Tracembler Examples

These represent additional datafiles for the published paper:

  • Dong, Q., Wilkerson, M.D. & Brendel, V. (2007) Tracembler - software for in silico chromosome walking in unassembled genomes. BMC Bioinformatics 8, 151. [PubMed ID: 17490482] [online abstract]

The following examples were produced using the Tracembler Web Server ( on Jan 2, 2007.

Example 1. Recovering rat chrm2 gene and its 5' and 3' upstream regions

[Back to the top]

A. chrm2 gene sequence used as query

>ref|NC_005103.2|NC_005103:63911288-63913359 Rattus norvegicus cholinergic receptor, muscarinic 2 (Chrm2)
[Back to the top]

B. Parameters being used

		Database: Rattus_norvegicus_WGS
		Initial E-value: 1e-100
		Round E-value: 1e-60
		Round Limit: 3
		Max Queries: 50
		Initial BLAST
				Percent Identity: none
				Filters: Low Complexity, Mask for lookup table only
		Recursive BLAST
				Word Size: 32
				Percent Identity: none
				Filters: Low Complexity, Rodents Repeats, Mask for lookup table only
		GenomeThreader Species: rat
[Back to the top]

C. The contig sequence assembled by Tracembler

[Back to the top]

D. Pairwise alignment between the original chrm2 (Query) sequence and the above contig (Sbjct)

 Score = 4107 bits (2072), Expect = 0.0
 Identities = 2072/2072 (100%)
 Strand = Plus / Plus

Query: 1    ccctacaggtttaaatgtttctttggccacttgactactgaacacaaaatgaataactca 60
Sbjct: 1450 ccctacaggtttaaatgtttctttggccacttgactactgaacacaaaatgaataactca 1509

Query: 61   acaaactcctcgaacaatggcttggctattaccagtccttacaagacatttgaagtggta 120
Sbjct: 1510 acaaactcctcgaacaatggcttggctattaccagtccttacaagacatttgaagtggta 1569

Query: 121  tttattgtccttgtggctggatccctcagtctggtgaccatcattgggaacattctggtc 180
Sbjct: 1570 tttattgtccttgtggctggatccctcagtctggtgaccatcattgggaacattctggtc 1629

Query: 181  atggtttccattaaagtcaaccgccaccttcagactgtcaacaattacttcttgttcagc 240
Sbjct: 1630 atggtttccattaaagtcaaccgccaccttcagactgtcaacaattacttcttgttcagc 1689

Query: 241  ctggcctgtgctgacctcatcataggtgttttctccatgaacttgtataccctctacact 300
Sbjct: 1690 ctggcctgtgctgacctcatcataggtgttttctccatgaacttgtataccctctacact 1749

Query: 301  gtgattggttactggcctttgggacctgtagtatgtgacctttggctagcattggactat 360
Sbjct: 1750 gtgattggttactggcctttgggacctgtagtatgtgacctttggctagcattggactat 1809

Query: 361  gttgtcagcaatgcctccgttatgaatctcctcatcatcagctttgatagatacttctgt 420
Sbjct: 1810 gttgtcagcaatgcctccgttatgaatctcctcatcatcagctttgatagatacttctgt 1869

Query: 421  gtcacgaaacctctgacctacccagttaagcggaccacaaaaatggcaggcatgatgatt 480
Sbjct: 1870 gtcacgaaacctctgacctacccagttaagcggaccacaaaaatggcaggcatgatgatt 1929

Query: 481  gcagctgcgtgggtcctttccttcatcctctgggccccagccattctcttctggcagttc 540
Sbjct: 1930 gcagctgcgtgggtcctttccttcatcctctgggccccagccattctcttctggcagttc 1989

Query: 541  atcgtaggggtgaggactgtggaggatggggagtgctatattcagttcttttccaatgcg 600
Sbjct: 1990 atcgtaggggtgaggactgtggaggatggggagtgctatattcagttcttttccaatgcg 2049

Query: 601  gccgtcaccttcggcactgccattgcagctttctatctgcctgtcatcatcatgactgtg 660
Sbjct: 2050 gccgtcaccttcggcactgccattgcagctttctatctgcctgtcatcatcatgactgtg 2109

Query: 661  ctctattggcatatatcccgggcaagcaagagtagaataaagaaggaaaagaaggaacct 720
Sbjct: 2110 ctctattggcatatatcccgggcaagcaagagtagaataaagaaggaaaagaaggaacct 2169

Query: 721  gtggccaaccaagacccagtatctccaagtctggtgcaaggaagaattgtaaagccaaac 780
Sbjct: 2170 gtggccaaccaagacccagtatctccaagtctggtgcaaggaagaattgtaaagccaaac 2229

Query: 781  aataacaatatgcctggtggtgatggcggcctggaacacaacaagatccagaatggcaag 840
Sbjct: 2230 aataacaatatgcctggtggtgatggcggcctggaacacaacaagatccagaatggcaag 2289

Query: 841  gctccacgggacggcgtgactgaaaactgtgttcagggggaggagaaagagagctccaat 900
Sbjct: 2290 gctccacgggacggcgtgactgaaaactgtgttcagggggaggagaaagagagctccaat 2349

Query: 901  gattcgacgtcagtcagtgctgtggcctccaatatgagagatgatgagataacccaggat 960
Sbjct: 2350 gattcgacgtcagtcagtgctgtggcctccaatatgagagatgatgagataacccaggat 2409

Query: 961  gaaaacacagtttccacttcgctgggccactccagagatgacaactctaagcaaacatgc 1020
Sbjct: 2410 gaaaacacagtttccacttcgctgggccactccagagatgacaactctaagcaaacatgc 2469

Query: 1021 atcaaaattgtcaccaaggcccaaaagggtgatgtgtgcaccccaacgagtaccactgta 1080
Sbjct: 2470 atcaaaattgtcaccaaggcccaaaagggtgatgtgtgcaccccaacgagtaccactgta 2529

Query: 1081 gaactagttgggtcgtcgggtcagaatggggatgaaaagcagaacattgtagcccgcaaa 1140
Sbjct: 2530 gaactagttgggtcgtcgggtcagaatggggatgaaaagcagaacattgtagcccgcaaa 2589

Query: 1141 atcgtgaagatgaccaagcagcctgccaaaaagaagcctccaccatcccgggaaaagaaa 1200
Sbjct: 2590 atcgtgaagatgaccaagcagcctgccaaaaagaagcctccaccatcccgggaaaagaaa 2649

Query: 1201 gtgaccaggacaatcttggctatcctgttggctttcatcataacgtgggcgccatacaat 1260
Sbjct: 2650 gtgaccaggacaatcttggctatcctgttggctttcatcataacgtgggcgccatacaat 2709

Query: 1261 gtcatggtgctcatcaatactttctgtgcaccctgcatccccaatacagtatggacaatt 1320
Sbjct: 2710 gtcatggtgctcatcaatactttctgtgcaccctgcatccccaatacagtatggacaatt 2769

Query: 1321 ggctactggctctgttacatcaatagcaccatcaatccggcctgctatgcgctttgtaat 1380
Sbjct: 2770 ggctactggctctgttacatcaatagcaccatcaatccggcctgctatgcgctttgtaat 2829

Query: 1381 gccaccttcaaaaagacttttaagcacctcctcatgtgtcattacaagaacataggcgct 1440
Sbjct: 2830 gccaccttcaaaaagacttttaagcacctcctcatgtgtcattacaagaacataggcgct 2889

Query: 1441 acacggtgaaaagaccatcaaaagaagaaatgtggtcgagtgtgtcttggggaagaacag 1500
Sbjct: 2890 acacggtgaaaagaccatcaaaagaagaaatgtggtcgagtgtgtcttggggaagaacag 2949

Query: 1501 agacaagaaagctgtgtttatagtgacctgccatttcactttacagtcttactgcaacat 1560
Sbjct: 2950 agacaagaaagctgtgtttatagtgacctgccatttcactttacagtcttactgcaacat 3009

Query: 1561 gaaagtaaggagttttagagagacactatcattgtgcccatgctccattttgggaaaaat 1620
Sbjct: 3010 gaaagtaaggagttttagagagacactatcattgtgcccatgctccattttgggaaaaat 3069

Query: 1621 aaattaataaaccttcaccttataaaccctgtcagtttaggagcaccgagaaaatgaaag 1680
Sbjct: 3070 aaattaataaaccttcaccttataaaccctgtcagtttaggagcaccgagaaaatgaaag 3129

Query: 1681 aggcatgctgaaactgcagatctaaggaaaaatctctactgtctcctgctctcttgaaga 1740
Sbjct: 3130 aggcatgctgaaactgcagatctaaggaaaaatctctactgtctcctgctctcttgaaga 3189

Query: 1741 agggcgtcagagtctacaatttcatgtctctgcacaagaagaataacctagtctatttgt 1800
Sbjct: 3190 agggcgtcagagtctacaatttcatgtctctgcacaagaagaataacctagtctatttgt 3249

Query: 1801 tgtttctttctgttgttcccctgtgtggcggtgagaaagaaatgacacattccatgctaa 1860
Sbjct: 3250 tgtttctttctgttgttcccctgtgtggcggtgagaaagaaatgacacattccatgctaa 3309

Query: 1861 cacagagacctacatggaaagaagcaggcactgtacaatgagagagaagaagaaagaaaa 1920
Sbjct: 3310 cacagagacctacatggaaagaagcaggcactgtacaatgagagagaagaagaaagaaaa 3369

Query: 1921 tcaaataggatgcagagatggtctgcagagcagcgagcatatcctcggctgtgctgtgct 1980
Sbjct: 3370 tcaaataggatgcagagatggtctgcagagcagcgagcatatcctcggctgtgctgtgct 3429

Query: 1981 ctgatctgaaggatttcaacacaacaactgcttatttcttctctcttcccctttcccgtc 2040
Sbjct: 3430 ctgatctgaaggatttcaacacaacaactgcttatttcttctctcttcccctttcccgtc 3489

Query: 2041 atggaaagcaagaaagcaaaacaacaaaagcc 2072
Sbjct: 3490 atggaaagcaagaaagcaaaacaacaaaagcc 3521
[Back to the top]

E. Pairwise alignment between the above contig (Query) and entire rat Chromosome 4 (Sbjct), which is gi|62750804|ref|NC_005103.2|NC_005103Rattus norvegicus chromosome 4, reference assembly (based on RGSC v3.4).

The alignment was performed with the BLAST2 web server at NCBI ( with its 'Filter' option un-checked.

 Score = 9662 bits (5025),  Expect = 0.0
 Identities = 5045/5050 (99%), Gaps = 2/5050 (0%)

				 |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||

				 || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||


















































































				 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |

Query  5039      GATGCAGACG  5048
Sbjct  63914879  GATGCAGACG  63914888
[Back to the top]

Example 2. Micro-synteny of two genes between Medicago truncatula and soybean

[Back to the top]

A. Two Medicago truncatula proteins used as query

IMGA|AC146590_10.2 AC146590.25 50435-49430 H EGN_Mt050401 20050623  SWIM zinc finger, putative
>IMGA|AC146590_11.2 AC146590.25 52557-50736 H EGN_Mt050401 20050623  hypothetical protein
[Back to the top]

B. Parameters being used

Database: Glycine_max_WGS
Initial E-value: 1e-60
Round E-value: 1e-60
Round Limit: 4
Max Queries: 50
Initial BLAST
		Percent Identity: none
		Filters: Low Complexity, Mask for lookup table only
Recursive BLAST
		Word Size: 32
		Percent Identity: none
		Filters: Low Complexity, Rodents Repeats, Mask for lookup table only
GenomeThreader Species: arabidopsis
[Back to the top]

C. The produced contig that covers the soybean homologs of the above two Medicago proteins

[Back to the top]

D. Pairwise alignment between the original Medicago query sequences and the above contig

Query= IMGA|AC146590_10.2 H EGN_Mt050401 20050623  SWIM zinc finger, putative
			(175 letters)

	Score =  283 bits (725), Expect = 2e-78
	Identities = 135/174 (77%), Positives = 149/174 (85%), Gaps = 1/174 (0%)
	Frame = -3




Query= IMGA|AC146590_11.2 H EGN_Mt050401 20050623  hypothetical
			(183 letters)

	Score =  157 bits (396), Expect(2) = 4e-75
	Identities = 67/77 (87%), Positives = 73/77 (94%)
	Frame = -3



	Score =  137 bits (346), Expect(2) = 4e-75
	Identities = 61/69 (88%), Positives = 65/69 (94%)
	Frame = -2


Query: 99   VSAFRWLMK 107
Sbjct: 2659 ISAFRWLMK 2633
[Back to the top]

E. Spliced alignment between the above contig and the two query protein sequences

Protein Sequence: file=/PlantGDB/html/tmp/tracembler-1167778359/QRY.fsa, description=IMGA|AC146590_10.2 H EGN_Mt050401 20050623  SWIM zinc finger, putative


Genomic Template: file=/PlantGDB/html/tmp/tracembler-1167778359/reads.cap.contigs, strand=-, from=2247, to=1162, description=Contig

Predicted gene structure:

	Exon  1 1950 1453 ( 498 n)  Protein      1    175 ( 175 aa) score: 0.637

MATCH	Contig-	IMGA+	0.637	498	0.949	P
PGS_Contig-_IMGA+	(1950  1453)

Alignment (genomic DNA sequence = upper lines):

	L  K  L   M  S  P  L   Q  E  Q   A  H  G   V  L  T  R   F  A  F 
	+  |  |   |  |  |  |   |  |  |   |  |  .      |  |  |   |  +  | 
	M  K  L   M  S  P  L   Q  E  Q   A  H  S   D  L  T  R   F  S  F           20

	Q  K  F   Q  E  E  F   E  R  S   T  Q  Y   S  I  H  H   E  N  G 
	|  |  |   |  |  |  |      |  |   +  |  |   |  |     |   |  |  | 
	Q  K  F   Q  E  E  F   V  R  S   S  Q  Y   S  I  D  H   E  N  G           40

	N  E  F   V  L  R  Y   Y  K  D   A  N  S   R  K  H  M   V  F  W 
	|     |   |  +  |  +   |  |  |   .  |  |   |  |  |  +   |  |  | 
	N  V  F   V  V  R  F   Y  K  D   V  N  S   R  K  H  V   V  F  W           60

	D  G  K   I  A  T  C   S  C  K   Y  F  E   F  W  G  I   L  C  R 
	|  |  |   +  |  |  |   |  |  |      |  |   |  |  |  |   |  |  | 
	D  G  K   V  A  T  C   S  C  K   L  F  E   F  W  G  I   L  C  R           80

	H  I  L   S  I  F  L   H  K  D   C  H  E   I  P  S  N   Y  L  P 
	|  |  |   |  |  |  |   |  |  |   |  |  |   |  |  |  |   |  |  | 
	H  I  L   S  I  F  L   H  K  D   C  H  E   I  P  S  N   Y  L  P          100

	S  R  W   R  L  Q  T   S  H  D   D  D  E   V  D     P   Q  Q  V 
	|  |  |      |  |  .   |  +  |   |  +  +   |  +         |       
	S  R  W   L  L  Q  V   S  Y  D   D  N  D   V  E     S   Q  V  N          120

GTTGTCTTTG AGGAACAAGT C---GAT--- ---------- ---------- ----GTTGTT        1561
	N  V  V   F  E  E  Q      V                                D  V 
	|         |  +                                             | 
	V  V  G   E  E  Q  L   L  D  C   N  N  E   P  Q  P  Q   H  V  V          140

	V  H  C   P  P  P  S   K  T  K   G  R  P   K  R  R  R   L  K  G 
			|        .                       +  |  |            | 
	Y  C  P   P  K  S  K   P  K  G   R  P  K   R  R  R  L   K  G  G          160

	G  K  E   L  S  H  N   M  N  T   C  G  L   C  K  D 
	+            +         .                        
	K  E  L   S  H  N  M   N  T  C   G  L  C   R  G  L                       176

Protein Sequence: file=/PlantGDB/html/tmp/tracembler-1167778359/QRY.fsa, description=IMGA|AC146590_11.2 H EGN_Mt050401 20050623  hypothetical protein

	181  PCC

Genomic Template: file=/PlantGDB/html/tmp/tracembler-1167778359/reads.cap.contigs, strand=-, from=3106, to=1999, description=Contig

Predicted gene structure:

	Exon  1 3105 3053 (  53 n)  Protein     23     39 (  17 aa) score: 0.211
	Intron  1 3052 2837 ( 216 n) Pd: 0.050   Pa: 0.050 
	Exon  2 2836 2633 ( 204 n)  Protein     40    107 (  68 aa) score: 0.886
	Intron  2 2632 2521 ( 112 n) Pd: 0.050   Pa: 0.050 
	Exon  3 2520 2291 ( 230 n)  Protein    108    183 (  76 aa) score: 0.832

MATCH	Contig-	IMGA+	0.790	487	0.887	P
PGS_Contig-_IMGA+	(3105  3053,2836  2633,2520  2291)

Alignment (genomic DNA sequence = upper lines):

	S  L  K   M     I  E   R  I  F   L  L  K   E  G  G  L   S       
	+     |            .   +         |  |      .     |      .       
	N  W  K   K     K  R   K  N  C   L  L  P   N  M  G  Q   E ......          40

.......... .......... .......... .......... .......... ..........          40

.......... .......... .......... .......... .......... ..........          40

.......... .......... .......... .......... .......... ..........          40

									H  I  F   W  S  P  A   S  C  S 
									|  |  |   |  |     |   |  |    
.......... .......... ..........  H  I  F   W  S  S  A   S  C  F           50

	D  W  Y   Q  K  Y  G   D  V  V   V  F  D   T  T  Y  K   V  N  S 
	|  |  |   |  |  |  |   |  |  |   |  |  |   |  |  |  |   |  |  | 
	D  W  Y   Q  K  Y  G   D  V  V   V  F  D   T  T  Y  K   V  N  S           70

	Y  E  M   P  F  G  I   F  V  G   M  N  S   H  G  K  T   V  L  F 
	|  |  |   |  |  |  |   |  |      |  |  +   +  |  |  |   +  |  | 
	Y  E  M   P  F  G  I   F  V  D   M  N  N   Y  G  K  T   I  L  F           90

	G  C  A   L  L  R  N   E  T  I   S  A  F   R  W  L  M   K       
	|  |  |   |  |  |  |   |     +   |  |  |   |  |  |  |   |       
	G  C  A   L  L  R  N   E  M  V   S  A  F   R  W  L  M   K ......         108

.......... .......... .......... .......... .......... ..........         108

													K   P  P  K  T
													|   |  |     |
.......... .......... .......... .......... ...... K   P  P  T  T         113

	I  L  T   D  Q  D   P  W  M  K   E  A  I   S  K  D   L  P  S  T
	|  |  |   +  |  |   |  |  |  |   |  |  |   |  |  +   .  |  |   
	I  L  T   N  Q  D   P  W  M  K   E  A  I   S  K  E   F  P  S  K         133

	K  H  S   F  C  I   W  H  I  T   F  K  F   S  S  W   F  N  A  I
	|  |  |   |     |   |  |  |  |   |  |  |   +  |  |   |  |  |  +
	K  H  S   F  W  I   W  H  I  T   F  K  F   T  S  W   F  N  A  L         153

	L  R  D   K  Y  S   K  W  C  S   D  F  Y   E  L  Y   K  L  E  T
	|  |  |   |  |  +   |  |  |  |   +  |  |   |  |  |   |  |  |  |
	L  R  D   K  Y  A   K  W  C  S   E  F  Y   E  L  Y   K  L  E  T         173

ATGTGAAGAA TTTGAGCATC AATGGCCAA- AAGTTGT                                 2291
	C  E  E   F  E  H   Q  W  P      S  C 
	|  |  |   |  |  |   |  |  |         | 
	C  E  E   F  E  H   Q  W  P      C  C                                   185


Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!