Y  A  T  S  T  -  :  S  A  C  V  L  K  L  K 
        N  D  S  M  L  R  V  P  E :   A  L  V  C  -  S  -  R 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-1_AGS-2_PPS_1 (8598  8720,8849  9045,9438  9477,9729  9839,10516  10669,11330  11355)	(frame '1';   651 bp,  217 residues) 
     1  ASLKLVEPFK LSEPVRAAFA NGLAGLSAST CSQAIFVPID VISQKLMVQG YSGNARYKGG 
    61  LDVARKVIKA DGIRGLYRGF GLSVMTYAPS SAVWWASYGS SQRIIWSLEN LITNLKQCDE 
   121  APSQLKLVGV QASGGVFAGA VTSFVTTPID TIKTRLQVMD NENKPKAREV VKRLIAEDGW 
   181  KGLYRGLGPR FFSSSAWGTS MIVCYEYLKR LCAKVEE

NCBI Blastp





PGL   2 (+ strand):	 12352   17665


AGS-1 (12352  12640,12723  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15034,15520  15628,15847  15903,15976  16309)
SCR   (e 0.983  d 0.000 a 0.000,e 1.000  d 0.511 a 0.000,e 1.000  d 0.964 a 0.978,e 1.000  d 0.000 a 1.000,e 1.000  d 0.992 a 0.939,e 1.000  d 0.973 a 0.989,e 1.000  d 0.890 a 0.830,e 1.000  d 0.979 a 0.910,e 0.977  d 0.995 a 0.000,e 0.910  d 0.794 a 0.933,e 1.000  d 1.000 a 0.995,e 1.000  d 0.991 a 0.993,e 0.997)

  Exon  1  12352  12640 ( 289 n); score: 0.983
   Intron  1  12641  12722 (  82 n);           Pd: 0.000  Pa: 0.000
  Exon  2  12723  12823 ( 101 n); score: 1.000
   Intron  2  12824  12920 (  97 n);           Pd: 0.511  Pa: 0.000
  Exon  3  12921  12990 (  70 n); score: 1.000
   Intron  3  12991  13196 ( 206 n);           Pd: 0.964  Pa: 0.978
  Exon  4  13197  13280 (  84 n); score: 1.000
   Intron  4  13281  13380 ( 100 n);           Pd: 0.000  Pa: 1.000
  Exon  5  13381  13467 (  87 n); score: 1.000
   Intron  5  13468  13886 ( 419 n);           Pd: 0.992  Pa: 0.939
  Exon  6  13887  13957 (  71 n); score: 1.000
   Intron  6  13958  14109 ( 152 n);           Pd: 0.973  Pa: 0.989
  Exon  7  14110  14161 (  52 n); score: 1.000
   Intron  7  14162  14253 (  92 n);           Pd: 0.890  Pa: 0.830
  Exon  8  14254  14311 (  58 n); score: 1.000
   Intron  8  14312  14684 ( 373 n);           Pd: 0.979  Pa: 0.910
  Exon  9  14685  14779 (  95 n); score: 0.977
   Intron  9  14780  14879 ( 100 n);           Pd: 0.995  Pa: 0.000
  Exon 10  14880  15034 ( 155 n); score: 0.910
   Intron 10  15035  15519 ( 485 n);           Pd: 0.794  Pa: 0.933
  Exon 11  15520  15628 ( 109 n); score: 1.000
   Intron 11  15629  15846 ( 218 n);           Pd: 1.000  Pa: 0.995
  Exon 12  15847  15903 (  57 n); score: 1.000
   Intron 12  15904  15975 (  72 n);           Pd: 0.991  Pa: 0.993
  Exon 13  15976  16309 ( 334 n); score: 0.997

  PGS (12352  12640,12723  12823,12921  12990,13197  13208)	13585839+
  PGS (12352  12640,12723  12823,12921  12990)	13585840+
  PGS (12380  12640,12723  12823,12921  12990,13197  13207)	18965012+
  PGS (12473  12640,12723  12823,12921  12990,13197  13280,13381  13467,13887  13939)	20809597+
  PGS (12590  12640,12723  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14260)	14593236+
  PGS (12766  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779)	22490341-
  PGS (12788  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15034,15520  15573)	9410872+
  PGS (12790  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15030)	12030559+
  PGS (12814  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14771)	18965015-
  PGS (12473  12640)	21278903+
  PGS (12478  12586)	25415362+
  PGS (13247  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15024)	13120649+
  PGS (14110  14161,14254  14311,14685  14779,14880  15034,15520  15628,15847  15903,15976  15985)	24301133+
  PGS (14897  15034,15520  15628,15847  15903,15976  16159)	12027888-
  PGS (14898  15034,15520  15628,15847  15903,15976  16159)	12038224-
  PGS (14906  15034,15520  15628,15847  15903,15976  16159)	12038221-
  PGS (14952  15034,15520  15628,15847  15903,15976  16304)	14570760+
  PGS (14974  15034,15520  15628,15847  15903,15976  16222)	13586923+
  PGS (15520  15628,15847  15903,15976  16159)	24287802-
  PGS (15520  15628,15847  15903,15976  16159)	24293407-
  PGS (15538  15628,15847  15903,15976  16280)	13586921+
  PGS (15598  15628,15847  15903,15976  16291)	5688746-
  PGS (15604  15628,15847  15903,15976  16309)	12973578-

3-phase translation of AGS-1 (+strand):

        .         .         .         .         .         .         
 12352  TTGCTAGTCTTCTTCAGCTTCAGTCCAGTCACAACTGAATCCGCCGCGCAAGGCATCCAA
         L  L  V  F  F  S  F  S  P  V  T  T  E  S  A  A  Q  G  I  Q 
          C  -  S  S  S  A  S  V  Q  S  Q  L  N  P  P  R  K  A  S  K 
           A  S  L  L  Q  L  Q  S  S  H  N  -  I  R  R  A  R  H  P 


        .         .         .         .         .         .         
 12412  GGATTTGTTCGTCCTTCGGAGGGTGGGGAATCGAAGCGACGAAAACGAAGCAATGAACGA
         G  F  V  R  P  S  E  G  G  E  S  K  R  R  K  R  S  N  E  R 
          D  L  F  V  L  R  R  V  G  N  R  S  D  E  N  E  A  M  N  E 
        R  I  C  S  S  F  G  G  W  G  I  E  A  T  K  T  K  Q  -  T 


        .         .         .         .         .         .         
 12472  GGCGGTGCAGGAGGCGAAGCTGCTGCGGCAGGTGAACGCGCTCATCGTGGCGCACCTCCG
         G  G  A  G  G  E  A  A  A  A  G  E  R  A  H  R  G  A  P  P 
          A  V  Q  E  A  K  L  L  R  Q  V  N  A  L  I  V  A  H  L  R 
        R  R  C  R  R  R  S  C  C  G  R  -  T  R  S  S  W  R  T  S 


        .         .         .         .         .         .         
 12532  TAGCCAGAACCTCGGGCAGGCCGCAGCCGCCGTCGCCGCCGCCACCATGACCCCCATCTC
         -  P  E  P  R  A  G  R  S  R  R  R  R  R  H  H  D  P  H  L 
          S  Q  N  L  G  Q  A  A  A  A  V  A  A  A  T  M  T  P  I  S 
        V  A  R  T  S  G  R  P  Q  P  P  S  P  P  P  P  -  P  P  S 


        .         .         .         .         .         :  .         
 12592  CGCCGCCGAATCCGTCCCCGCAAATCAACTCCTACGTCTCGTGGCCAAG : GGCCTCGCGGC
         R  R  R  I  R  P  R  K  S  T  P  T  S  R  G  Q   : G  P  R  G 
          A  A  E  S  V  P  A  N  Q  L  L  R  L  V  A  K  :  G  L  A  A 
        P  P  P  N  P  S  P  Q  I  N  S  Y  V  S  W  P  R :   A  S  R 


        .         .         .         .         .         .         
 12734  GGAGGGCGGAGGAGGAGCCGCTTCCGCATTCGACTCCGCCGGGTTCGGTGGGGCGGTGCA
         G  G  R  R  R  S  R  F  R  I  R  L  R  R  V  R  W  G  G  A 
          E  G  G  G  G  A  A  S  A  F  D  S  A  G  F  G  G  A  V  Q 
        R  R  A  E  E  E  P  L  P  H  S  T  P  P  G  S  V  G  R  C 


        .         .         .          : .         .         .         
 12794  GCCGCTCGGCTCCAGTGCCGTGGATTTCAG : TATGCAGGATGTCAAGGGCTCATCCAAGAG
         A  A  R  L  Q  C  R  G  F  Q  :  Y  A  G  C  Q  G  L  I  Q  E 
          P  L  G  S  S  A  V  D  F  S :   M  Q  D  V  K  G  S  S  K  S 
        S  R  S  A  P  V  P  W  I  S   : V  C  R  M  S  R  A  H  P  R 


        .         .         .         .          : .         .         
 12951  CTTCCCCAAGCACGAGGCGAAGCATGTCTCTGACCATAAG : AACGCTGCCCGGTGTGCGAA
         L  P  Q  A  R  G  E  A  C  L  -  P  -   : E  R  C  P  V  C  E 
          F  P  K  H  E  A  K  H  V  S  D  H  K  :  N  A  A  R  C  A  K 
        A  S  P  S  T  R  R  S  M  S  L  T  I  R :   T  L  P  G  V  R 


        .         .         .         .         .         .         
 13217  ATTTAGTCCTGATGGGAAGTATTTTGCAACTGGGAGTGCTGATACATCCATTAAGTTTTT
         I  -  S  -  W  E  V  F  C  N  W  E  C  -  Y  I  H  -  V  F 
          F  S  P  D  G  K  Y  F  A  T  G  S  A  D  T  S  I  K  F  F 
        N  L  V  L  M  G  S  I  L  Q  L  G  V  L  I  H  P  L  S  F 


        .    :       .         .         .         .         .         
 13277  TGAG : GTTGCTAAAATTAAGCAGACTATGGTAGGGGACTCCAAAGATGGTCCTGCCAGGCC
         -   : G  C  -  N  -  A  D  Y  G  R  G  L  Q  R  W  S  C  Q  A 
          E  :  V  A  K  I  K  Q  T  M  V  G  D  S  K  D  G  P  A  R  P 
        L  R :   L  L  K  L  S  R  L  W  -  G  T  P  K  M  V  L  P  G 


        .         .         .         . :          .         .         
 13437  TGTGATTCGCACATTTTATGATCACACACAG : GCCATCAATGATCTGGATTTTCATCCTGA
         C  D  S  H  I  L  -  S  H  T   : G  H  Q  -  S  G  F  S  S  - 
          V  I  R  T  F  Y  D  H  T  Q  :  A  I  N  D  L  D  F  H  P  E 
        L  -  F  A  H  F  M  I  T  H  R :   P  S  M  I  W  I  F  I  L 


        .         .         .         .         .  :         .         
 13916  GAGTCCAATACTGATATCAGCTGCAAAAGACAATACAATAAA : ATTTTTTGACTTCTCAAA
         E  S  N  T  D  I  S  C  K  R  Q  Y  N  K  :  I  F  -  L  L  K 
          S  P  I  L  I  S  A  A  K  D  N  T  I  K :   F  F  D  F  S  K 
        R  V  Q  Y  -  Y  Q  L  Q  K  T  I  Q  -   : N  F  L  T  S  Q 


        .         .         .         .    :       .         .         
 14128  GACCAATGCGAGGAAAGCGTTCAGAGTTATTCAG : GATACTCATAATGTTAGATCTGTATG
         D  Q  C  E  E  S  V  Q  S  Y  S   : G  Y  S  -  C  -  I  C  M 
          T  N  A  R  K  A  F  R  V  I  Q  :  D  T  H  N  V  R  S  V  C 
        R  P  M  R  G  K  R  S  E  L  F  R :   I  L  I  M  L  D  L  Y 


        .         .         .         .  :         .         .         
 14280  TTTTCATCCTTGTGGGGATTACCTTTTAGCAG : GGACTGATCACCCAGTTGCTCATTTATA
         F  S  S  L  W  G  L  P  F  S  R :   D  -  S  P  S  C  S  F  I 
          F  H  P  C  G  D  Y  L  L  A   : G  T  D  H  P  V  A  H  L  Y 
        V  F  I  L  V  G  I  T  F  -  Q  :  G  L  I  T  Q  L  L  I  Y 


        .         .         .         .         .         .         
 14713  TGATATAAATACTTTTACATGCTACTTATCAGCAAATGCACAGGATTCTAGTTCTCCCAT
         -  Y  K  Y  F  Y  M  L  L  I  S  K  C  T  G  F  -  F  S  H 
          D  I  N  T  F  T  C  Y  L  S  A  N  A  Q  D  S  S  S  P  I 
        M  I  -  I  L  L  H  A  T  Y  Q  Q  M  H  R  I  L  V  L  P 


        .       :    .         .         .         .         .         
 14773  TAACCAG : GTACGCTACTCCTGTACTGGGAGCTTGTATGTGACTGCTTCTAAAGATGGTTC
         -  P   : G  T  L  L  L  Y  W  E  L  V  C  D  C  F  -  R  W  F 
          N  Q  :  V  R  Y  S  C  T  G  S  L  Y  V  T  A  S  K  D  G  S 
        L  T  R :   Y  A  T  P  V  L  G  A  C  M  -  L  L  L  K  M  V 


        .         .         .         .         .         .         
 14933  TCTGCGCATTTGGGATGGAGTATCTGCTGAATGTGTTCGACCTATTATTGGAGCACATGG
         S  A  H  L  G  W  S  I  C  -  M  C  S  T  Y  Y  W  S  T  W 
          L  R  I  W  D  G  V  S  A  E  C  V  R  P  I  I  G  A  H  G 
        L  C  A  F  G  M  E  Y  L  L  N  V  F  D  L  L  L  E  H  M 


        .         .         .         .         .  :         .         
 14993  ATCTGCAGAAGCTACTAGCGCAATTTTCACCAGAGATGAGAG : GTATGTCCTATCTTGTGG
         I  C  R  S  Y  -  R  N  F  H  Q  R  -  E  :  V  C  P  I  L  W 
          S  A  E  A  T  S  A  I  F  T  R  D  E  R :   Y  V  L  S  C  G 
        D  L  Q  K  L  L  A  Q  F  S  P  E  M  R   : G  M  S  Y  L  V 


        .         .         .         .         .         .         
 15538  GAAAGATTCTTGTGTCAAGTTATGGGAAGTTGGCACTGGACGACTTGTGAAGCAATATGC
         E  R  F  L  C  Q  V  M  G  S  W  H  W  T  T  C  E  A  I  C 
          K  D  S  C  V  K  L  W  E  V  G  T  G  R  L  V  K  Q  Y  A 
        G  K  I  L  V  S  S  Y  G  K  L  A  L  D  D  L  -  S  N  M 


        .         .         .         . :          .         .         
 15598  AGGAGCCATTCGCAGACAATTTCGTTGTCAG : GCTGTCTTCAATGAAACCGAAGAATTTGT
         R  S  H  S  Q  T  I  S  L  S   : G  C  L  Q  -  N  R  R  I  C 
          G  A  I  R  R  Q  F  R  C  Q  :  A  V  F  N  E  T  E  E  F  V 
        Q  E  P  F  A  D  N  F  V  V  R :   L  S  S  M  K  P  K  N  L 


        .         .         .        :   .         .         .         
 15876  TCTATCAGTTGATGAACAAAACAATGAG : GTTGTCGTCTGGGATGCACTTACTGCAGAAAA
         S  I  S  -  -  T  K  Q  -   : G  C  R  L  G  C  T  Y  C  R  K 
          L  S  V  D  E  Q  N  N  E  :  V  V  V  W  D  A  L  T  A  E  K 
        F  Y  Q  L  M  N  K  T  M  R :   L  S  S  G  M  H  L  L  Q  K 


        .         .         .         .         .         .         
 16008  GGTTGCAAGATTGCCCTCTGGCAGCACTGGTGCTCCCAGATGGCTCGACCACTCCCCAGT
         G  C  K  I  A  L  W  Q  H  W  C  S  Q  M  A  R  P  L  P  S 
          V  A  R  L  P  S  G  S  T  G  A  P  R  W  L  D  H  S  P  V 
        R  L  Q  D  C  P  L  A  A  L  V  L  P  D  G  S  T  T  P  Q 


        .         .         .         .         .         .         
 16068  TGAACCAGTTTTTGTTATTTGTGGAAATGATAGATCGATCAGATTCTGGAAACAAACCGT
         -  T  S  F  C  Y  L  W  K  -  -  I  D  Q  I  L  E  T  N  R 
          E  P  V  F  V  I  C  G  N  D  R  S  I  R  F  W  K  Q  T  V 
        L  N  Q  F  L  L  F  V  E  M  I  D  R  S  D  S  G  N  K  P 


        .         .         .         .         .         .         
 16128  ATAGCTTGTAGATTCAACCATTCAAATCAAAAGTATGCTTTCAGTATTACGTTTCAGGAG
         I  A  C  R  F  N  H  S  N  Q  K  Y  A  F  S  I  T  F  Q  E 
          -  L  V  D  S  T  I  Q  I  K  S  M  L  S  V  L  R  F  R  R 
        Y  S  L  -  I  Q  P  F  K  S  K  V  C  F  Q  Y  Y  V  S  G 


        .         .         .         .         .         .         
 16188  GAATGTGCTCATGTAACTTTAGTTGTATATGGGAGAAATTTGCATAAGCATTTTTTTTAT
         E  C  A  H  V  T  L  V  V  Y  G  R  N  L  H  K  H  F  F  Y 
          N  V  L  M  -  L  -  L  Y  M  G  E  I  C  I  S  I  F  F  I 
        G  M  C  S  C  N  F  S  C  I  W  E  K  F  A  -  A  F  F  L 


        .         .         .         .         .         .         
 16248  TGGAAACTGCATAAGCAATTGATTGATCTAATAGCAAACCCCAATGATATGTTTTTTTTT
         W  K  L  H  K  Q  L  I  D  L  I  A  N  P  N  D  M  F  F  F 
          G  N  C  I  S  N  -  L  I  -  -  Q  T  P  M  I  C  F  F  F 
        L  E  T  A  -  A  I  D  -  S  N  S  K  P  Q  -  Y  V  F  F 


        . 
 16308  TG
        
         
        L 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-2_AGS-1_PPS_1 (12359  12640,12723  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14161,14254  14311,14685  14779,14880  15034,15520  15628,15847  15903,15976  16131)	(frame '2';  1374 bp,  458 residues) 
     1  SSSASVQSQL NPPRKASKDL FVLRRVGNRS DENEAMNEAV QEAKLLRQVN ALIVAHLRSQ 
    61  NLGQAAAAVA AATMTPISAA ESVPANQLLR LVAKGLAAEG GGGAASAFDS AGFGGAVQPL 
   121  GSSAVDFSMQ DVKGSSKSFP KHEAKHVSDH KNAARCAKFS PDGKYFATGS ADTSIKFFEV 
   181  AKIKQTMVGD SKDGPARPVI RTFYDHTQAI NDLDFHPESP ILISAAKDNT IKFFDFSKTN 
   241  ARKAFRVIQD THNVRSVCFH PCGDYLLAGT DHPVAHLYDI NTFTCYLSAN AQDSSSPINQ 
   301  VRYSCTGSLY VTASKDGSLR IWDGVSAECV RPIIGAHGSA EATSAIFTRD ERYVLSCGKD 
   361  SCVKLWEVGT GRLVKQYAGA IRRQFRCQAV FNETEEFVLS VDEQNNEVVV WDALTAEKVA 
   421  RLPSGSTGAP RWLDHSPVEP VFVICGNDRS IRFWKQTV-

NCBI Blastp


>21326110+_PGL-2_AGS-1_PPS_2 (16101  16307)	(frame '1';   207 bp,   69 residues) 
     1  IDQILETNRI ACRFNHSNQK YAFSITFQEE CAHVTLVVYG RNLHKHFFYW KLHKQLIDLI 
    61  ANPNDMFFF

NCBI Blastp




AGS-2 (12444  12648,12714  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14139)
SCR   (e 0.847  d 0.000 a 0.000,e 0.718  d 0.511 a 0.000,e 0.800  d 0.964 a 0.978,e 0.869  d 0.000 a 1.000,e 0.810  d 0.992 a 0.939,e 0.859  d 0.973 a 0.989,e 0.700)

  Exon  1  12444  12648 ( 205 n); score: 0.847
   Intron  1  12649  12713 (  65 n);           Pd: 0.000  Pa: 0.000
  Exon  2  12714  12823 ( 110 n); score: 0.718
   Intron  2  12824  12920 (  97 n);           Pd: 0.511  Pa: 0.000
  Exon  3  12921  12990 (  70 n); score: 0.800
   Intron  3  12991  13196 ( 206 n);           Pd: 0.964  Pa: 0.978
  Exon  4  13197  13280 (  84 n); score: 0.869
   Intron  4  13281  13380 ( 100 n);           Pd: 0.000  Pa: 1.000
  Exon  5  13381  13467 (  87 n); score: 0.810
   Intron  5  13468  13886 ( 419 n);           Pd: 0.992  Pa: 0.939
  Exon  6  13887  13957 (  71 n); score: 0.859
   Intron  6  13958  14109 ( 152 n);           Pd: 0.973  Pa: 0.989
  Exon  7  14110  14139 (  30 n); score: 0.700

  PGS (12444  12648,12714  12823,12921  12990,13197  13280,13381  13422)	13090650+
  PGS (12464  12648,12714  12823,12921  12990,13197  13280,13381  13467,13887  13957)	12035017+
  PGS (12464  12648,12714  12823,12921  12990,13197  13280,13381  13467)	12035019+
  PGS (12466  12648,12714  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14139)	24328201+
  PGS (12473  12648,12714  12823,12921  12942)	21935116+

3-phase translation of AGS-2 (+strand):

        .         .         .         .         .         .         
 12444  GAAGCGACGAAAACGAAGCAATGAACGAGGCGGTGCAGGAGGCGAAGCTGCTGCGGCAGG
         E  A  T  K  T  K  Q  -  T  R  R  C  R  R  R  S  C  C  G  R 
          K  R  R  K  R  S  N  E  R  G  G  A  G  G  E  A  A  A  A  G 
           S  D  E  N  E  A  M  N  E  A  V  Q  E  A  K  L  L  R  Q 


        .         .         .         .         .         .         
 12504  TGAACGCGCTCATCGTGGCGCACCTCCGTAGCCAGAACCTCGGGCAGGCCGCAGCCGCCG
         -  T  R  S  S  W  R  T  S  V  A  R  T  S  G  R  P  Q  P  P 
          E  R  A  H  R  G  A  P  P  -  P  E  P  R  A  G  R  S  R  R 
        V  N  A  L  I  V  A  H  L  R  S  Q  N  L  G  Q  A  A  A  A 


        .         .         .         .         .         .         
 12564  TCGCCGCCGCCACCATGACCCCCATCTCCGCCGCCGAATCCGTCCCCGCAAATCAACTCC
         S  P  P  P  P  -  P  P  S  P  P  P  N  P  S  P  Q  I  N  S 
          R  R  R  H  H  D  P  H  L  R  R  R  I  R  P  R  K  S  T  P 
        V  A  A  A  T  M  T  P  I  S  A  A  E  S  V  P  A  N  Q  L 


        .         .         .     :      .         .         .         
 12624  TACGTCTCGTGGCCAAGGTCCCCCC : GGTTCGCAGGGCCTCGCGGCGGAGGGCGGAGGAGG
         Y  V  S  W  P  R  S  P   : R  F  A  G  P  R  G  G  G  R  R  R 
          T  S  R  G  Q  G  P  P  :  G  S  Q  G  L  A  A  E  G  G  G  G 
        L  R  L  V  A  K  V  P  P :   V  R  R  A  S  R  R  R  A  E  E 


        .         .         .         .         .         .         
 12749  AGCCGCTTCCGCATTCGACTCCGCCGGGTTCGGTGGGGCGGTGCAGCCGCTCGGCTCCAG
         S  R  F  R  I  R  L  R  R  V  R  W  G  G  A  A  A  R  L  Q 
          A  A  S  A  F  D  S  A  G  F  G  G  A  V  Q  P  L  G  S  S 
        E  P  L  P  H  S  T  P  P  G  S  V  G  R  C  S  R  S  A  P 


        .         .     :      .         .         .         .         
 12809  TGCCGTGGATTTCAG : TATGCAGGATGTCAAGGGCTCATCCAAGAGCTTCCCCAAGCACGA
         C  R  G  F  Q  :  Y  A  G  C  Q  G  L  I  Q  E  L  P  Q  A  R 
          A  V  D  F  S :   M  Q  D  V  K  G  S  S  K  S  F  P  K  H  E 
        V  P  W  I  S   : V  C  R  M  S  R  A  H  P  R  A  S  P  S  T 


        .         .         .     :      .         .         .         
 12966  GGCGAAGCATGTCTCTGACCATAAG : AACGCTGCCCGGTGTGCGAAATTTAGTCCTGATGG
         G  E  A  C  L  -  P  -   : E  R  C  P  V  C  E  I  -  S  -  W 
          A  K  H  V  S  D  H  K  :  N  A  A  R  C  A  K  F  S  P  D  G 
        R  R  S  M  S  L  T  I  R :   T  L  P  G  V  R  N  L  V  L  M 


        .         .         .         .         .         :  .         
 13232  GAAGTATTTTGCAACTGGGAGTGCTGATACATCCATTAAGTTTTTTGAG : GTTGCTAAAAT
         E  V  F  C  N  W  E  C  -  Y  I  H  -  V  F  -   : G  C  -  N 
          K  Y  F  A  T  G  S  A  D  T  S  I  K  F  F  E  :  V  A  K  I 
        G  S  I  L  Q  L  G  V  L  I  H  P  L  S  F  L  R :   L  L  K 


        .         .         .         .         .         .         
 13392  TAAGCAGACTATGGTAGGGGACTCCAAAGATGGTCCTGCCAGGCCTGTGATTCGCACATT
         -  A  D  Y  G  R  G  L  Q  R  W  S  C  Q  A  C  D  S  H  I 
          K  Q  T  M  V  G  D  S  K  D  G  P  A  R  P  V  I  R  T  F 
        L  S  R  L  W  -  G  T  P  K  M  V  L  P  G  L  -  F  A  H 


        .         .      :     .         .         .         .         
 13452  TTATGATCACACACAG : GCCATCAATGATCTGGATTTTCATCCTGAGAGTCCAATACTGAT
         L  -  S  H  T   : G  H  Q  -  S  G  F  S  S  -  E  S  N  T  D 
          Y  D  H  T  Q  :  A  I  N  D  L  D  F  H  P  E  S  P  I  L  I 
        F  M  I  T  H  R :   P  S  M  I  W  I  F  I  L  R  V  Q  Y  - 


        .         .         .       :    .         .         .      
 13931  ATCAGCTGCAAAAGACAATACAATAAA : ATTTTTTGACTTCTCAAAGACCAATGCGAG
         I  S  C  K  R  Q  Y  N  K  :  I  F  -  L  L  K  D  Q  C  E 
          S  A  A  K  D  N  T  I  K :   F  F  D  F  S  K  T  N  A 
        Y  Q  L  Q  K  T  I  Q  -   : N  F  L  T  S  Q  R  P  M  R 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-2_AGS-2_PPS_1 (12535  12648,12714  12823,12921  12990,13197  13280,13381  13467,13887  13957,14110  14137)	(frame '2';   564 bp,  188 residues) 
     1  PEPRAGRSRR RRRHHDPHLR RRIRPRKSTP TSRGQGPPGS QGLAAEGGGG AASAFDSAGF 
    61  GGAVQPLGSS AVDFSMQDVK GSSKSFPKHE AKHVSDHKNA ARCAKFSPDG KYFATGSADT 
   121  SIKFFEVAKI KQTMVGDSKD GPARPVIRTF YDHTQAINDL DFHPESPILI SAAKDNTIKF 
   181  FDFSKTNA

NCBI Blastp




AGS-3 (12473  12650,12718  12823,12921  12990,13197  13295)
SCR   (e 0.843  d 0.000 a 0.000,e 0.689  d 0.511 a 0.000,e 0.757  d 0.964 a 0.978,e 0.828)

  Exon  1  12473  12650 ( 178 n); score: 0.843
   Intron  1  12651  12717 (  67 n);           Pd: 0.000  Pa: 0.000
  Exon  2  12718  12823 ( 106 n); score: 0.689
   Intron  2  12824  12920 (  97 n);           Pd: 0.511  Pa: 0.000
  Exon  3  12921  12990 (  70 n); score: 0.757
   Intron  3  12991  13196 ( 206 n);           Pd: 0.964  Pa: 0.978
  Exon  4  13197  13295 (  99 n); score: 0.828

  PGS (12473  12650,12718  12823,12921  12990,13197  13295)	9661046+

3-phase translation of AGS-3 (+strand):

        .         .         .         .         .         .         
 12473  GCGGTGCAGGAGGCGAAGCTGCTGCGGCAGGTGAACGCGCTCATCGTGGCGCACCTCCGT
         A  V  Q  E  A  K  L  L  R  Q  V  N  A  L  I  V  A  H  L  R 
          R  C  R  R  R  S  C  C  G  R  -  T  R  S  S  W  R  T  S  V 
           G  A  G  G  E  A  A  A  A  G  E  R  A  H  R  G  A  P  P 


        .         .         .         .         .         .         
 12533  AGCCAGAACCTCGGGCAGGCCGCAGCCGCCGTCGCCGCCGCCACCATGACCCCCATCTCC
         S  Q  N  L  G  Q  A  A  A  A  V  A  A  A  T  M  T  P  I  S 
          A  R  T  S  G  R  P  Q  P  P  S  P  P  P  P  -  P  P  S  P 
        -  P  E  P  R  A  G  R  S  R  R  R  R  R  H  H  D  P  H  L 


        .         .         .         .         .         .        :   
 12593  GCCGCCGAATCCGTCCCCGCAAATCAACTCCTACGTCTCGTGGCCAAGGTCCCCCCAC : CG
         A  A  E  S  V  P  A  N  Q  L  L  R  L  V  A  K  V  P  P   : P 
          P  P  N  P  S  P  Q  I  N  S  Y  V  S  W  P  R  S  P  H  :  R 
        R  R  R  I  R  P  R  K  S  T  P  T  S  R  G  Q  G  P  P  T :  


        .         .         .         .         .         .         
 12720  CAGGGCCTCGCGGCGGAGGGCGGAGGAGGAGCCGCTTCCGCATTCGACTCCGCCGGGTTC
         Q  G  L  A  A  E  G  G  G  G  A  A  S  A  F  D  S  A  G  F 
          R  A  S  R  R  R  A  E  E  E  P  L  P  H  S  T  P  P  G  S 
        A  G  P  R  G  G  G  R  R  R  S  R  F  R  I  R  L  R  R  V 


        .         .         .         .         .    :       .         
 12780  GGTGGGGCGGTGCAGCCGCTCGGCTCCAGTGCCGTGGATTTCAG : TATGCAGGATGTCAAG
         G  G  A  V  Q  P  L  G  S  S  A  V  D  F  S :   M  Q  D  V  K 
          V  G  R  C  S  R  S  A  P  V  P  W  I  S   : V  C  R  M  S  R 
        R  W  G  G  A  A  A  R  L  Q  C  R  G  F  Q  :  Y  A  G  C  Q 


        .         .         .         .         .         .    :       
 12937  GGCTCATCCAAGAGCTTCCCCAAGCACGAGGCGAAGCATGTCTCTGACCATAAG : AACGCT
         G  S  S  K  S  F  P  K  H  E  A  K  H  V  S  D  H  K  :  N  A 
          A  H  P  R  A  S  P  S  T  R  R  S  M  S  L  T  I  R :   T  L 
        G  L  I  Q  E  L  P  Q  A  R  G  E  A  C  L  -  P  -   : E  R 


        .         .         .         .         .         .         
 13203  GCCCGGTGTGCGAAATTTAGTCCTGATGGGAAGTATTTTGCAACTGGGAGTGCTGATACA
         A  R  C  A  K  F  S  P  D  G  K  Y  F  A  T  G  S  A  D  T 
          P  G  V  R  N  L  V  L  M  G  S  I  L  Q  L  G  V  L  I  H 
        C  P  V  C  E  I  -  S  -  W  E  V  F  C  N  W  E  C  -  Y 


        .         .         .         .  
 13263  TCCATTAAGTTTTTTGAGGTGAACTTGAAATTT
         S  I  K  F  F  E  V  N  L  K  F 
          P  L  S  F  L  R  -  T  -  N 
        I  H  -  V  F  -  G  E  L  E  I 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-2_AGS-3_PPS_1 (12473  12650,12718  12823,12921  12990,13197  13295)	(frame '1';   453 bp,  151 residues) 
     1  AVQEAKLLRQ VNALIVAHLR SQNLGQAAAA VAAATMTPIS AAESVPANQL LRLVAKVPPP 
    61  QGLAAEGGGG AASAFDSAGF GGAVQPLGSS AVDFSMQDVK GSSKSFPKHE AKHVSDHKNA 
   121  ARCAKFSPDG KYFATGSADT SIKFFEVNLK F

NCBI Blastp




AGS-4 (12473  12642,12704  12823,12921  12990,13197  13262)
SCR   (e 0.853  d 0.000 a 0.000,e 0.558  d 0.511 a 0.000,e 0.757  d 0.964 a 0.978,e 0.848)

  Exon  1  12473  12642 ( 170 n); score: 0.853
   Intron  1  12643  12703 (  61 n);           Pd: 0.000  Pa: 0.000
  Exon  2  12704  12823 ( 120 n); score: 0.558
   Intron  2  12824  12920 (  97 n);           Pd: 0.511  Pa: 0.000
  Exon  3  12921  12990 (  70 n); score: 0.757
   Intron  3  12991  13196 ( 206 n);           Pd: 0.964  Pa: 0.978
  Exon  4  13197  13262 (  66 n); score: 0.848

  PGS (12473  12642,12704  12823,12921  12990,13197  13262)	9359764+

3-phase translation of AGS-4 (+strand):

        .         .         .         .         .         .         
 12473  GCGGTGCAGGAGGCGAAGCTGCTGCGGCAGGTGAACGCGCTCATCGTGGCGCACCTCCGT
         A  V  Q  E  A  K  L  L  R  Q  V  N  A  L  I  V  A  H  L  R 
          R  C  R  R  R  S  C  C  G  R  -  T  R  S  S  W  R  T  S  V 
           G  A  G  G  E  A  A  A  A  G  E  R  A  H  R  G  A  P  P 


        .         .         .         .         .         .         
 12533  AGCCAGAACCTCGGGCAGGCCGCAGCCGCCGTCGCCGCCGCCACCATGACCCCCATCTCC
         S  Q  N  L  G  Q  A  A  A  A  V  A  A  A  T  M  T  P  I  S 
          A  R  T  S  G  R  P  Q  P  P  S  P  P  P  P  -  P  P  S  P 
        -  P  E  P  R  A  G  R  S  R  R  R  R  R  H  H  D  P  H  L 


        .         .         .         .         .          : .         
 12593  GCCGCCGAATCCGTCCCCGCAAATCAACTCCTACGTCTCGTGGCCAAGGT : CCTCACTGTT
         A  A  E  S  V  P  A  N  Q  L  L  R  L  V  A  K  V :   L  T  V 
          P  P  N  P  S  P  Q  I  N  S  Y  V  S  W  P  R   : S  S  L  L 
        R  R  R  I  R  P  R  K  S  T  P  T  S  R  G  Q  G  :  P  H  C 


        .         .         .         .         .         .         
 12714  GGTTCGCAGGGCCTCGCGGCGGAGGGCGGAGGAGGAGCCGCTTCCGCATTCGACTCCGCC
         G  S  Q  G  L  A  A  E  G  G  G  G  A  A  S  A  F  D  S  A 
          V  R  R  A  S  R  R  R  A  E  E  E  P  L  P  H  S  T  P  P 
        W  F  A  G  P  R  G  G  G  R  R  R  S  R  F  R  I  R  L  R 


        .         .         .         .         .          : .         
 12774  GGGTTCGGTGGGGCGGTGCAGCCGCTCGGCTCCAGTGCCGTGGATTTCAG : TATGCAGGAT
         G  F  G  G  A  V  Q  P  L  G  S  S  A  V  D  F  S :   M  Q  D 
          G  S  V  G  R  C  S  R  S  A  P  V  P  W  I  S   : V  C  R  M 
        R  V  R  W  G  G  A  A  A  R  L  Q  C  R  G  F  Q  :  Y  A  G 


        .         .         .         .         .         .          : 
 12931  GTCAAGGGCTCATCCAAGAGCTTCCCCAAGCACGAGGCGAAGCATGTCTCTGACCATAAG : 
         V  K  G  S  S  K  S  F  P  K  H  E  A  K  H  V  S  D  H  K  : 
          S  R  A  H  P  R  A  S  P  S  T  R  R  S  M  S  L  T  I  R :  
        C  Q  G  L  I  Q  E  L  P  Q  A  R  G  E  A  C  L  -  P  -   :


        .         .         .         .         .         .         
 13197  AACGCTGCCCGGTGTGCGAAATTTAGTCCTGATGGGAAGTATTTTGCAACTGGGAGTGCT
         N  A  A  R  C  A  K  F  S  P  D  G  K  Y  F  A  T  G  S  A 
          T  L  P  G  V  R  N  L  V  L  M  G  S  I  L  Q  L  G  V  L 
        E  R  C  P  V  C  E  I  -  S  -  W  E  V  F  C  N  W  E  C 


        .     
 13257  GATACA
         D  T 
          I 
        -  Y 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-2_AGS-4_PPS_1 (12473  12642,12704  12823,12921  12990,13197  13262)	(frame '1';   426 bp,  142 residues) 
     1  AVQEAKLLRQ VNALIVAHLR SQNLGQAAAA VAAATMTPIS AAESVPANQL LRLVAKVLTV 
    61  GSQGLAAEGG GGAASAFDSA GFGGAVQPLG SSAVDFSMQD VKGSSKSFPK HEAKHVSDHK 
   121  NAARCAKFSP DGKYFATGSA DT

NCBI Blastp




AGS-5 (14844  14868,15234  15240,15908  15924,15976  15981,16321  16334,16506  16536,16897  17040)
SCR   (e 0.760  d 0.000 a 0.765,e 0.714  d 0.243 a 0.000,e 0.765  d 0.022 a 0.993,e 0.833  d 0.000 a 0.818,e 0.571  d 0.000 a 0.758,e 0.710  d 0.000 a 0.000,e 0.736)

  Exon  1  14844  14868 (  25 n); score: 0.760
   Intron  1  14869  15233 ( 365 n);           Pd: 0.000  Pa: 0.765
  Exon  2  15234  15240 (   7 n); score: 0.714
   Intron  2  15241  15907 ( 667 n);           Pd: 0.243  Pa: 0.000
  Exon  3  15908  15924 (  17 n); score: 0.765
   Intron  3  15925  15975 (  51 n);           Pd: 0.022  Pa: 0.993
  Exon  4  15976  15981 (   6 n); score: 0.833
   Intron  4  15982  16320 ( 339 n);           Pd: 0.000  Pa: 0.818
  Exon  5  16321  16334 (  14 n); score: 0.571
   Intron  5  16335  16505 ( 171 n);           Pd: 0.000  Pa: 0.758
  Exon  6  16506  16536 (  31 n); score: 0.710
   Intron  6  16537  16896 ( 360 n);           Pd: 0.000  Pa: 0.000
  Exon  7  16897  17040 ( 144 n); score: 0.736

  PGS (14844  14868,15234  15240,15908  15924,15976  15981,16321  16334,16506  16536,16897  17040)	14571087+

3-phase translation of AGS-5 (+strand):

        .         .         .     :      .  :         .         :  .     :      
 14844  TTCTCCGCCAGCCATGCTTACTGAT : ACGTGTC : ATTCCAAATTGAGAACA : GTTGTC : CTGAT
         F  S  A  S  H  A  Y  -   : Y  V  S :   F  Q  I  E  N   : S  C   : P  D 
          S  P  P  A  M  L  T  D  :  T  C   : H  S  K  L  R  T  :  V  V  :  L  M 
           L  R  Q  P  C  L  L  I :   R  V  :  I  P  N  -  E  Q :   L  S :   - 


        .         :  .         .         .          : .         .         
 16326  GACAGTTGT : GGCATGTTTAGATTGAAGATGAAAATTTTTT : TTTTTGGTTTTTGAGACTGT
         D  S  C  :  G  M  F  R  L  K  M  K  I  F   : F  F  G  F  -  D  C 
          T  V  V :   A  C  L  D  -  R  -  K  F  F  :  F  L  V  F  E  T  V 
        -  Q  L   : W  H  V  -  I  E  D  E  N  F  F :   F  W  F  L  R  L 


        .         .         .         .         .         .         
 16917  AGCACTTTCGTTTTTATTTGACAAATATTGTCTAATCATAGAGTAACTAGGTTTAAAAGA
         S  T  F  V  F  I  -  Q  I  L  S  N  H  R  V  T  R  F  K  R 
          A  L  S  F  L  F  D  K  Y  C  L  I  I  E  -  L  G  L  K  D 
        -  H  F  R  F  Y  L  T  N  I  V  -  S  -  S  N  -  V  -  K 


        .         .         .         .         .         .         
 16977  TTTATCTCGCGATTTATAGGTAAACTGTGCAATTAGTTTTTATTTTTGTATATATTTAAT
         F  I  S  R  F  I  G  K  L  C  N  -  F  L  F  L  Y  I  F  N 
          L  S  R  D  L  -  V  N  C  A  I  S  F  Y  F  C  I  Y  L  M 
        I  Y  L  A  I  Y  R  -  T  V  Q  L  V  F  I  F  V  Y  I  - 


        .   
 17037  GCTT
         A 
          L 
        C 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-6 (14855  14879,15884  15903,16875  16970)
SCR   (e 0.720  d 0.978 a 0.361,e 0.500  d 0.991 a 0.000,e 0.833)

  Exon  1  14855  14879 (  25 n); score: 0.720
   Intron  1  14880  15883 (1004 n);           Pd: 0.978  Pa: 0.361
  Exon  2  15884  15903 (  20 n); score: 0.500
   Intron  2  15904  16874 ( 971 n);           Pd: 0.991  Pa: 0.000
  Exon  3  16875  16970 (  96 n); score: 0.833

  PGS (14855  14879,15884  15903,16875  16970)	13469214+

3-phase translation of AGS-6 (+strand):

        .         .         .     :      .         .     :      .         
 14855  CCATGCTTACTGATGTTGCTGCCAG : TTGATGAACAAAACAATGAG : GGCCTTGTTTAGTTT
         P  C  L  L  M  L  L  P   : V  D  E  Q  N  N  E  :  G  L  V  -  F 
          H  A  Y  -  C  C  C  Q  :  L  M  N  K  T  M  R :   A  L  F  S  F 
           M  L  T  D  V  A  A  S :   -  -  T  K  Q  -   : G  P  C  L  V 


        .         .         .         .         .         .         
 16890  CGAAAACTTTTTGGTTTTTGAGACTGTAGCACTTTCGTTTTTATTTGACAAATATTGTCT
         R  K  L  F  G  F  -  D  C  S  T  F  V  F  I  -  Q  I  L  S 
          E  N  F  L  V  F  E  T  V  A  L  S  F  L  F  D  K  Y  C  L 
        S  K  T  F  W  F  L  R  L  -  H  F  R  F  Y  L  T  N  I  V 


        .         .         .
 16950  AATCATAGAGTAACTAGGTTT
         N  H  R  V  T  R  F 
          I  I  E  -  L  G 
        -  S  -  S  N  -  V 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-7 (16506  16747,17005  17091)
SCR   (e 0.769  d 0.780 a 0.000,e 0.774)

  Exon  1  16506  16747 ( 242 n); score: 0.769
   Intron  1  16748  17004 ( 257 n);           Pd: 0.780  Pa: 0.000
  Exon  2  17005  17091 (  87 n); score: 0.774

  PGS (16506  16747,17005  17091)	7218093-
  PGS (16539  16747,17005  17066)	27548386+

3-phase translation of AGS-7 (+strand):

        .         .         .         .         .         .         
 16506  GGCATGTTTAGATTGAAGATGAAAATTTTTTAGGTCACATCGGATATGTCGGAAGGATGT
         G  M  F  R  L  K  M  K  I  F  -  V  T  S  D  M  S  E  G  C 
          A  C  L  D  -  R  -  K  F  F  R  S  H  R  I  C  R  K  D  V 
           H  V  -  I  E  D  E  N  F  L  G  H  I  G  Y  V  G  R  M 


        .         .         .         .         .         .         
 16566  CGGGAGGGGTTTTTAAAAACTAATAAAAAAAACAAATTACATAACTCGTCAGGAAACTGC
         R  E  G  F  L  K  T  N  K  K  N  K  L  H  N  S  S  G  N  C 
          G  R  G  F  -  K  L  I  K  K  T  N  Y  I  T  R  Q  E  T  A 
        S  G  G  V  F  K  N  -  -  K  K  Q  I  T  -  L  V  R  K  L 


        .         .         .         .         .         .         
 16626  AAGACGAATCTATTAAGTATAATTAATCTATTATTAGCACATGTGGGTTACTGTAGCACT
         K  T  N  L  L  S  I  I  N  L  L  L  A  H  V  G  Y  C  S  T 
          R  R  I  Y  -  V  -  L  I  Y  Y  -  H  M  W  V  T  V  A  L 
        Q  D  E  S  I  K  Y  N  -  S  I  I  S  T  C  G  L  L  -  H 


        .         .         .         .         .         .         
 16686  TAAGGCTAATCATGGACTAACTAGGCTTAAAAAATTCATCTCGCGATTTTCAACCAAACT
         -  G  -  S  W  T  N  -  A  -  K  I  H  L  A  I  F  N  Q  T 
          K  A  N  H  G  L  T  R  L  K  K  F  I  S  R  F  S  T  K  L 
        L  R  L  I  M  D  -  L  G  L  K  N  S  S  R  D  F  Q  P  N 


        .  :         .         .         .         .         .         
 16746  GT : GCAATTAGTTTTTATTTTTGTATATATTTAATGCTTCATGCATGTGTCGTAATATTTG
         V :   Q  L  V  F  I  F  V  Y  I  -  C  F  M  H  V  S  -  Y  L 
           : C  N  -  F  L  F  L  Y  I  F  N  A  S  C  M  C  R  N  I  - 
        C  :  A  I  S  F  Y  F  C  I  Y  L  M  L  H  A  C  V  V  I  F 


        .         .         .        
 17063  ATGTGTTGAGAAATTTTGAAAAGTTTTTG
         M  C  -  E  I  L  K  S  F 
          C  V  E  K  F  -  K  V  F 
        D  V  L  R  N  F  E  K  F  L 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-8 (16629  16679,16939  17036)
SCR   (e 0.745  d 0.000 a 0.000,e 0.724)

  Exon  1  16629  16679 (  51 n); score: 0.745
   Intron  1  16680  16938 ( 259 n);           Pd: 0.000  Pa: 0.000
  Exon  2  16939  17036 (  98 n); score: 0.724

  PGS (16629  16679,16939  17036)	15856082-

3-phase translation of AGS-8 (+strand):

        .         .         .         .         .         . :          
 16629  ACGAATCTATTAAGTATAATTAATCTATTATTAGCACATGTGGGTTACTGT : AAATATTGT
         T  N  L  L  S  I  I  N  L  L  L  A  H  V  G  Y  C  :  K  Y  C 
          R  I  Y  -  V  -  L  I  Y  Y  -  H  M  W  V  T  V :   N  I  V 
           E  S  I  K  Y  N  -  S  I  I  S  T  C  G  L  L   : -  I  L 


        .         .         .         .         .         .         
 16948  CTAATCATAGAGTAACTAGGTTTAAAAGATTTATCTCGCGATTTATAGGTAAACTGTGCA
         L  I  I  E  -  L  G  L  K  D  L  S  R  D  L  -  V  N  C  A 
          -  S  -  S  N  -  V  -  K  I  Y  L  A  I  Y  R  -  T  V  Q 
        S  N  H  R  V  T  R  F  K  R  F  I  S  R  F  I  G  K  L  C 


        .         .         .        
 17008  ATTAGTTTTTATTTTTGTATATATTTAAT
         I  S  F  Y  F  C  I  Y  L 
          L  V  F  I  F  V  Y  I  - 
        N  -  F  L  F  L  Y  I  F  N 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-9 (16586  16685,16941  17066)
SCR   (e 0.770  d 0.000 a 0.000,e 0.762)

  Exon  1  16586  16685 ( 100 n); score: 0.770
   Intron  1  16686  16940 ( 255 n);           Pd: 0.000  Pa: 0.000
  Exon  2  16941  17066 ( 126 n); score: 0.762

  PGS (16586  16685,16941  17066)	12622939-

3-phase translation of AGS-9 (+strand):

        .         .         .         .         .         .         
 16586  TAATAAAAAAAACAAATTACATAACTCGTCAGGAAACTGCAAGACGAATCTATTAAGTAT
         -  -  K  K  Q  I  T  -  L  V  R  K  L  Q  D  E  S  I  K  Y 
          N  K  K  N  K  L  H  N  S  S  G  N  C  K  T  N  L  L  S  I 
           I  K  K  T  N  Y  I  T  R  Q  E  T  A  R  R  I  Y  -  V 


        .         .         .         .          : .         .         
 16646  AATTAATCTATTATTAGCACATGTGGGTTACTGTAGCACT : ATATTGTCTAATCATAGAGT
         N  -  S  I  I  S  T  C  G  L  L  -  H   : Y  I  V  -  S  -  S 
          I  N  L  L  L  A  H  V  G  Y  C  S  T  :  I  L  S  N  H  R  V 
        -  L  I  Y  Y  -  H  M  W  V  T  V  A  L :   Y  C  L  I  I  E 


        .         .         .         .         .         .         
 16961  AACTAGGTTTAAAAGATTTATCTCGCGATTTATAGGTAAACTGTGCAATTAGTTTTTATT
         N  -  V  -  K  I  Y  L  A  I  Y  R  -  T  V  Q  L  V  F  I 
          T  R  F  K  R  F  I  S  R  F  I  G  K  L  C  N  -  F  L  F 
        -  L  G  L  K  D  L  S  R  D  L  -  V  N  C  A  I  S  F  Y 


        .         .         .         .         .     
 17021  TTTGTATATATTTAATGCTTCATGCATGTGTCGTAATATTTGATGT
         F  V  Y  I  -  C  F  M  H  V  S  -  Y  L  M 
          L  Y  I  F  N  A  S  C  M  C  R  N  I  -  C 
        F  C  I  Y  L  M  L  H  A  C  V  V  I  F  D 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-10 (17372  17665)
SCR   (e 0.745)

  Exon  1  17372  17665 ( 294 n); score: 0.745

  PGS (17372  17665)	25451626+

3-phase translation of AGS-10 (+strand):

        .         .         .         .         .         .         
 17372  GCCATGGCTTTCTCCCCGCGCTCGCCGTGGTCGCGTCCCAAGAGAAACGACGTCTACTCA
         A  M  A  F  S  P  R  S  P  W  S  R  P  K  R  N  D  V  Y  S 
          P  W  L  S  P  R  A  R  R  G  R  V  P  R  E  T  T  S  T  Q 
           H  G  F  L  P  A  L  A  V  V  A  S  Q  E  K  R  R  L  L 


        .         .         .         .         .         .         
 17432  ACCTTCGTCGTCCACGGCGATGACGACGAGGACGACGCCCGCGGCAGCAGGCGCGGCAGG
         T  F  V  V  H  G  D  D  D  E  D  D  A  R  G  S  R  R  G  R 
          P  S  S  S  T  A  M  T  T  R  T  T  P  A  A  A  G  A  A  G 
        N  L  R  R  P  R  R  -  R  R  G  R  R  P  R  Q  Q  A  R  Q 


        .         .         .         .         .         .         
 17492  GGCCCGTCCACGCGGGCGGAGGAAGACGAGGAGGAAGACCCCTCCTCGCTGCCTCCGCTT
         G  P  S  T  R  A  E  E  D  E  E  E  D  P  S  S  L  P  P  L 
          A  R  P  R  G  R  R  K  T  R  R  K  T  P  P  R  C  L  R  F 
        G  P  V  H  A  G  G  G  R  R  G  G  R  P  L  L  A  A  S  A 


        .         .         .         .         .         .         
 17552  CTCCAGCGGCTCCCCAAGGACTTCGGCGGCCCCTCCTTTGACGAAGACGAGGACGCCTAC
         L  Q  R  L  P  K  D  F  G  G  P  S  F  D  E  D  E  D  A  Y 
          S  S  G  S  P  R  T  S  A  A  P  P  L  T  K  T  R  T  P  T 
        S  P  A  A  P  Q  G  L  R  R  P  L  L  -  R  R  R  G  R  L 


        .         .         .         .         .         .   
 17612  TCCTCCGACCCCGACGATGCTTCCCTCTCCGCTACGGTGGTCTTCAAGAGCGGC
         S  S  D  P  D  D  A  S  L  S  A  T  V  V  F  K  S  G 
          P  P  T  P  T  M  L  P  S  P  L  R  W  S  S  R  A 
        L  L  R  P  R  R  C  F  P  L  R  Y  G  G  L  Q  E  R 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-2_AGS-10_PPS_1 (17372  17665)	(frame '1';   294 bp,   98 residues) 
     1  AMAFSPRSPW SRPKRNDVYS TFVVHGDDDE DDARGSRRGR GPSTRAEEDE EEDPSSLPPL 
    61  LQRLPKDFGG PSFDEDEDAY SSDPDDASLS ATVVFKSG

NCBI Blastp


>21326110+_PGL-2_AGS-10_PPS_2 (17373  17663)	(frame '2';   291 bp,   97 residues) 
     1  PWLSPRARRG RVPRETTSTQ PSSSTAMTTR TTPAAAGAAG ARPRGRRKTR RKTPPRCLRF 
    61  SSGSPRTSAA PPLTKTRTPT PPTPTMLPSP LRWSSRA

NCBI Blastp

3-phase translation of AGS-10 (-strand):

        .         .         .         .         .         .         
 17665  GCCGCTCTTGAAGACCACCGTAGCGGAGAGGGAAGCATCGTCGGGGTCGGAGGAGTAGGC
         A  A  L  E  D  H  R  S  G  E  G  S  I  V  G  V  G  G  V  G 
          P  L  L  K  T  T  V  A  E  R  E  A  S  S  G  S  E  E  -  A 
           R  S  -  R  P  P  -  R  R  G  K  H  R  R  G  R  R  S  R 


        .         .         .         .         .         .         
 17605  GTCCTCGTCTTCGTCAAAGGAGGGGCCGCCGAAGTCCTTGGGGAGCCGCTGGAGAAGCGG
         V  L  V  F  V  K  G  G  A  A  E  V  L  G  E  P  L  E  K  R 
          S  S  S  S  S  K  E  G  P  P  K  S  L  G  S  R  W  R  S  G 
        R  P  R  L  R  Q  R  R  G  R  R  S  P  W  G  A  A  G  E  A 


        .         .         .         .         .         .         
 17545  AGGCAGCGAGGAGGGGTCTTCCTCCTCGTCTTCCTCCGCCCGCGTGGACGGGCCCCTGCC
         R  Q  R  G  G  V  F  L  L  V  F  L  R  P  R  G  R  A  P  A 
          G  S  E  E  G  S  S  S  S  S  S  S  A  R  V  D  G  P  L  P 
        E  A  A  R  R  G  L  P  P  R  L  P  P  P  A  W  T  G  P  C 


        .         .         .         .         .         .         
 17485  GCGCCTGCTGCCGCGGGCGTCGTCCTCGTCGTCATCGCCGTGGACGACGAAGGTTGAGTA
         A  P  A  A  A  G  V  V  L  V  V  I  A  V  D  D  E  G  -  V 
          R  L  L  P  R  A  S  S  S  S  S  S  P  W  T  T  K  V  E  - 
        R  A  C  C  R  G  R  R  P  R  R  H  R  R  G  R  R  R  L  S 


        .         .         .         .         .         .   
 17425  GACGTCGTTTCTCTTGGGACGCGACCACGGCGAGCGCGGGGAGAAAGCCATGGC
         D  V  V  S  L  G  T  R  P  R  R  A  R  G  E  S  H  G 
          T  S  F  L  L  G  R  D  H  G  E  R  G  E  K  A  M 
        R  R  R  F  S  W  D  A  T  T  A  S  A  G  R  K  P  W 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110-_PGL-2_AGS-10_PPS_1 (17642  17373)	(frame '0';   270 bp,   90 residues) 
     1  RRGKHRRGRR SRRPRLRQRR GRRSPWGAAG EAEAARRGLP PRLPPPAWTG PCRACCRGRR 
    61  PRRHRRGRRR LSRRRFSWDA TTASAGRKPW

NCBI Blastp





PGL   3 (- strand):	 17104   15201


AGS-1 (17104  16939,16683  16583,16477  16452,15876  15865,15706  15680,15646  15628,15222  15201)
SCR   (e 0.820  d 0.000 a 0.000,e 0.782  d 0.000 a 0.593,e 0.692  d 0.000 a 0.884,e 0.583  d 0.000 a 0.000,e 0.741  d 0.000 a 0.334,e 0.789  d 0.000 a 0.033,e 0.818)

  Exon  1  17104  16939 ( 166 n); score: 0.820
   Intron  1  16938  16684 ( 255 n);           Pd: 0.000  Pa: 0.000
  Exon  2  16683  16583 ( 101 n); score: 0.782
   Intron  2  16582  16478 ( 105 n);           Pd: 0.000  Pa: 0.593
  Exon  3  16477  16452 (  26 n); score: 0.692
   Intron  3  16451  15877 ( 575 n);           Pd: 0.000  Pa: 0.884
  Exon  4  15876  15865 (  12 n); score: 0.583
   Intron  4  15864  15707 ( 158 n);           Pd: 0.000  Pa: 0.000
  Exon  5  15706  15680 (  27 n); score: 0.741
   Intron  5  15679  15647 (  33 n);           Pd: 0.000  Pa: 0.334
  Exon  6  15646  15628 (  19 n); score: 0.789
   Intron  6  15627  15223 ( 405 n);           Pd: 0.000  Pa: 0.033
  Exon  7  15222  15201 (  22 n); score: 0.818

  PGS (17066  16939,16683  16583,16477  16452,15876  15865,15706  15680,15646  15628,15222  15201)	25807618+
  PGS (17091  16914)	6859140-
  PGS (17091  16914)	6859177-
  PGS (17091  16914)	24978904+
  PGS (17084  16914)	6675384-
  PGS (17046  16914)	6859195-
  PGS (17091  16916)	8548455+
  PGS (17104  16974)	11679374+
  PGS (17104  16994)	14514413+

3-phase translation of AGS-1 (-strand):

        .         .         .         .         .         .         
 17104  TCACCCCAAAAACCAAAAACTTTTCAAAATTTCTCAACACATCAAATATTACGACACATG
         S  P  Q  K  P  K  T  F  Q  N  F  S  T  H  Q  I  L  R  H  M 
          H  P  K  N  Q  K  L  F  K  I  S  Q  H  I  K  Y  Y  D  T  C 
           T  P  K  T  K  N  F  S  K  F  L  N  T  S  N  I  T  T  H 


        .         .         .         .         .         .         
 17044  CATGAAGCATTAAATATATACAAAAATAAAAACTAATTGCACAGTTTACCTATAAATCGC
         H  E  A  L  N  I  Y  K  N  K  N  -  L  H  S  L  P  I  N  R 
          M  K  H  -  I  Y  T  K  I  K  T  N  C  T  V  Y  L  -  I  A 
        A  -  S  I  K  Y  I  Q  K  -  K  L  I  A  Q  F  T  Y  K  S 


        .         .         .         .         .      :     .         
 16984  GAGATAAATCTTTTAAACCTAGTTACTCTATGATTAGACAATATTT : TGCTACAGTAACCC
         E  I  N  L  L  N  L  V  T  L  -  L  D  N  I   : L  L  Q  -  P 
          R  -  I  F  -  T  -  L  L  Y  D  -  T  I  F  :  C  Y  S  N  P 
        R  D  K  S  F  K  P  S  Y  S  M  I  R  Q  Y  F :   A  T  V  T 


        .         .         .         .         .         .         
 16669  ACATGTGCTAATAATAGATTAATTATACTTAATAGATTCGTCTTGCAGTTTCCTGACGAG
         T  C  A  N  N  R  L  I  I  L  N  R  F  V  L  Q  F  P  D  E 
          H  V  L  I  I  D  -  L  Y  L  I  D  S  S  C  S  F  L  T  S 
        H  M  C  -  -  -  I  N  Y  T  -  -  I  R  L  A  V  S  -  R 


        .         .         .       :    .         .         .   :        
 16609  TTATGTAATTTGTTTTTTTTATTAGTT : AACTTTTATAGGCTATCACACATGTG : AACAAAT
         L  C  N  L  F  F  L  L  V  :  N  F  Y  R  L  S  H  M  - :   T  N 
          Y  V  I  C  F  F  Y  -  L :   T  F  I  G  Y  H  T  C   : E  Q  I 
        V  M  -  F  V  F  F  I  S   : -  L  L  -  A  I  T  H  V  :  N  K 


        .     :      .         .         .  :         .         . :          
 15869  TCTTC : AAAAATAATATATATGGCACACGAGTA : AAACACAGAGAAACTAACC : GAAATTATC
         S  S :   K  I  I  Y  M  A  H  E  - :   N  T  E  K  L  T  :  E  I  I 
          L   : Q  K  -  Y  I  W  H  T  S   : K  T  Q  R  N  -  P :   K  L  S 
        F  F  :  K  N  N  I  Y  G  T  R  V  :  K  H  R  E  T  N   : R  N  Y 


        .         .  
 15213  CAGGACATGTTAT
         Q  D  M  L 
          R  T  C  Y 
        P  G  H  V 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-2 (17104  16890,16363  16341)
SCR   (e 0.804  d 0.000 a 0.000,e 0.739)

  Exon  1  17104  16890 ( 215 n); score: 0.804
   Intron  1  16889  16364 ( 526 n);           Pd: 0.000  Pa: 0.000
  Exon  2  16363  16341 (  23 n); score: 0.739

  PGS (17023  16890,16363  16341)	9307163-
  PGS (17091  16867)	7553385-
  PGS (17078  16867)	13587489-
  PGS (16972  16867)	18052346-
  PGS (16966  16871)	7554466-
  PGS (17097  16874)	18066500-
  PGS (17093  16874)	20549510-
  PGS (17085  16874)	20548647-
  PGS (17066  16874)	8548754-
  PGS (17024  16874)	6672435-
  PGS (16970  16874)	6673765-
  PGS (17064  16875)	14514528-
  PGS (17056  16876)	11996680-
  PGS (17091  16878)	9301429+
  PGS (17091  16883)	9299558-
  PGS (17091  16887)	11552500-
  PGS (17091  16887)	11552512-
  PGS (17104  16888)	8088762-
  PGS (17064  16897)	12617906-
  PGS (17024  16910)	6673837-
  PGS (17041  16912)	12501667-

3-phase translation of AGS-2 (-strand):

        .         .         .         .         .         .         
 17104  TCACCCCAAAAACCAAAAACTTTTCAAAATTTCTCAACACATCAAATATTACGACACATG
         S  P  Q  K  P  K  T  F  Q  N  F  S  T  H  Q  I  L  R  H  M 
          H  P  K  N  Q  K  L  F  K  I  S  Q  H  I  K  Y  Y  D  T  C 
           T  P  K  T  K  N  F  S  K  F  L  N  T  S  N  I  T  T  H 


        .         .         .         .         .         .         
 17044  CATGAAGCATTAAATATATACAAAAATAAAAACTAATTGCACAGTTTACCTATAAATCGC
         H  E  A  L  N  I  Y  K  N  K  N  -  L  H  S  L  P  I  N  R 
          M  K  H  -  I  Y  T  K  I  K  T  N  C  T  V  Y  L  -  I  A 
        A  -  S  I  K  Y  I  Q  K  -  K  L  I  A  Q  F  T  Y  K  S 


        .         .         .         .         .         .         
 16984  GAGATAAATCTTTTAAACCTAGTTACTCTATGATTAGACAATATTTGTCAAATAAAAACG
         E  I  N  L  L  N  L  V  T  L  -  L  D  N  I  C  Q  I  K  T 
          R  -  I  F  -  T  -  L  L  Y  D  -  T  I  F  V  K  -  K  R 
        R  D  K  S  F  K  P  S  Y  S  M  I  R  Q  Y  L  S  N  K  N 


        .         .         .         .     :      .         .       
 16924  AAAGTGCTACAGTCTCAAAAACCAAAAAGTTTTCG : GACCAATAAGAATCAGGTCAAGG
         K  V  L  Q  S  Q  K  P  K  S  F  R :   T  N  K  N  Q  V  K 
          K  C  Y  S  L  K  N  Q  K  V  F   : G  P  I  R  I  R  S  R 
        E  S  A  T  V  S  K  T  K  K  F  S  :  D  Q  -  E  S  G  Q 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-3 (16223  16066)
SCR   (e 0.968)

  Exon  1  16223  16066 ( 158 n); score: 0.968

  PGS (16223  16066)	13586922-

3-phase translation of AGS-3 (-strand):

        .         .         .         .         .         .         
 16223  TCTCCCATATACAACTAAAGTTACATGAGCACATTCCTCCTGAAACGTAATACTGAAAGC
         S  P  I  Y  N  -  S  Y  M  S  T  F  L  L  K  R  N  T  E  S 
          L  P  Y  T  T  K  V  T  -  A  H  S  S  -  N  V  I  L  K  A 
           S  H  I  Q  L  K  L  H  E  H  I  P  P  E  T  -  Y  -  K 


        .         .         .         .         .         .         
 16163  ATACTTTTGATTTGAATGGTTGAATCTACAAGCTATACGGTTTGTTTCCAGAATCTGATC
         I  L  L  I  -  M  V  E  S  T  S  Y  T  V  C  F  Q  N  L  I 
          Y  F  -  F  E  W  L  N  L  Q  A  I  R  F  V  S  R  I  -  S 
        H  T  F  D  L  N  G  -  I  Y  K  L  Y  G  L  F  P  E  S  D 


        .         .         .         .       
 16103  GATCTATCATTTCCACAAATAACAAAAACTGGTTCAAC
         D  L  S  F  P  Q  I  T  K  T  G  S 
          I  Y  H  F  H  K  -  Q  K  L  V  Q 
        R  S  I  I  S  T  N  N  K  N  W  F  N 


Maximal non-overlapping open reading frames (>= 64 codons):
none


3-phase translation of AGS-3 (+strand):

        .         .         .         .         .         .         
 16066  GTTGAACCAGTTTTTGTTATTTGTGGAAATGATAGATCGATCAGATTCTGGAAACAAACC
         V  E  P  V  F  V  I  C  G  N  D  R  S  I  R  F  W  K  Q  T 
          L  N  Q  F  L  L  F  V  E  M  I  D  R  S  D  S  G  N  K  P 
           -  T  S  F  C  Y  L  W  K  -  -  I  D  Q  I  L  E  T  N 


        .         .         .         .         .         .         
 16126  GTATAGCTTGTAGATTCAACCATTCAAATCAAAAGTATGCTTTCAGTATTACGTTTCAGG
         V  -  L  V  D  S  T  I  Q  I  K  S  M  L  S  V  L  R  F  R 
          Y  S  L  -  I  Q  P  F  K  S  K  V  C  F  Q  Y  Y  V  S  G 
        R  I  A  C  R  F  N  H  S  N  Q  K  Y  A  F  S  I  T  F  Q 


        .         .         .         .       
 16186  AGGAATGTGCTCATGTAACTTTAGTTGTATATGGGAGA
         R  N  V  L  M  -  L  -  L  Y  M  G 
          G  M  C  S  C  N  F  S  C  I  W  E 
        E  E  C  A  H  V  T  L  V  V  Y  G  R 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-4 (17104  16878,16584  16544)
SCR   (e 0.802  d 0.000 a 0.795,e 0.512)

  Exon  1  17104  16878 ( 227 n); score: 0.802
   Intron  1  16877  16585 ( 293 n);           Pd: 0.000  Pa: 0.795
  Exon  2  16584  16544 (  41 n); score: 0.512

  PGS (17104  16878,16584  16544)	18065753+
  PGS (16981  16863)	11680489+

3-phase translation of AGS-4 (-strand):

        .         .         .         .         .         .         
 17104  TCACCCCAAAAACCAAAAACTTTTCAAAATTTCTCAACACATCAAATATTACGACACATG
         S  P  Q  K  P  K  T  F  Q  N  F  S  T  H  Q  I  L  R  H  M 
          H  P  K  N  Q  K  L  F  K  I  S  Q  H  I  K  Y  Y  D  T  C 
           T  P  K  T  K  N  F  S  K  F  L  N  T  S  N  I  T  T  H 


        .         .         .         .         .         .         
 17044  CATGAAGCATTAAATATATACAAAAATAAAAACTAATTGCACAGTTTACCTATAAATCGC
         H  E  A  L  N  I  Y  K  N  K  N  -  L  H  S  L  P  I  N  R 
          M  K  H  -  I  Y  T  K  I  K  T  N  C  T  V  Y  L  -  I  A 
        A  -  S  I  K  Y  I  Q  K  -  K  L  I  A  Q  F  T  Y  K  S 


        .         .         .         .         .         .         
 16984  GAGATAAATCTTTTAAACCTAGTTACTCTATGATTAGACAATATTTGTCAAATAAAAACG
         E  I  N  L  L  N  L  V  T  L  -  L  D  N  I  C  Q  I  K  T 
          R  -  I  F  -  T  -  L  L  Y  D  -  T  I  F  V  K  -  K  R 
        R  D  K  S  F  K  P  S  Y  S  M  I  R  Q  Y  L  S  N  K  N 


        .         .         .         .         .       :    .         
 16924  AAAGTGCTACAGTCTCAAAAACCAAAAAGTTTTCGAAACTAAACAAG : TTTTTAAAAACCC
         K  V  L  Q  S  Q  K  P  K  S  F  R  N  -  T  S :   F  -  K  P 
          K  C  Y  S  L  K  N  Q  K  V  F  E  T  K  Q   : V  F  K  N  P 
        E  S  A  T  V  S  K  T  K  K  F  S  K  L  N  K  :  F  L  K  T 


        .         .         .       
 16571  CTCCCGACATCCTTCCGACATATCCGAT
         L  P  T  S  F  R  H  I  R 
          S  R  H  P  S  D  I  S  D 
        P  P  D  I  L  P  T  Y  P 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-5 (17065  17000,16743  16502)
SCR   (e 0.879  d 0.000 a 0.088,e 0.770)

  Exon  1  17065  17000 (  66 n); score: 0.879
   Intron  1  16999  16744 ( 256 n);           Pd: 0.000  Pa: 0.088
  Exon  2  16743  16502 ( 242 n); score: 0.770

  PGS (17065  17000,16743  16544)	25805124+
  PGS (16637  16502)	13152848-
  PGS (16710  16506)	6859196-
  PGS (16762  16582)	16578696-
  PGS (16743  16597)	18388584+

3-phase translation of AGS-5 (-strand):

        .         .         .         .         .         .         
 17065  CATCAAATATTACGACACATGCATGAAGCATTAAATATATACAAAAATAAAAACTAATTG
         H  Q  I  L  R  H  M  H  E  A  L  N  I  Y  K  N  K  N  -  L 
          I  K  Y  Y  D  T  C  M  K  H  -  I  Y  T  K  I  K  T  N  C 
           S  N  I  T  T  H  A  -  S  I  K  Y  I  Q  K  -  K  L  I 


        .      :     .         .         .         .         .         
 17005  CACAGT : TTTGGTTGAAAATCGCGAGATGAATTTTTTAAGCCTAGTTAGTCCATGATTAGC
         H  S  :  F  G  -  K  S  R  D  E  F  F  K  P  S  -  S  M  I  S 
          T  V :   L  V  E  N  R  E  M  N  F  L  S  L  V  S  P  -  L  A 
        A  Q   : F  W  L  K  I  A  R  -  I  F  -  A  -  L  V  H  D  - 


        .         .         .         .         .         .         
 16689  CTTAAGTGCTACAGTAACCCACATGTGCTAATAATAGATTAATTATACTTAATAGATTCG
         L  K  C  Y  S  N  P  H  V  L  I  I  D  -  L  Y  L  I  D  S 
          L  S  A  T  V  T  H  M  C  -  -  -  I  N  Y  T  -  -  I  R 
        P  -  V  L  Q  -  P  T  C  A  N  N  R  L  I  I  L  N  R  F 


        .         .         .         .         .         .         
 16629  TCTTGCAGTTTCCTGACGAGTTATGTAATTTGTTTTTTTTATTAGTTTTTAAAAACCCCT
         S  C  S  F  L  T  S  Y  V  I  C  F  F  Y  -  F  L  K  T  P 
          L  A  V  S  -  R  V  M  -  F  V  F  F  I  S  F  -  K  P  L 
        V  L  Q  F  P  D  E  L  C  N  L  F  F  L  L  V  F  K  N  P 


        .         .         .         .         .         .         
 16569  CCCGACATCCTTCCGACATATCCGATGTGACCTAAAAAATTTTCATCTTCAATCTAAACA
         P  D  I  L  P  T  Y  P  M  -  P  K  K  F  S  S  S  I  -  T 
          P  T  S  F  R  H  I  R  C  D  L  K  N  F  H  L  Q  S  K  H 
        S  R  H  P  S  D  I  S  D  V  T  -  K  I  F  I  F  N  L  N 


        .       
 16509  TGCCCTAA
         C  P 
          A  L 
        M  P  - 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-6 (17037  16939,16679  16626)
SCR   (e 0.717  d 0.000 a 0.000,e 0.759)

  Exon  1  17037  16939 (  99 n); score: 0.717
   Intron  1  16938  16680 ( 259 n);           Pd: 0.000  Pa: 0.000
  Exon  2  16679  16626 (  54 n); score: 0.759

  PGS (17037  16939,16679  16626)	15856972+

3-phase translation of AGS-6 (-strand):

        .         .         .         .         .         .         
 17037  CATTAAATATATACAAAAATAAAAACTAATTGCACAGTTTACCTATAAATCGCGAGATAA
         H  -  I  Y  T  K  I  K  T  N  C  T  V  Y  L  -  I  A  R  - 
          I  K  Y  I  Q  K  -  K  L  I  A  Q  F  T  Y  K  S  R  D  K 
           L  N  I  Y  K  N  K  N  -  L  H  S  L  P  I  N  R  E  I 


        .         .         .         .         :  .         .         
 16977  ATCTTTTAAACCTAGTTACTCTATGATTAGACAATATTT : ACAGTAACCCACATGTGCTAA
         I  F  -  T  -  L  L  Y  D  -  T  I  F  :  T  V  T  H  M  C  - 
          S  F  K  P  S  Y  S  M  I  R  Q  Y  L :   Q  -  P  T  C  A  N 
        N  L  L  N  L  V  T  L  -  L  D  N  I   : Y  S  N  P  H  V  L 


        .         .         .         .  
 16658  TAATAGATTAATTATACTTAATAGATTCGTCTT
         -  -  I  N  Y  T  -  -  I  R  L 
          N  R  L  I  I  L  N  R  F  V 
        I  I  D  -  L  Y  L  I  D  S  S 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-7 (17100  16511)
SCR   (e 0.850)

  Exon  1  17100  16511 ( 590 n); score: 0.850

  PGS (16843  16511)	9855330-
  PGS (16853  16544)	4714617+
  PGS (16839  16544)	20553288+
  PGS (16845  16586)	25805794+
  PGS (16843  16623)	6674009-
  PGS (17100  16825)	12775389+
  PGS (17038  16830)	7219249+
  PGS (17091  16843)	11678487-

3-phase translation of AGS-7 (-strand):

        .         .         .         .         .         .         
 17100  CCCAAAAACCAAAAACTTTTCAAAATTTCTCAACACATCAAATATTACGACACATGCATG
         P  K  N  Q  K  L  F  K  I  S  Q  H  I  K  Y  Y  D  T  C  M 
          P  K  T  K  N  F  S  K  F  L  N  T  S  N  I  T  T  H  A  - 
           Q  K  P  K  T  F  Q  N  F  S  T  H  Q  I  L  R  H  M  H 


        .         .         .         .         .         .         
 17040  AAGCATTAAATATATACAAAAATAAAAACTAATTGCACAGTTTACCTATAAATCGCGAGA
         K  H  -  I  Y  T  K  I  K  T  N  C  T  V  Y  L  -  I  A  R 
          S  I  K  Y  I  Q  K  -  K  L  I  A  Q  F  T  Y  K  S  R  D 
        E  A  L  N  I  Y  K  N  K  N  -  L  H  S  L  P  I  N  R  E 


        .         .         .         .         .         .         
 16980  TAAATCTTTTAAACCTAGTTACTCTATGATTAGACAATATTTGTCAAATAAAAACGAAAG
         -  I  F  -  T  -  L  L  Y  D  -  T  I  F  V  K  -  K  R  K 
          K  S  F  K  P  S  Y  S  M  I  R  Q  Y  L  S  N  K  N  E  S 
        I  N  L  L  N  L  V  T  L  -  L  D  N  I  C  Q  I  K  T  K 


        .         .         .         .         .         .         
 16920  TGCTACAGTCTCAAAAACCAAAAAGTTTTCGAAACTAAACAAGGCCTGACACTTGCACAT
         C  Y  S  L  K  N  Q  K  V  F  E  T  K  Q  G  L  T  L  A  H 
          A  T  V  S  K  T  K  K  F  S  K  L  N  K  A  -  H  L  H  I 
        V  L  Q  S  Q  K  P  K  S  F  R  N  -  T  R  P  D  T  C  T 


        .         .         .         .         .         .         
 16860  CTTTTTTAAAAAATATAAGGCCCTGTTTAGTTCCCACCTAAAAAATTTTCATCCATCACA
         L  F  -  K  I  -  G  P  V  -  F  P  P  K  K  F  S  S  I  T 
          F  F  K  K  Y  K  A  L  F  S  S  H  L  K  N  F  H  P  S  H 
        S  F  L  K  N  I  R  P  C  L  V  P  T  -  K  I  F  I  H  H 


        .         .         .         .         .         .         
 16800  TTGAATCTTTAGACACATACATAAAACATTAAATGTAGATAAAAAATAATTACACAGTTT
         L  N  L  -  T  H  T  -  N  I  K  C  R  -  K  I  I  T  Q  F 
          -  I  F  R  H  I  H  K  T  L  N  V  D  K  K  -  L  H  S  L 
        I  E  S  L  D  T  Y  I  K  H  -  M  -  I  K  N  N  Y  T  V 


        .         .         .         .         .         .         
 16740  GGTTGAAAATCGCGAGATGAATTTTTTAAGCCTAGTTAGTCCATGATTAGCCTTAAGTGC
         G  -  K  S  R  D  E  F  F  K  P  S  -  S  M  I  S  L  K  C 
          V  E  N  R  E  M  N  F  L  S  L  V  S  P  -  L  A  L  S  A 
        W  L  K  I  A  R  -  I  F  -  A  -  L  V  H  D  -  P  -  V 


        .         .         .         .         .         .         
 16680  TACAGTAACCCACATGTGCTAATAATAGATTAATTATACTTAATAGATTCGTCTTGCAGT
         Y  S  N  P  H  V  L  I  I  D  -  L  Y  L  I  D  S  S  C  S 
          T  V  T  H  M  C  -  -  -  I  N  Y  T  -  -  I  R  L  A  V 
        L  Q  -  P  T  C  A  N  N  R  L  I  I  L  N  R  F  V  L  Q 


        .         .         .         .         .         .         
 16620  TTCCTGACGAGTTATGTAATTTGTTTTTTTTATTAGTTTTTAAAAACCCCTCCCGACATC
         F  L  T  S  Y  V  I  C  F  F  Y  -  F  L  K  T  P  P  D  I 
          S  -  R  V  M  -  F  V  F  F  I  S  F  -  K  P  L  P  T  S 
        F  P  D  E  L  C  N  L  F  F  L  L  V  F  K  N  P  S  R  H 


        .         .         .         .         .         
 16560  CTTCCGACATATCCGATGTGACCTAAAAAATTTTCATCTTCAATCTAAAC
         L  P  T  Y  P  M  -  P  K  K  F  S  S  S  I  - 
          F  R  H  I  R  C  D  L  K  N  F  H  L  Q  S  K 
        P  S  D  I  S  D  V  T  -  K  I  F  I  F  N  L  N 


Maximal non-overlapping open reading frames (>= 64 codons):
none


3-phase translation of AGS-7 (+strand):

        .         .         .         .         .         .         
 16511  GTTTAGATTGAAGATGAAAATTTTTTAGGTCACATCGGATATGTCGGAAGGATGTCGGGA
         V  -  I  E  D  E  N  F  L  G  H  I  G  Y  V  G  R  M  S  G 
          F  R  L  K  M  K  I  F  -  V  T  S  D  M  S  E  G  C  R  E 
           L  D  -  R  -  K  F  F  R  S  H  R  I  C  R  K  D  V  G 


        .         .         .         .         .         .         
 16571  GGGGTTTTTAAAAACTAATAAAAAAAACAAATTACATAACTCGTCAGGAAACTGCAAGAC
         G  V  F  K  N  -  -  K  K  Q  I  T  -  L  V  R  K  L  Q  D 
          G  F  L  K  T  N  K  K  N  K  L  H  N  S  S  G  N  C  K  T 
        R  G  F  -  K  L  I  K  K  T  N  Y  I  T  R  Q  E  T  A  R 


        .         .         .         .         .         .         
 16631  GAATCTATTAAGTATAATTAATCTATTATTAGCACATGTGGGTTACTGTAGCACTTAAGG
         E  S  I  K  Y  N  -  S  I  I  S  T  C  G  L  L  -  H  L  R 
          N  L  L  S  I  I  N  L  L  L  A  H  V  G  Y  C  S  T  -  G 
        R  I  Y  -  V  -  L  I  Y  Y  -  H  M  W  V  T  V  A  L  K 


        .         .         .         .         .         .         
 16691  CTAATCATGGACTAACTAGGCTTAAAAAATTCATCTCGCGATTTTCAACCAAACTGTGTA
         L  I  M  D  -  L  G  L  K  N  S  S  R  D  F  Q  P  N  C  V 
          -  S  W  T  N  -  A  -  K  I  H  L  A  I  F  N  Q  T  V  - 
        A  N  H  G  L  T  R  L  K  K  F  I  S  R  F  S  T  K  L  C 


        .         .         .         .         .         .         
 16751  ATTATTTTTTATCTACATTTAATGTTTTATGTATGTGTCTAAAGATTCAATGTGATGGAT
         I  I  F  Y  L  H  L  M  F  Y  V  C  V  -  R  F  N  V  M  D 
          L  F  F  I  Y  I  -  C  F  M  Y  V  S  K  D  S  M  -  W  M 
        N  Y  F  L  S  T  F  N  V  L  C  M  C  L  K  I  Q  C  D  G 


        .         .         .         .         .         .         
 16811  GAAAATTTTTTAGGTGGGAACTAAACAGGGCCTTATATTTTTTAAAAAAGATGTGCAAGT
         E  N  F  L  G  G  N  -  T  G  P  Y  I  F  -  K  R  C  A  S 
          K  I  F  -  V  G  T  K  Q  G  L  I  F  F  K  K  D  V  Q  V 
        -  K  F  F  R  W  E  L  N  R  A  L  Y  F  L  K  K  M  C  K 


        .         .         .         .         .         .         
 16871  GTCAGGCCTTGTTTAGTTTCGAAAACTTTTTGGTTTTTGAGACTGTAGCACTTTCGTTTT
         V  R  P  C  L  V  S  K  T  F  W  F  L  R  L  -  H  F  R  F 
          S  G  L  V  -  F  R  K  L  F  G  F  -  D  C  S  T  F  V  F 
        C  Q  A  L  F  S  F  E  N  F  L  V  F  E  T  V  A  L  S  F 


        .         .         .         .         .         .         
 16931  TATTTGACAAATATTGTCTAATCATAGAGTAACTAGGTTTAAAAGATTTATCTCGCGATT
         Y  L  T  N  I  V  -  S  -  S  N  -  V  -  K  I  Y  L  A  I 
          I  -  Q  I  L  S  N  H  R  V  T  R  F  K  R  F  I  S  R  F 
        L  F  D  K  Y  C  L  I  I  E  -  L  G  L  K  D  L  S  R  D 


        .         .         .         .         .         .         
 16991  TATAGGTAAACTGTGCAATTAGTTTTTATTTTTGTATATATTTAATGCTTCATGCATGTG
         Y  R  -  T  V  Q  L  V  F  I  F  V  Y  I  -  C  F  M  H  V 
          I  G  K  L  C  N  -  F  L  F  L  Y  I  F  N  A  S  C  M  C 
        L  -  V  N  C  A  I  S  F  Y  F  C  I  Y  L  M  L  H  A  C 


        .         .         .         .         .         
 17051  TCGTAATATTTGATGTGTTGAGAAATTTTGAAAAGTTTTTGGTTTTTGGG
         S  -  Y  L  M  C  -  E  I  L  K  S  F  W  F  L 
          R  N  I  -  C  V  E  K  F  -  K  V  F  G  F  W 
        V  V  I  F  D  V  L  R  N  F  E  K  F  L  V  F  G 


Maximal non-overlapping open reading frames (>= 64 codons):
none






PGL   4 (+ strand):	 18165   22500


AGS-1 (18165  18218,18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)
SCR   (e 0.778  d 0.941 a 0.878,e 0.742  d 0.993 a 0.998,e 0.852  d 0.980 a 0.787,e 0.956  d 0.000 a 0.953,e 1.000  d 0.984 a 0.000,e 1.000  d 0.770 a 0.962,e 1.000  d 0.929 a 0.999,e 0.962  d 0.992 a 0.998,e 0.944  d 0.596 a 0.894,e 0.878)

  Exon  1  18165  18218 (  54 n); score: 0.778
   Intron  1  18219  18328 ( 110 n);           Pd: 0.941  Pa: 0.878
  Exon  2  18329  18417 (  89 n); score: 0.742
   Intron  2  18418  18626 ( 209 n);           Pd: 0.993  Pa: 0.998
  Exon  3  18627  18734 ( 108 n); score: 0.852
   Intron  3  18735  18859 ( 125 n);           Pd: 0.980  Pa: 0.787
  Exon  4  18860  18967 ( 108 n); score: 0.956
   Intron  4  18968  19065 (  98 n);           Pd: 0.000  Pa: 0.953
  Exon  5  19066  19156 (  91 n); score: 1.000
   Intron  5  19157  19270 ( 114 n);           Pd: 0.984  Pa: 0.000
  Exon  6  19271  19323 (  53 n); score: 1.000
   Intron  6  19324  20843 (1520 n);           Pd: 0.770  Pa: 0.962
  Exon  7  20844  20906 (  63 n); score: 1.000
   Intron  7  20907  21626 ( 720 n);           Pd: 0.929  Pa: 0.999
  Exon  8  21627  21671 (  45 n); score: 0.962
   Intron  8  21672  21777 ( 106 n);           Pd: 0.992  Pa: 0.998
  Exon  9  21778  21813 (  36 n); score: 0.944
   Intron  9  21814  22451 ( 638 n);           Pd: 0.596  Pa: 0.894
  Exon 10  22452  22500 (  49 n); score: 0.878

  PGS (18165  18218,18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)	2352083+
  PGS (18165  18218,18329  18417,18627  18734,18860  18967,19066  19156,19271  19317)	13613476+
  PGS (18165  18218,18329  18417,18627  18734,18860  18967,19066  19135)	21922100+
  PGS (18169  18218,18329  18417,18627  18734,18860  18967,19066  19106)	17069519+
  PGS (18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)	22136893+
  PGS (18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)	18176307+
  PGS (18660  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)	13615373+
  PGS (18660  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)	13610520+
  PGS (18854  18967,19066  19156,19271  19323,20844  20906,21627  21652)	13316811+
  PGS (18917  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22500)	13263258+
  PGS (18864  18887)	11931938+
  PGS (18864  18887)	10698690+
  PGS (19281  19323,20844  20910)	12047395+

3-phase translation of AGS-1 (+strand):

        .         .         .         .         .         .    :       
 18165  ACAGTGTTACCAGAGAGGATCCTTCCACCAAGTACGAGCTGCTCCATGAGCTTG : GGAAAG
         T  V  L  P  E  R  I  L  P  P  S  T  S  C  S  M  S  L  :  G  K 
          Q  C  Y  Q  R  G  S  F  H  Q  V  R  A  A  P  -  A  W :   E  R 
           S  V  T  R  E  D  P  S  T  K  Y  E  L  L  H  E  L   : G  K 


        .         .         .         .         .         .         
 18335  GCTCATATGGTGCAGTGTACAAAGCAAGGGATCTCAGAACGCAGGAGCTTGTGGCTGTCA
         A  H  M  V  Q  C  T  K  Q  G  I  S  E  R  R  S  L  W  L  S 
          L  I  W  C  S  V  Q  S  K  G  S  Q  N  A  G  A  C  G  C  Q 
        G  S  Y  G  A  V  Y  K  A  R  D  L  R  T  Q  E  L  V  A  V 


        .         .         .   :        .         .         .         
 18395  AGATTATCTCACTAACAGAAGGG : GAAGAAGGATATGAAGACATACGGGGAGAAATTGAGA
         R  L  S  H  -  Q  K  G :   K  K  D  M  K  T  Y  G  E  K  L  R 
          D  Y  L  T  N  R  R   : G  R  R  I  -  R  H  T  G  R  N  -  D 
        K  I  I  S  L  T  E  G  :  E  E  G  Y  E  D  I  R  G  E  I  E 


        .         .         .         .         .         .         
 18664  TGCTGCAGCAGTGTAGCCATCCAAATGTTGTCCGCTACTTTGGAAGCTACCAAGGAGAGG
         C  C  S  S  V  A  I  Q  M  L  S  A  T  L  E  A  T  K  E  R 
          A  A  A  V  -  P  S  K  C  C  P  L  L  W  K  L  P  R  R  G 
        M  L  Q  Q  C  S  H  P  N  V  V  R  Y  F  G  S  Y  Q  G  E 


        .         . :          .         .         .         .         
 18724  ACTACCTATGG : ATAGTTATGGAGTACTGTGGTGGTGGAAGTGTTGCTGATTTGATAGGCA
         T  T  Y  G :   -  L  W  S  T  V  V  V  E  V  L  L  I  -  -  A 
          L  P  M   : D  S  Y  G  V  L  W  W  W  K  C  C  -  F  D  R  H 
        D  Y  L  W  :  I  V  M  E  Y  C  G  G  G  S  V  A  D  L  I  G 


        .         .         .         .         .         .         :  
 18909  TCACAGAGGAGCCTCTTGATGAATCCCAAATAGCTTATATATGTAGAGAAGCACTAAAG : G
         S  Q  R  S  L  L  M  N  P  K  -  L  I  Y  V  E  K  H  -  R :  
          H  R  G  A  S  -  -  I  P  N  S  L  Y  M  -  R  S  T  K   : G 
        I  T  E  E  P  L  D  E  S  Q  I  A  Y  I  C  R  E  A  L  K  : 


        .         .         .         .         .         .         
 19067  GCCTTGCTTACCTGCACTCCATTTTTAAAGTTCATAGAGATATTAAGGGTGGCAACATTC
         A  L  L  T  C  T  P  F  L  K  F  I  E  I  L  R  V  A  T  F 
          P  C  L  P  A  L  H  F  -  S  S  -  R  Y  -  G  W  Q  H  S 
        G  L  A  Y  L  H  S  I  F  K  V  H  R  D  I  K  G  G  N  I 


        .         .         .          : .         .         .         
 19127  TTCTAACTGAGCAAGGCGAGGTGAAGTTGG : GTGATTTTGGTGTAGCTGCCCAGCTGACAA
         F  -  L  S  K  A  R  -  S  W  :  V  I  L  V  -  L  P  S  -  Q 
          S  N  -  A  R  R  G  E  V  G :   -  F  W  C  S  C  P  A  D  K 
        L  L  T  E  Q  G  E  V  K  L   : G  D  F  G  V  A  A  Q  L  T 


        .         .         .   :        .         .         .         
 19301  GAACCATGTCAAAGCGCAACACG : TTCATTGGTACTCCACATTGGATGGCACCAGAGGTCA
         E  P  C  Q  S  A  T  R :   S  L  V  L  H  I  G  W  H  Q  R  S 
          N  H  V  K  A  Q  H   : V  H  W  Y  S  T  L  D  G  T  R  G  H 
        R  T  M  S  K  R  N  T  :  F  I  G  T  P  H  W  M  A  P  E  V 


        .         .         .      :     .         .         .         
 20881  TTCAAGAAAGTCGTTATGATGGAAAG : GTAGATGTTTGGGCATTAGGTGTATCTGCAATTG
         F  K  K  V  V  M  M  E  R :   -  M  F  G  H  -  V  Y  L  Q  L 
          S  R  K  S  L  -  W  K   : G  R  C  L  G  I  R  C  I  C  N  - 
        I  Q  E  S  R  Y  D  G  K  :  V  D  V  W  A  L  G  V  S  A  I 


        .         . :          .         .         .       :    .         
 21661  AGATGGCAGAG : GGCATGCCACCAAGATCCACTGTACATCCAATGAGA : GTTATCTTCATGA
         R  W  Q  R :   A  C  H  Q  D  P  L  Y  I  Q  -  E :   L  S  S  - 
          D  G  R   : G  H  A  T  K  I  H  C  T  S  N  E   : S  Y  L  H  D 
        E  M  A  E  :  G  M  P  P  R  S  T  V  H  P  M  R  :  V  I  F  M 


        .         .         .         .     
 22465  TATCCAGTGAACCAGCACCAATGCTGGAGGATAAGG
         Y  P  V  N  Q  H  Q  C  W  R  I  R 
          I  Q  -  T  S  T  N  A  G  G  - 
        I  S  S  E  P  A  P  M  L  E  D  K 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-4_AGS-1_PPS_1 (18167  18218,18329  18417,18627  18734,18860  18967,19066  19156,19271  19323,20844  20906,21627  21671,21778  21813,22452  22499)	(frame '0';   693 bp,  231 residues) 
     1  SVTREDPSTK YELLHELGKG SYGAVYKARD LRTQELVAVK IISLTEGEEG YEDIRGEIEM 
    61  LQQCSHPNVV RYFGSYQGED YLWIVMEYCG GGSVADLIGI TEEPLDESQI AYICREALKG 
   121  LAYLHSIFKV HRDIKGGNIL LTEQGEVKLG DFGVAAQLTR TMSKRNTFIG TPHWMAPEVI 
   181  QESRYDGKVD VWALGVSAIE MAEGMPPRST VHPMRVIFMI SSEPAPMLED K

NCBI Blastp




AGS-2 (18165  18218,18329  18417,18627  18734,18860  18967,19271  19323,20844  20906,21627  21671,21778  21813)
SCR   (e 0.778  d 0.941 a 0.878,e 0.663  d 0.993 a 0.998,e 0.843  d 0.980 a 0.787,e 0.769  d 0.000 a 0.000,e 0.887  d 0.770 a 0.962,e 0.889  d 0.929 a 0.999,e 0.800  d 0.992 a 0.998,e 0.694)

  Exon  1  18165  18218 (  54 n); score: 0.778
   Intron  1  18219  18328 ( 110 n);           Pd: 0.941  Pa: 0.878
  Exon  2  18329  18417 (  89 n); score: 0.663
   Intron  2  18418  18626 ( 209 n);           Pd: 0.993  Pa: 0.998
  Exon  3  18627  18734 ( 108 n); score: 0.843
   Intron  3  18735  18859 ( 125 n);           Pd: 0.980  Pa: 0.787
  Exon  4  18860  18967 ( 108 n); score: 0.769
   Intron  4  18968  19270 ( 303 n);           Pd: 0.000  Pa: 0.000
  Exon  5  19271  19323 (  53 n); score: 0.887
   Intron  5  19324  20843 (1520 n);           Pd: 0.770  Pa: 0.962
  Exon  6  20844  20906 (  63 n); score: 0.889
   Intron  6  20907  21626 ( 720 n);           Pd: 0.929  Pa: 0.999
  Exon  7  21627  21671 (  45 n); score: 0.800
   Intron  7  21672  21777 ( 106 n);           Pd: 0.992  Pa: 0.998
  Exon  8  21778  21813 (  36 n); score: 0.694

  PGS (18165  18218,18329  18417,18627  18734,18860  18967,19271  19323,20844  20906,21627  21671,21778  21813)	20172268+
  PGS (18165  18218,18329  18417,18627  18734,18860  18967,19271  19323,20844  20906,21627  21671)	13607727+

3-phase translation of AGS-2 (+strand):

        .         .         .         .         .         .    :       
 18165  ACAGTGTTACCAGAGAGGATCCTTCCACCAAGTACGAGCTGCTCCATGAGCTTG : GGAAAG
         T  V  L  P  E  R  I  L  P  P  S  T  S  C  S  M  S  L  :  G  K 
          Q  C  Y  Q  R  G  S  F  H  Q  V  R  A  A  P  -  A  W :   E  R 
           S  V  T  R  E  D  P  S  T  K  Y  E  L  L  H  E  L   : G  K 


        .         .         .         .         .         .         
 18335  GCTCATATGGTGCAGTGTACAAAGCAAGGGATCTCAGAACGCAGGAGCTTGTGGCTGTCA
         A  H  M  V  Q  C  T  K  Q  G  I  S  E  R  R  S  L  W  L  S 
          L  I  W  C  S  V  Q  S  K  G  S  Q  N  A  G  A  C  G  C  Q 
        G  S  Y  G  A  V  Y  K  A  R  D  L  R  T  Q  E  L  V  A  V 


        .         .         .   :        .         .         .         
 18395  AGATTATCTCACTAACAGAAGGG : GAAGAAGGATATGAAGACATACGGGGAGAAATTGAGA
         R  L  S  H  -  Q  K  G :   K  K  D  M  K  T  Y  G  E  K  L  R 
          D  Y  L  T  N  R  R   : G  R  R  I  -  R  H  T  G  R  N  -  D 
        K  I  I  S  L  T  E  G  :  E  E  G  Y  E  D  I  R  G  E  I  E 


        .         .         .         .         .         .         
 18664  TGCTGCAGCAGTGTAGCCATCCAAATGTTGTCCGCTACTTTGGAAGCTACCAAGGAGAGG
         C  C  S  S  V  A  I  Q  M  L  S  A  T  L  E  A  T  K  E  R 
          A  A  A  V  -  P  S  K  C  C  P  L  L  W  K  L  P  R  R  G 
        M  L  Q  Q  C  S  H  P  N  V  V  R  Y  F  G  S  Y  Q  G  E 


        .         . :          .         .         .         .         
 18724  ACTACCTATGG : ATAGTTATGGAGTACTGTGGTGGTGGAAGTGTTGCTGATTTGATAGGCA
         T  T  Y  G :   -  L  W  S  T  V  V  V  E  V  L  L  I  -  -  A 
          L  P  M   : D  S  Y  G  V  L  W  W  W  K  C  C  -  F  D  R  H 
        D  Y  L  W  :  I  V  M  E  Y  C  G  G  G  S  V  A  D  L  I  G 


        .         .         .         .         .         .         :  
 18909  TCACAGAGGAGCCTCTTGATGAATCCCAAATAGCTTATATATGTAGAGAAGCACTAAAG : G
         S  Q  R  S  L  L  M  N  P  K  -  L  I  Y  V  E  K  H  -  R :  
          H  R  G  A  S  -  -  I  P  N  S  L  Y  M  -  R  S  T  K   : G 
        I  T  E  E  P  L  D  E  S  Q  I  A  Y  I  C  R  E  A  L  K  : 


        .         .         .         .         .         .  :         
 19272  TGATTTTGGTGTAGCTGCCCAGCTGACAAGAACCATGTCAAAGCGCAACACG : TTCATTGG
         -  F  W  C  S  C  P  A  D  K  N  H  V  K  A  Q  H   : V  H  W 
          D  F  G  V  A  A  Q  L  T  R  T  M  S  K  R  N  T  :  F  I  G 
        V  I  L  V  -  L  P  S  -  Q  E  P  C  Q  S  A  T  R :   S  L 


        .         .         .         .         .         .     :      
 20852  TACTCCACATTGGATGGCACCAGAGGTCATTCAAGAAAGTCGTTATGATGGAAAG : GTAGA
         Y  S  T  L  D  G  T  R  G  H  S  R  K  S  L  -  W  K   : G  R 
          T  P  H  W  M  A  P  E  V  I  Q  E  S  R  Y  D  G  K  :  V  D 
        V  L  H  I  G  W  H  Q  R  S  F  K  K  V  V  M  M  E  R :   - 


        .         .         .         .          : .         .         
 21632  TGTTTGGGCATTAGGTGTATCTGCAATTGAGATGGCAGAG : GGCATGCCACCAAGATCCAC
         C  L  G  I  R  C  I  C  N  -  D  G  R   : G  H  A  T  K  I  H 
          V  W  A  L  G  V  S  A  I  E  M  A  E  :  G  M  P  P  R  S  T 
        M  F  G  H  -  V  Y  L  Q  L  R  W  Q  R :   A  C  H  Q  D  P 


        .         .     
 21798  TGTACATCCAATGAGA
         C  T  S  N  E 
          V  H  P  M  R 
        L  Y  I  Q  - 


Maximal non-overlapping open reading frames (>= 64 codons):



>21326110+_PGL-4_AGS-2_PPS_1 (18167  18218,18329  18417,18627  18734,18860  18967,19271  19285)	(frame '0';   369 bp,  123 residues) 
     1  SVTREDPSTK YELLHELGKG SYGAVYKARD LRTQELVAVK IISLTEGEEG YEDIRGEIEM 
    61  LQQCSHPNVV RYFGSYQGED YLWIVMEYCG GGSVADLIGI TEEPLDESQI AYICREALKV 
   121  ILV-

NCBI Blastp


>21326110+_PGL-4_AGS-2_PPS_2 (18955  18967,19271  19323,20844  20906,21627  21671,21778  21813)	(frame '2';   210 bp,   70 residues) 
     1  RSTKGDFGVA AQLTRTMSKR NTFIGTPHWM APEVIQESRY DGKVDVWALG VSAIEMAEGM 
    61  PPRSTVHPMR

NCBI Blastp




AGS-3 (21266  21345,21414  21440,21646  21671)
SCR   (e 0.775  d 0.000 a 0.000,e 0.741  d 0.000 a 0.848,e 0.692)

  Exon  1  21266  21345 (  80 n); score: 0.775
   Intron  1  21346  21413 (  68 n);           Pd: 0.000  Pa: 0.000
  Exon  2  21414  21440 (  27 n); score: 0.741
   Intron  2  21441  21645 ( 205 n);           Pd: 0.000  Pa: 0.848
  Exon  3  21646  21671 (  26 n); score: 0.692

  PGS (21266  21345,21414  21440,21646  21671)	27547907+

3-phase translation of AGS-3 (+strand):

        .         .         .         .         .         .         
 21266  GGATGAAAACGGATCGGATACGGACGGATATCATCGATATCATATTTGTTTTCGTATTTC
         G  -  K  R  I  G  Y  G  R  I  S  S  I  S  Y  L  F  S  Y  F 
          D  E  N  G  S  D  T  D  G  Y  H  R  Y  H  I  C  F  R  I  S 
           M  K  T  D  R  I  R  T  D  I  I  D  I  I  F  V  F  V  F 


        .         .          : .         .         .       :    .         
 21326  TGGTCGAATTCGGATTCGAA : TACTCGGATACGGATACGGTATCGGAT : GTGTATCTGCAAT
         W  S  N  S  D  S  N :   T  R  I  R  I  R  Y  R  M :   C  I  C  N 
          G  R  I  R  I  R   : I  L  G  Y  G  Y  G  I  G   : C  V  S  A  I 
        L  V  E  F  G  F  E  :  Y  S  D  T  D  T  V  S  D  :  V  Y  L  Q 


        .         .  
 21659  TGAGATGGCAGAG
         -  D  G  R 
          E  M  A  E 
        L  R  W  Q 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-4 (21285  21538,21646  21671)
SCR   (e 0.886  d 0.000 a 0.848,e 0.615)

  Exon  1  21285  21538 ( 254 n); score: 0.886
   Intron  1  21539  21645 ( 107 n);           Pd: 0.000  Pa: 0.848
  Exon  2  21646  21671 (  26 n); score: 0.615

  PGS (21477  21538,21646  21671)	11409274-
  PGS (21285  21538)	7217281-
  PGS (21375  21535)	9299315-

3-phase translation of AGS-4 (+strand):

        .         .         .         .         .         .         
 21285  ACGGACGGATATCATCGATATCATATTTGTTTTCGTATTTCTGGTCGAATTCGGATTCGA
         T  D  G  Y  H  R  Y  H  I  C  F  R  I  S  G  R  I  R  I  R 
          R  T  D  I  I  D  I  I  F  V  F  V  F  L  V  E  F  G  F  E 
           G  R  I  S  S  I  S  Y  L  F  S  Y  F  W  S  N  S  D  S 


        .         .         .         .         .         .         
 21345  ATACGGATAATGTCAACTATATCGGATAAGATACGATTGGATGTCGACATCATAAATATA
         I  R  I  M  S  T  I  S  D  K  I  R  L  D  V  D  I  I  N  I 
          Y  G  -  C  Q  L  Y  R  I  R  Y  D  W  M  S  T  S  -  I  Y 
        N  T  D  N  V  N  Y  I  G  -  D  T  I  G  C  R  H  H  K  Y 


        .         .         .         .         .         .         
 21405  TGATTTAAGTACTCGGATACGGATACGGTATCGGATGTAGAACATTCGAACTCGGATACG
         -  F  K  Y  S  D  T  D  T  V  S  D  V  E  H  S  N  S  D  T 
          D  L  S  T  R  I  R  I  R  Y  R  M  -  N  I  R  T  R  I  R 
        M  I  -  V  L  G  Y  G  Y  G  I  G  C  R  T  F  E  L  G  Y 


        .         .         .         .         .         .         
 21465  AACTGGTCTGAATCCCTCTAAACGAATTCGGTCTCAAATACGGTCGGAAAATATCCGTAC
         N  W  S  E  S  L  -  T  N  S  V  S  N  T  V  G  K  Y  P  Y 
          T  G  L  N  P  S  K  R  I  R  S  Q  I  R  S  E  N  I  R  T 
        E  L  V  -  I  P  L  N  E  F  G  L  K  Y  G  R  K  I  S  V 


        .         .    :       .         .         
 21525  CGTTTTCATCCCTA : GTGTATCTGCAATTGAGATGGCAGAG
         R  F  H  P  - :   C  I  C  N  -  D  G  R 
          V  F  I  P   : S  V  S  A  I  E  M  A  E 
        P  F  S  S  L  :  V  Y  L  Q  L  R  W  Q 


Maximal non-overlapping open reading frames (>= 64 codons):
none





AGS-5 (21266  21406)
SCR   (e 0.851)

  Exon  1  21266  21406 ( 141 n); score: 0.851

  PGS (21266  21406)	13239349+

3-phase translation of AGS-5 (+strand):

        .         .         .         .         .         .         
 21266  GGATGAAAACGGATCGGATACGGACGGATATCATCGATATCATATTTGTTTTCGTATTTC
         G  -  K  R  I  G  Y  G  R  I  S  S  I  S  Y  L  F  S  Y  F 
          D  E  N  G  S  D  T  D  G  Y  H  R  Y  H  I  C  F  R  I  S 
           M  K  T  D  R  I  R  T  D  I  I  D  I  I  F  V  F  V  F 


        .         .         .         .         .         .         
 21326  TGGTCGAATTCGGATTCGAATACGGATAATGTCAACTATATCGGATAAGATACGATTGGA
         W  S  N  S  D  S  N  T  D  N  V  N  Y  I  G  -  D  T  I  G 
          G  R  I  R  I  R  I  R  I  M  S  T  I  S  D  K  I  R  L  D 
        L  V  E  F  G  F  E  Y  G  -  C  Q  L  Y  R  I  R  Y  D  W 


        .         .         .
 21386  TGTCGACATCATAAATATATG
         C  R  H  H  K  Y  M 
          V  D  I  I  N  I 
        M  S  T  S  -  I  Y 


Maximal non-overlapping open reading frames (>= 64 codons):
none


3-phase translation of AGS-5 (-strand):

        .         .         .         .         .         .         
 21406  CATATATTTATGATGTCGACATCCAATCGTATCTTATCCGATATAGTTGACATTATCCGT
         H  I  F  M  M  S  T  S  N  R  I  L  S  D  I  V  D  I  I  R 
          I  Y  L  -  C  R  H  P  I  V  S  Y  P  I  -  L  T  L  S  V 
           Y  I  Y  D  V  D  I  Q  S  Y  L  I  R  Y  S  -  H  Y  P 


        .         .         .         .         .         .         
 21346  ATTCGAATCCGAATTCGACCAGAAATACGAAAACAAATATGATATCGATGATATCCGTCC
         I  R  I  R  I  R  P  E  I  R  K  Q  I  -  Y  R  -  Y  P  S 
          F  E  S  E  F  D  Q  K  Y  E  N  K  Y  D  I  D  D  I  R  P 
        Y  S  N  P  N  S  T  R  N  T  K  T  N  M  I  S  M  I  S  V 


        .         .         .
 21286  GTATCCGATCCGTTTTCATCC
         V  S  D  P  F  S  S 
          Y  P  I  R  F  H 
        R  I  R  S  V  F  I 


Maximal non-overlapping open reading frames (>= 64 codons):
none