<h2>SRGD</h2>

Gene Groups

Search  
in  



Experimentally identified Arabidopsis snRNAs
BLAST against Arabidopsis genome

snRNAsFrom ecotype
atU1aColumbia
atU2.2, atU2.3, atU2.4, atU2.5, atU2.7, atU2.9Benscheim
atU2.6Landsberg
atU4.1, atU4.2, atU4.3Landsberg
atU5.1Benscheim Be-O
atU6.1, atU6.26, atU6.29Landsberg

The best hit for each snRNA in ecotype columbia was shown here:

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17660|emb|X53175.1|ATU1ASNRN A.thaliana U1a snRNA
         (819 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698605|ref|NC_003076.4|  Arabidopsis thaliana chromosom...   815  0.0
>gi|30698605|ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score =  815 bits (411), Expect = 0.0
 Identities = 432/435 (99%), Gaps = 3/435 (0%)
 Strand = Plus / Minus

                                                                            
Query: 388      ttatagtatgcacttca-tgggcctagag-acatatgggctatggctcatgtgtataaca 445
                ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 19903515 ttatagtatgcacttcaatgggcctagaggacatatgggctatggctcatgtgtataaca 19903456

                                                                            
Query: 446      taaa-ctcatctcgttaaaaagagaccaataggtgtgtgagatgtgttaatttgcagagt 504
                |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903455 taaaactcatctcgttaaaaagagaccaataggtgtgtgagatgtgttaatttgcagagt 19903396

                                                                            
Query: 505      cccacatcgctaagacctgaaagaatgattgaggaagcagagtataactgaagatgtgga 564
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903395 cccacatcgctaagacctgaaagaatgattgaggaagcagagtataactgaagatgtgga 19903336

                                                                            
Query: 565      cagtctgtgaaaattacttacctggacggggtcaacttgtgatcaataagacgagtggcc 624
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903335 cagtctgtgaaaattacttacctggacggggtcaacttgtgatcaataagacgagtggcc 19903276

                                                                            
Query: 625      taggctagtgacctccattgcacataacggaggggtgcttagcttaaggtctccccaagt 684
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903275 taggctagtgacctccattgcacataacggaggggtgcttagcttaaggtctccccaagt 19903216

                                                                            
Query: 685      gggagagcctgcgtcattatttgtggcagagggggcctgcgttcgcgcggtccctaccat 744
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903215 gggagagcctgcgtcattatttgtggcagagggggcctgcgttcgcgcggtccctaccat 19903156

                                                                            
Query: 745      tctttttacatgaaacctttgttaaataaagctgtaaaaggtaatttcttattacgaatt 804
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903155 tctttttacatgaaacctttgttaaataaagctgtaaaaggtaatttcttattacgaatt 19903096

                               
Query: 805      gtaagtttcgaattc 819
                |||||||||||||||
Sbjct: 19903095 gtaagtttcgaattc 19903081
 Score =  482 bits (243), Expect = e-135
 Identities = 278/283 (98%), Gaps = 5/283 (1%)
 Strand = Plus / Minus

                                                                            
Query: 1        gaattcaacaacaaatggaatcagaatcgtaatatcaaccctaaacaaatggaatcga-c 59
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 19903924 gaattcaacaacaaatggaatcagaatcgtaatatcaaccctaaacaaatggaatcgagc 19903865

                                                                            
Query: 60       ttcgattttgaaattttcgtatttctaggtcaagacagcaaagaagagtcaatttcgcgt 119
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903864 ttcgattttgaaattttcgtatttctaggtcaagacagcaaagaagagtcaatttcgcgt 19903805

                                                                            
Query: 120      actgaatagaaggtgtaagatttagaaaagtacctaattcagacgacgag-atcgccatg 178
                |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 19903804 actgaatagaaggtgtaagatttagaaaagtacctaattcagacgacgagaatcgccatg 19903745

                                                                            
Query: 179      gaagagagaaggagaagctgatcagttttgtagtcgtagtactaaagtaggtgattgctg 238
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 19903744 gaagagagaaggagaagctgatcagttttgtagtcgtagtactaaagtaggtga-tgctg 19903686

                                                           
Query: 239      aaccattttagagttaagct-aaccttgcgt-aatctacagta 279
                |||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 19903685 aaccattttagagttaagctaaaccttgcgtaaatctacagta 19903643

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17661|emb|X06473.1|ATU22 Arabidopsis thaliana U2 RNA
gene (U2.2)
         (848 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1431  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1431 bits (722), Expect = 0.0
 Identities = 831/860 (96%), Gaps = 23/860 (2%)
 Strand = Plus / Plus

                                                                            
Query: 7        tatattgatgaagccatgtt-aacgcaattctgtatgagtcagagcatcagtgcatcaat 65
                |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 21357327 tatattgatgaagccatgtttaacgcaattctatatgagtcagagcatcagtgcatcaat 21357386

                                                                            
Query: 66       tca-------gaaaaagttcctccgtttttgctttgaagattctttctcaagtttc-atc 117
                |||       |||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 21357387 tcacagagcagaaaaagttcctccgtttttgctttgaagattctttctcaagtttccatc 21357446

                                                                            
Query: 118      tttcttcttctgggtttacatagttctgtgaaccacagactgtgatcagtggcaacgaac 177
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 21357447 tttcttcttctgggtttacatagttctgtgaatcacagactgtgatcagtggcaacgaac 21357506

                                                                            
Query: 178      acagagaacaaagatgcattaaaagacaaatttattcattgttttgtattgatagttcat 237
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21357507 acagagaacaaagatgcattaaaagacaaatttattcattgttttgtattgatagttcat 21357566

                                                                            
Query: 238      atgtaattgattaaagaagaaatatgcgtaagagaagactaaagagtacatttggctaaa 297
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21357567 atgtaattgattaaagaagaaatatgcgtaagagaagactaaagagtacatttggctaaa 21357626

                                                                            
Query: 298      cccttttttaaaagtcccacatcgacaagctagggatcgttggtcataagctttgtagta 357
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21357627 cccttttttaaaagtcccacatcgacaagctagggatcgttggtcataagctttgtagta 21357686

                                                                            
Query: 358      taaataagaagctgagccattcgttcaattcatacctttctcggccttttggctaagatc 417
                |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||
Sbjct: 21357687 taaataagaagctgagccattcgttctaatcatacctttctcggccttttggctaagatc 21357746

                                                                            
Query: 418      aagtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggctcacacga 477
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21357747 aagtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggctcacacga 21357806

                                                                            
Query: 478      tattaactctatcttttaagggagaaagcccgctatgatagcttgctatctgggcttcca 537
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21357807 tattaactctatcttttaagggagaaagcccgctatgatagcttgctatctgggcttcca 21357866

                                                                            
Query: 538      cgagtcgcccatgcgttgcactactgcacgggcctggctcaacccgccaaactagaagtg 597
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21357867 cgagtcgcccatgcgttgcactactgcacgggcctggctcaacccgccaaactagaagtg 21357926

                                                                            
Query: 598      aaacttttaaaattttagtcacttttgatgtttagtttttaaaaatgatgtaggattctt 657
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 21357927 aaacttttaaaattttagtcacttttgatgtttagttttt-aaaatgatgtaggattctt 21357985

                                                                            
Query: 658      tatcattcaaag---------tccaaaatatacgacaagtaaaaatctgtgaagtagaat 708
                ||||||||||||         ||||||||||||||||||||||||||||||||||| |||
Sbjct: 21357986 tatcattcaaagtccaaaacatccaaaatatacgacaagtaaaaatctgtgaagta-aat 21358044

                                                                            
Query: 709      atatgaacttttgcttgtctctggcaaaaatcgtgaatggtaatgtttcagactcaagcc 768
                |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||
Sbjct: 21358045 atatgaacttttgcttgtctctggcaaaaatc-tgaatggtaatgtttcagactgaagcc 21358103

                                                                            
Query: 769      aaaatggcattggcattgtctctgcgtcattgtgtgtctcatctgcgatctacagtttga 828
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 21358104 aaaatggcattggcattgtctctgcgtca-tgtgtgtctcatctgcgatctacagtttga 21358162

                                    
Query: 829      tccgataatttgcagaattc 848
                |  |||||||||||||||||
Sbjct: 21358163 t-ggataatttgcagaattc 21358181


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17662|emb|X06474.1|ATU23 Arabidopsis thaliana U2 RNA
gene (U2.3)
         (867 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1554  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1554 bits (784), Expect = 0.0
 Identities = 853/871 (97%), Gaps = 5/871 (0%)
 Strand = Plus / Minus

                                                                            
Query: 1        gaattcagtatcgagatacgttacagcatctcgaatctccttagcgatcttcaatcttac 60
                |||||||||||  ||||||||||||||||||  |||||||||||||||||||||||||||
Sbjct: 21409109 gaattcagtatgcagatacgttacagcatctgcaatctccttagcgatcttcaatcttac 21409050

                                                                            
Query: 61       actccaagccaatggcttgattacctcccccgcacctcctatataggcaagacgtccctt 120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Sbjct: 21409049 actccaagccaatggcttgattacctcccccgcacctcctatataggcaagagctccctt 21408990

                                                                            
Query: 121      ttctgggtattcacacacgagaaccggacgaggaaactctagacaacaccccaagagctt 180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408989 ttctgggtattcacacacgagaaccggacgaggaaactctagacaacaccccaagagctt 21408930

                                                                            
Query: 181      gagaacattcttatggctgctcat-atcgatgaaaccgcaatatc--ggtaaaagttgtc 237
                |||||||||||||||||||||||| ||||||||||||||||||||  |||||||||||||
Sbjct: 21408929 gagaacattcttatggctgctcatcatcgatgaaaccgcaatatcacggtaaaagttgtc 21408870

                                                                            
Query: 238      agggtcaaagttaaagggttcatctttatagtacttgatcagcacggctctgttttcaat 297
                |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 21408869 agggtcaaagttaaagggttcacctttatagtacttgatcagcacggctctgttttcaat 21408810

                                                                            
Query: 298      cgtacctttgtaccacacgaatctgtctacaccgattcgatagctccagtcgaagttgtt 357
                |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 21408809 cgtacctttgtaccacacgaatctgtctacaccgattgcatagctccagtcgaagttgtt 21408750

                                                                            
Query: 358      tgtagcttcaaggatttggtgagaagaaaacgtacggatgggattgtatttacctcctga 417
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408749 tgtagcttcaaggatttggtgagaagaaaacgtacggatgggattgtatttacctcctga 21408690

                                                                            
Query: 418      cgatgcaatgagtaaagtcccacatcgacaagttagagagccgtggtcataagcattgta 477
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408689 cgatgcaatgagtaaagtcccacatcgacaagttagagagccgtggtcataagcattgta 21408630

                                                                            
Query: 478      gtataaataagaacgtccgcccatcgtccaaatcatacctttctcggccttttggctaag 537
                |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408629 gtataaataagaagctccgcccatcgtccaaatcatacctttctcggccttttggctaag 21408570

                                                                            
Query: 538      atcaagtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggcccaca 597
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408569 atcaagtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggcccaca 21408510

                                                                            
Query: 598      cgatattaactctattttttaagggagaaagcccactaagatagcttgctatctgggctt 657
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408509 cgatattaactctattttttaagggagaaagcccactaagatagcttgctatctgggctt 21408450

                                                                            
Query: 658      tcacgagtcgcccatgcgttgcactactgcacgggcctggctcaacccgccaagcaaata 717
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 21408449 tcacgagtcgcccatgcgttgcactactgcacgggcctggctcaacccgccaagcaaat- 21408391

                                                                            
Query: 718      aagtcaaaactttttaaaccttactctttatctttcaagtccaaaagctcagaggataaa 777
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408390 aagtcaaaactttttaaaccttactctttatctttcaagtccaaaagctcagaggataaa 21408331

                                                                            
Query: 778      agtgaatggag-aaaacttcgttaaataacgttttctgtaattatctatcttcctgtaga 836
                ||||||||||| ||||||  ||||||||||||||||||||||||||||||||||||||||
Sbjct: 21408330 agtgaatggagaaaaactctgttaaataacgttttctgtaattatctatcttcctgtaga 21408271

                                               
Query: 837      aaatcagagatatttatatatgttacgcagg 867
                |||||||||||||||||||||||||||||||
Sbjct: 21408270 aaatcagagatatttatatatgttacgcagg 21408240

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17663|emb|X06475.1|ATU24 Arabidopsis thaliana U2 RNA
gene (U2.4)
         (884 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1437  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1437 bits (725), Expect = 0.0
 Identities = 846/879 (96%), Gaps = 13/879 (1%)
 Strand = Plus / Minus

                                                                            
Query: 11       aaccttcgaacctaccaaaggccagtcaccagcaaacaatactcgagacttgtctttaat 70
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21053576 aaccttcgaacctaccaaaggccagtcaccagcaaacaatactcgagacttgtctttaat 21053517

                                                                            
Query: 71       acctg--atatgattctcagtcgaagcatcattgaactcgagatcgataattataaaaac 128
                ||||   |||||||||||||||||||||||||||||||  ||||||||||||||||||||
Sbjct: 21053516 accttgtatatgattctcagtcgaagcatcattgaactgcagatcgataattataaaaac 21053457

                                                                            
Query: 129      gttgatccctgaaacatcttccacaaa-cagacttttgaagtaatttcgaaaatttccac 187
                ||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||
Sbjct: 21053456 gttgatccctgaaacatcttccacttttcagacttttgaagtaatttcgaaaatttccac 21053397

                                                                            
Query: 188      ctttcttctttaggaggatccagcnnnnnnnnnnaacacacactcatcaaattccagttt 247
                ||||||||||||||||||||||||          ||||||||||||||||||||||||||
Sbjct: 21053396 ctttcttctttaggaggatccagcttttttttttaacacacactcatcaaattccagttt 21053337

                                                                            
Query: 248      tcctctgtgcgcacagatcagatcactgatcttgaagtatcaccagctcacaatttctta 307
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 21053336 tcctctgtgcgcacagatcagatcactgatcttcaagtatcaccagctcacaatttctta 21053277

                                                                            
Query: 308      tggtctttcctagtgctgcaattgatctcaaa-gagcacacagaggcagaaggcaagata 366
                |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 21053276 tggtctttcctagtgctgcaattgatctcaaaagagcacacagaggcagaag-caagata 21053218

                                                                            
Query: 367      gtttcaaaccatgacgacgttgtcaaaatctccgacaagaaccagatg-ctaagcccatg 425
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 21053217 gtttcaaaccatgacgacgttgtcaaaatctccgacaagaaccagatggctaagcccatg 21053158

                                                                            
Query: 426      acatatattgaaccagatgtctaatgtctcttattgatatgttcgcgtttgcttatagat 485
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21053157 acatatattgaaccagatgtctaatgtctcttattgatatgttcgcgtttgcttatagat 21053098

                                                                            
Query: 486      gcgtaaagagtctatttttctaaacgtcccacatcgacaagttagagagcattggtcata 545
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21053097 gcgtaaagagtctatttttctaaacgtcccacatcgacaagttagagagcattggtcata 21053038

                                                                            
Query: 546      agatgtgtaatatataaagaaagctgagccaattgtccaattcatacctttctcggcctt 605
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 21053037 agatgtgtaatatataaagaaagctgagcccattgtccaattcatacctttctcggcctt 21052978

                                                                            
Query: 606      ttggctaagatcaagtgtagtatctgttcttatcagtttaatatctgatatgtgggccat 665
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21052977 ttggctaagatcaagtgtagtatctgttcttatcagtttaatatctgatatgtgggccat 21052918

                                                                            
Query: 666      cggcccacacgatattaactctattttttaagggagaaagcccactaagatagcttgcta 725
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21052917 cggcccacacgatattaactctattttttaagggagaaagcccactaagatagcttgcta 21052858

                                                                            
Query: 726      tctgggctttcaagagtcgcccatgcgttgcactactgcaagggctggctcaacccgcca 785
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21052857 tctgggctttcaagagtcgcccatgcgttgcactactgcaagggctggctcaacccgcca 21052798

                                                                            
Query: 786      gctaaccagtcaaattttcgactcatctctaattaatcaaactctataaaaccaaaactt 845
                |||||||||||||||||| | |   |||||||||||||||||||||||||||  ||| ||
Sbjct: 21052797 gctaaccagtcaaatttt-gtc---tctctaattaatcaaactctataaaac--aaaatt 21052744

                                                       
Query: 846      aattaattaacaccaaatcaacaatgaacagaggaagat 884
                ||||||||||||||||||||| |||||||||||||||||
Sbjct: 21052743 aattaattaacaccaaatcaa-aatgaacagaggaagat 21052706


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17664|emb|X06476.1|ATU25 Arabidopsis thaliana U2 RNA
gene (U2.5)
         (748 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698605|ref|NC_003076.4|  Arabidopsis thaliana chromosom...  1283  0.0
>gi|30698605|ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 1283 bits (647), Expect = 0.0
 Identities = 707/731 (96%), Gaps = 2/731 (0%)
 Strand = Plus / Plus

                                                                           
Query: 9       gattgaagttgaaagttgagtcgattcctttcttgagccggttttgatttagattagttt 68
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2974564 gattgaagttgaaagttgagtcgattcctttcttgagccggttttgatttagattagttt 2974623

                                                                           
Query: 69      gggcacagctacagctacatgtaaggcggtgaaatcgaacggcctaaaattgagaacgca 128
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2974624 gggcacagctacagctacatgtaaggcggtgaaatcgaacggcctaaaattgagaacgca 2974683

                                                                           
Query: 129     acaagtgtacatgtctactccagttattcttgattttgtttattctcnnnnnnnnnnnng 188
               |||||||||||||||||||||||||||||||||||||||||||||||            |
Sbjct: 2974684 acaagtgtacatgtctactccagttattcttgattttgtttattctcttttttttttttg 2974743

                                                                           
Query: 189     tcaaagtatcttgagccgttttctctggatttttatttgactcgctcttcttttcttgct 248
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2974744 tcaaagtatcttgagccgttttctctggatttttatttgactcgctcttcttttcttgct 2974803

                                                                           
Query: 249     atccaaaaaaggttaaaagaagttg-aagcttgtttggcttgaggtttaagactatcatc 307
               ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||
Sbjct: 2974804 atccaaaaaaggttaaaagaagttggaagcttgtttggcttcaggtttaagactatcatc 2974863

                                                                           
Query: 308     aatcaggcgttgttacgaaacccgctaaaagagaaagagggttatagttatttagtttca 367
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2974864 aatcaggcgttgttacgaaacccgctaaaagagaaagagggttatagttatttagtttca 2974923

                                                                           
Query: 368     ctcgttcacgaagtcccacatcgctaagaaaagaacgtgaaagaaaaaac-agtggtata 426
               ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2974924 ctcgttcgcgaagtcccacatcgctaagaaaagaacgtgaaagaaaaaacgagtggtata 2974983

                                                                           
Query: 427     aagtacgaggccatggcactcagcaaatcatacctttctcggccttttggctaagatcaa 486
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2974984 aagtacgaggccatggcactcagcaaatcatacctttctcggccttttggctaagatcaa 2975043

                                                                           
Query: 487     gtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggcccacacgata 546
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2975044 gtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggcccacacgata 2975103

                                                                           
Query: 547     ttaactctattttttaagggaggaagcccgtttagatagcttgctatctgggctttcacg 606
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2975104 ttaactctattttttaagggaggaagcccgtttagatagcttgctatctgggctttcacg 2975163

                                                                           
Query: 607     agtctcccatgcgttgcactattgcgagggcttggctcaacccgccatttattcagtcta 666
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2975164 agtctcccatgcgttgcactattgcgagggcttggctcaacccgccatttattcagtcta 2975223

                                                                           
Query: 667     aggaaatnnnnnnnngctaaagtgattaaatcgaaaagccaaataaaatccatgaacgtc 726
               |||||||        |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2975224 aggaaataaaaaaaagctaaagtgattaaatcgaaaagccaaataaaatccatgaacgtc 2975283

                          
Query: 727     cgtctttcttg 737
               |||||||||||
Sbjct: 2975284 cgtctttcttg 2975294


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17665|emb|X52312.1|ATU26 Arabidopsis thaliana U2.6
snRNA gene for U2 snRNA
         (550 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1074  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1074 bits (542), Expect = 0.0
 Identities = 548/550 (99%)
 Strand = Plus / Plus

                                                                            
Query: 1        tttgaggattttttcttaagtttccgtctctcttcttctgggtttacatagttctgtgat 60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015238 tttgaggattttttcttaagtttccgtctctcttcttctgggtttacatagttctgtgat 21015297

                                                                            
Query: 61       caatgccaaataacgcacagagataatttctcttattgttttgttgattaaagaagaaat 120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015298 caatgccaaataacgcacagagataatttctcttattgttttgttgattaaagaagaaat 21015357

                                                                            
Query: 121      tatgagtaatagaagactaaagcctattttcttaacgtcccacatcgacaagttagagag 180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015358 tatgagtaatagaagactaaagcctattttcttaacgtcccacatcgacaagttagagag 21015417

                                                                            
Query: 181      cgttggtcataagctttgtaatatataaaggaagctgagccaaacgttcaattcatacct 240
                |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 21015418 cgttggtcataagctttgtaatatataaaggaagctgagccaaacgttcacttcatacct 21015477

                                                                            
Query: 241      ttctcggccttttggctaagatcaagtgtagtatctgttcttatcagtttaatatctgat 300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015478 ttctcggccttttggctaagatcaagtgtagtatctgttcttatcagtttaatatctgat 21015537

                                                                            
Query: 301      atgtgggccatcggcccacacgatattaactctattttttgagggagaaagcccactaag 360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015538 atgtgggccatcggcccacacgatattaactctattttttgagggagaaagcccactaag 21015597

                                                                            
Query: 361      atagcttgctatctgggctttcaagagtcgcctatgcgttgcactactgcacaggcttgg 420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015598 atagcttgctatctgggctttcaagagtcgcctatgcgttgcactactgcacaggcttgg 21015657

                                                                            
Query: 421      ctcaacccgccaaatttatagttgaagtgttgaactttcaatcttgttgataagggataa 480
                ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 21015658 ctcaacccgccaaatttatagttgaagtgttgaactttcaaacttgttgataagggataa 21015717

                                                                            
Query: 481      aatgtgaatacagaaattaattcggattctcaaacagttattaaagtattgtgagatttg 540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21015718 aatgtgaatacagaaattaattcggattctcaaacagttattaaagtattgtgagatttg 21015777

                          
Query: 541      ataagtaaat 550
                ||||||||||
Sbjct: 21015778 ataagtaaat 21015787

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top


BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17666|emb|X06477.1|ATU27 Arabidopsis thaliana U2 RNA
gene (U2.7)
         (842 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698605|ref|NC_003076.4|  Arabidopsis thaliana chromosom...  1509  0.0
>gi|30698605|ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 1509 bits (761), Expect = 0.0
 Identities = 815/831 (98%), Gaps = 5/831 (0%)
 Strand = Plus / Minus

                                                                            
Query: 16       aatgtccatagtt-ctgattcttt--ggcaagtttaagtacatcctgaatgttcgataaa 72
                ||||||||||||| ||||||||||  ||||||||||||||||||||||||||||||||||
Sbjct: 24731319 aatgtccatagtttctgattctttttggcaagtttaagtacatcctgaatgttcgataaa 24731260

                                                                            
Query: 73       ggctagtgtcatcaacatctctaatacatatgacagccaaggagcatccattgaaaaatg 132
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24731259 ggctagtgtcatcaacatctctaatacatatgacagccaaggagcatccattgaaaaatg 24731200

                                                                            
Query: 133      aggcaataaaattgagtacttataaactgttcatacttcttttctacctttgacgttgta 192
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24731199 aggcaataaaattgagtacttataaactgttcatacttcttttctacctttgacgttgta 24731140

                                                                            
Query: 193      aatgttaaatttatgaacttaagaatgtcattgctacnnnnnnnnnncaatgtgattgct 252
                |||||||||||||||||||||||||||||||||||||          |||||||||||||
Sbjct: 24731139 aatgttaaatttatgaacttaagaatgtcattgctacaaaaaaaaa-caatgtgattgct 24731081

                                                                            
Query: 253      atgcaatatacatgtaatttgaatataaatcttggtccggttacgctaaaccaaaatctg 312
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24731080 atgcaatatacatgtaatttgaatataaatcttggtccggttacgctaaaccaaaatctg 24731021

                                                                            
Query: 313      atattatctgggctacgtgtggattaaaaatccgattagggggagtcgtgcaaagcccac 372
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24731020 atattatctgggctacgtgtggattaaaaatccgattagggggagtcgtgcaaagcccac 24730961

                                                                            
Query: 373      taaaagaaacaggcggtttgttttattttaaataacttttaactcgttccaaagtcccac 432
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24730960 taaaagaaacaggcggtttgttttattttaaataacttttaactcgttccaaagtcccac 24730901

                                                                            
Query: 433      atcgctaacaatttaagaggtgaagacaagacgagtagtataaataacgag-ccacggcc 491
                ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 24730900 atcgctaacaatttaagaggtgaagacaagacgagtagtataaataacgaggccacggcc 24730841

                                                                            
Query: 492      acgaacaattcatacctttctcggccttttggctaagatcaagtgtagtatctgttctta 551
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24730840 acgaacaattcatacctttctcggccttttggctaagatcaagtgtagtatctgttctta 24730781

                                                                            
Query: 552      tcagtttaatatctgatatgtgggccatcggcccacacgatattaactctattttttaag 611
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24730780 tcagtttaatatctgatatgtgggccatcggcccacacgatattaactctattttttaag 24730721

                                                                            
Query: 612      ggagaaaacccactaaggtagcttgctatctgggttttcacgagtcgcccatgcgttgca 671
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24730720 ggagaaaacccactaaggtagcttgctatctgggttttcacgagtcgcccatgcgttgca 24730661

                                                                            
Query: 672      ctactgcacgggcctggctcatcccgccaataaaccagtaaaattataaatattggaaat 731
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24730660 ctactgcacgggcctggctcatcccgccaataaaccagtaaaattataaatattggaaat 24730601

                                                                            
Query: 732      ctgccactatgttgtagatttgggcttagggacctaaataaataacgccatgtaactggt 791
                |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Sbjct: 24730600 ctgccactatgttgtagatttgggcttagggacctaaataaataacgttatgtaactggt 24730541

                                                                   
Query: 792      ggatgaccgttgaaaccctcatacgcgatgcacatggttaggatagaattc 842
                |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24730540 ggatgaccgttgaaaccctcatacgcgatgcacatggttaggatagaattc 24730490

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17667|emb|X06478.1|ATU29 Arabidopsis thaliana U2 RNA
gene (U2.9)
         (359 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698542|ref|NC_003075.3|  Arabidopsis thaliana chromosom...   309  2e-83
>gi|30698542|ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
          Length = 18585042

 Score =  309 bits (156), Expect = 2e-83
 Identities = 218/239 (91%), Gaps = 6/239 (2%)
 Strand = Plus / Plus

                                                                          
Query: 121    agtcccacatcgacaagctagagagagtttgtcataaccttagtagtataagtaagaagc 180
              |||||||||| |||||| ||||||| ||| |||||||  |||||||||      ||||||
Sbjct: 815200 agtcccacatggacaagatagagagcgttggtcataagtttagtagta------agaagc 815253

                                                                          
Query: 181    tgagcccatcgaaaaattcatacctttctcggccttttggctaagatcaagtgtagtatc 240
              ||||||| | |   || |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 815254 tgagccctttggttaactcatacctttctcggccttttggctaagatcaagtgtagtatc 815313

                                                                          
Query: 241    tgttcttatcagtttaatatctgatatgtgggccatcggcccacacgatattaactctat 300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 815314 tgttcttatcagtttaatatctgatatgtgggccatcggcccacacgatattaactctat 815373

                                                                         
Query: 301    tttttaagggagaaagcccgttaagatagcttgctatctgggctttcgcgagtcgccca 359
              ||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||
Sbjct: 815374 tttttaagggagaaagcccgttaagatagcttgctatctaggctttcacgagtccccca 815432
 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 91/104 (87%), Gaps = 5/104 (4%)
 Strand = Plus / Plus

                                                                          
Query: 3      ttagagccgacaagtaccagatg-ctaagcccatgacgaaagttgaagcagatgtctgat 61
              |||||||| |||||||||||||| |||| |||||||| || |||||| |  |||||| ||
Sbjct: 815100 ttagagcccacaagtaccagatggctaaacccatgacaaaggttgaaacc-atgtctaat 815158

                                                          
Query: 62     gtcttattgatttgt-cgcgtttgctcatagagatgcgtaaaaa 104
              ||||||||||||||| |||||||||||  | |||||||||||||
Sbjct: 815159 gtcttattgatttgtccgcgtttgctc--acagatgcgtaaaaa 815200


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= gi|17673|emb|X67145.1|ATU41SN A.thaliana U4.1 snRNA gene (427 letters) Database: /DATA/GENOME_NEW/Arath/ATGall.fsa 7 sequences; 119,769,761 total letters Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698605|ref|NC_003076.4|  Arabidopsis thaliana chromosom...   674  0.0
>gi|30698605|ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score =  674 bits (340), Expect = 0.0
 Identities = 343/344 (99%)
 Strand = Plus / Minus

                                                                            
Query: 78       gaattcgattgtgtttatttattgtattggtacaagaataccacatcggaagaacgcatc 137
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903086 gaattcgattgtgtttatttattgtattggtacaagaataccacatcggaagaacgcatc 19903027

                                                                            
Query: 138      aagttggtcggttttgtttggatataaataaagaggcttgtgtttgaaacaaacttatct 197
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19903026 aagttggtcggttttgtttggatataaataaagaggcttgtgtttgaaacaaacttatct 19902967

                                                                            
Query: 198      ttgcgcttggggcaatgacgcagctaatgaggttctaaccgaggcgcgtctattgctggt 257
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19902966 ttgcgcttggggcaatgacgcagctaatgaggttctaaccgaggcgcgtctattgctggt 19902907

                                                                            
Query: 258      tgaaaactatttccaaaccccctcctaggcctaagcttgtcttaggccttcgagaatttc 317
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 19902906 tgaaaactatttccaaaccccctcctaggcctaagcttgtcttgggccttcgagaatttc 19902847

                                                                            
Query: 318      tggaagggctccctttggggtaaagccctacaattttcagttcaatttttagttgtggca 377
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19902846 tggaagggctccctttggggtaaagccctacaattttcagttcaatttttagttgtggca 19902787

                                                            
Query: 378      ttgtgtctctctttctcgaagggctcagtgaatttgtggaagac 421
                ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19902786 ttgtgtctctctttctcgaagggctcagtgaatttgtggaagac 19902743


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17674|emb|X67146.1|ATU42SN A.thaliana U4.2 snRNA gene
         (579 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1074  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1074 bits (542), Expect = 0.0
 Identities = 571/580 (98%), Gaps = 8/580 (1%)
 Strand = Plus / Minus

                                                                           
Query: 1       ttccctgcaagtgatcgaaagacccctggatcttcagtaactacaaagctacagagttat 60
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 2178631 ttccctgcaagtgatcgaaagacccttggatcttcagtaactacaaagctacagagttat 2178572

                                                                           
Query: 61      atatgtgaacgaatcttgtcgctttcagatttcagatttaaagttgtattgagaaagaag 120
               ||||||||||||||||||||||||||||||||       |||||||||||||||||||||
Sbjct: 2178571 atatgtgaacgaatcttgtcgctttcagattt-------aaagttgtattgagaaagaag 2178519

                                                                           
Query: 121     aggttgccgtcttctggtagagacttggagaagaagagagtctgttcaattcatctagcg 180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178518 aggttgccgtcttctggtagagacttggagaagaagagagtctgttcaattcatctagcg 2178459

                                                                           
Query: 181     aataggtttctttctagaataatataactagagggagtcccacatcgaaaagaaattgta 240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178458 aataggtttctttctagaataatataactagagggagtcccacatcgaaaagaaattgta 2178399

                                                                           
Query: 241     agatggttggttttgttcgggtataaataaagagggtttagttcggttgaaagtcatctt 300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178398 agatggttggttttgttcgggtataaataaagagggtttagttcggttgaaagtcatctt 2178339

                                                                           
Query: 301     tgcgcttggggcaatgacgcagctaatgaggtactaaccgaggcgcgtctattgctggtt 360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178338 tgcgcttggggcaatgacgcagctaatgaggtactaaccgaggcgcgtctattgctggtt 2178279

                                                                           
Query: 361     gaaaactatttccaaaccccctcctgggcctaagcttgtcttgggccttcgagaatttct 420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178278 gaaaactatttccaaaccccctcctgggcctaagcttgtcttgggccttcgagaatttct 2178219

                                                                           
Query: 421     ggaagggctccctttg-ggtaaagccctacaataactagtctaaatgtttttcgagtttt 479
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178218 ggaagggctccctttggggtaaagccctacaataactagtctaaatgtttttcgagtttt 2178159

                                                                           
Query: 480     gaaatttagaaaatcaaatatcatggaaagtatatatcacacaatctaggcccaagaaaa 539
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178158 gaaatttagaaaatcaaatatcatggaaagtatatatcacacaatctaggcccaagaaaa 2178099

                                                       
Query: 540     catcacttgctgatgatgaggcctgatagtgaaaattgaa 579
               ||||||||||||||||||||||||||||||||||||||||
Sbjct: 2178098 catcacttgctgatgatgaggcctgatagtgaaaattgaa 2178059


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17675|emb|X67147.1|ATU43SN A.thaliana U4.3 snRNA
pseudogene
         (448 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698605|ref|NC_003076.4|  Arabidopsis thaliana chromosom...   333  2e-90
>gi|30698605|ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score =  333 bits (168), Expect = 2e-90
 Identities = 270/301 (89%), Gaps = 16/301 (5%)
 Strand = Plus / Minus

                                                                            
Query: 1        gcagaggggtcatccgttagcgcggtcactaccattaatggttttagtttgttttttcca 60
                ||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||
Sbjct: 20112307 gcagaggggtcatgcgttagcgcggtcactaccattaatagttttagttttttttttcca 20112248

                                                                            
Query: 61       tgtttccatttctaagttttaagtgataaggtaattgactaagttcttctttttggaatg 120
                |||||||||||||||||||||||| ||||||||||||||||||||||  | |||||||||
Sbjct: 20112247 tgtttccatttctaagttttaagttataaggtaattgactaagttct--tatttggaatg 20112190

                                                                            
Query: 121      ccaagttttgaatatgttaaagttattgttatggtatacagtcctacatcggaaaaatgc 180
                ||||||||||||||||||||||||||| || ||||||||||||||||| ||| |||||||
Sbjct: 20112189 ccaagttttgaatatgttaaagttattattttggtatacagtcctacaacgg-aaaatgc 20112131

                                                                            
Query: 181      atcaagtaggtcgcttttgttttgatataaataaagaggtttgtgttgaaagaaacttat 240
                ||||||||  ||| ||||||||||||||     |||||||||||||||||  ||||||||
Sbjct: 20112130 atcaagtaaatcggttttgttttgatat-----aagaggtttgtgttgaacaaaacttat 20112076

                                                                            
Query: 241      cgttgcgcttggacaatgacacatctaatgaggttctaaccgagatgcgtctatgctggt 300
                       ||||| |||||||||||||||||||||||||||||||  ||||||||||||||
Sbjct: 20112075 -------cttgg-caatgacacatctaatgaggttctaaccgaggcgcgtctatgctggt 20112024

                 
Query: 301      t 301
                |
Sbjct: 20112023 t 20112023
 
 Score = 99.6 bits (50), Expect = 5e-20
 Identities = 53/54 (98%)
 Strand = Plus / Minus

                                                                      
Query: 391      ttcaaatgtatatttttctcaagttatggcattgagtcttcttatgacctaagg 444
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 20111992 ttcaaatgtatatttttctcaagttatggcattgagtcttcttctgacctaagg 20111939


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|17676|emb|X13012.1|ATU5RNA Arabidopsis thaliana DNA
for U5 small nuclear RNA
         (1275 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...   856  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score =  856 bits (432), Expect = 0.0
 Identities = 800/909 (88%), Gaps = 38/909 (4%)
 Strand = Plus / Minus

                                                                            
Query: 2        aagtagttcaactaactaatgctgatttacacagatactatatctctatttctgatcacc 61
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20741278 aagtagttcaactaactaatgctgatttacacagatactatatctctatttctgatcacc 20741219

                                                                            
Query: 62       aaagatcagaagaccaaaaagaagcaaagttttggannnnnnnncttagataggcattca 121
                |||||||||||||| ||||||||||||||||| |||        ||||||||||| ||||
Sbjct: 20741218 aaagatcagaagac-aaaaagaagcaaagttt-ggattgtttttcttagataggctttca 20741161

                                                                            
Query: 122      caagattagaatttagtaaccattgagaca----agaccaacatgattctgtgagtagct 177
                ||||||||||||| ||||||||||||||||    |||||||| ||| ||||||| |||||
Sbjct: 20741160 caagattagaattaagtaaccattgagacatgcaagaccaacctgagtctgtgattagct 20741101

                                                                            
Query: 178      gtcaatgttctcttccaagaagct-atatacatcaccg-ttagaagagaactcatacatt 235
                |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 20741100 gtcaatgttctcttccaagaagctcatatacatcaccggttagaagagaactcatacatt 20741041

                                                                            
Query: 236      ttccctctaacaaataattagtaccttatgaacgcttggcagaatttgcataaaacatta 295
                |||||||||||||||||   ||||||||||||| ||||||||||||||||||||||    
Sbjct: 20741040 ttccctctaacaaataa---gtaccttatgaacacttggcagaatttgcataaaac---- 20740988

                                                                            
Query: 296      aactccaaggcaacttcaac--tataaggttccacataagttacagtgctcaaaaattgc 353
                   |||||||||||||||||  ||||||||||||||||||| |||||||||||||| |||
Sbjct: 20740987 ---tccaaggcaacttcaacgttataaggttccacataagtcacagtgctcaaaaaatgc 20740931

                                                                            
Query: 354      ttgtccttgagaatctgttcaactccaagaccagcaaagctcccaaaatttactaatctc 413
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 20740930 ttgtccttgagaatctgttcaactccaagaccagcaaagctcccaaaatttactgatctc 20740871

                                                                            
Query: 414      tgtcctctatat--atgtgttggttatatgtatatcagtgacttagcttatacgaaatta 471
                ||||||||||||  ||| ||||||| ||| |||  |||||| ||||||||||||||||||
Sbjct: 20740870 tgtcctctatatatatgggttggttgtatatat-ccagtgatttagcttatacgaaatta 20740812

                                                                            
Query: 472      gcattgtacagtcgtcagttaaaatgggcccgtatcaataaaacctgaatttgttggtga 531
                 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 20740811 acattgtacagtcgtcagttaaaatgggcccgtatcaacaaaacctgaatttgttggtga 20740752

                                                                            
Query: 532      tgttnnnnnnnntgtttatgggctttcgagtatcctacaaagcc-ttttaacaagggaac 590
                  ||        ||||| |||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 20740751 cattaaaaaaaatgtttttgggcttttgagtatcctacaaagcctttttaacaaggcaac 20740692

                                                                            
Query: 591      ttcaagtatcccacatcggaaagctaagagacggtgatagaggaaatgatagtataaata 650
                ||||||||||||||||||||||||||  |||   | || | |||||||||||||||||||
Sbjct: 20740691 ttcaagtatcccacatcggaaagcta--agattttcatcgtggaaatgatagtataaata 20740634

                                                                            
Query: 651      aacttcactctcctgggagtaaaaatcacgcagccatgtggtgagtacaaagcgaactat 710
                 |||||||||| | |   | |||| |||||||||||||||||||| ||||||||||||| 
Sbjct: 20740633 cacttcactct-cagcatgaaaaattcacgcagccatgtggtgagcacaaagcgaacta- 20740576

                                                                            
Query: 711      ttctttcgccttttactaaagaataccgtgtgctctcgacgctaagt-gcatacgcctat 769
                 |||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||
Sbjct: 20740575 ctctttcgccttttactaaagaataccgtgtgctctccacgccaagtggcatacgcctat 20740516

                                                                            
Query: 770      ttttggagggctc-cacttctctgtggaacccaacatttacactagtctaaatatcaatt 828
                ||||||||||||| ||| |   ||||  |||||| | || |  |||||| ||||| ||||
Sbjct: 20740515 ttttggagggctctcacgtaaatgtgagacccaatagtttc--tagtctgaatattaatt 20740458

                                                                            
Query: 829      tattttcttgtcttgctccaatcccctgattggattgcaagtactaaagtccagtagtta 888
                ||||||  ||||||||||     ||||| |||||| |||||| |||||| ||||| ||||
Sbjct: 20740457 tatttt-atgtcttgctc-----ccctgtttggatagcaagttctaaagcccagtggtta 20740404

                         
Query: 889      aagaatata 897
                |||||||||
Sbjct: 20740403 aagaatata 20740395

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|16516|emb|X52527.1|ATSNU61 Arabidopsis thaliana U6-1
snRNA gene
         (795 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1433  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1433 bits (723), Expect = 0.0
 Identities = 774/794 (97%), Gaps = 2/794 (0%)
 Strand = Plus / Plus

                                                                           
Query: 1       agaaatctcaaaattccggcagaacaattttgaatctcgatccgtagaaacgagacggtc 60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951292 agaaatctcaaaattccggcagaacaattttgaatctcgatccgtagaaacgagacggtc 4951351

                                                                           
Query: 61      attgttttagttccaccacgattatatttgaaatttacgctgagtgtgagtgagacttgc 120
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 4951352 attgttttagttccaccacgattatatttgaaatttacg-tgagtgtgagtgagacttgc 4951410

                                                                           
Query: 121     ataagaaaataaaatctttagttgggaaaaaattcaataatataaatgggcttgagaagg 180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951411 ataagaaaataaaatctttagttgggaaaaaattcaataatataaatgggcttgagaagg 4951470

                                                                           
Query: 181     aagcgagggataggcctttttctaaaataggcccatttaagctattaacaatcttcaaaa 240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951471 aagcgagggataggcctttttctaaaataggcccatttaagctattaacaatcttcaaaa 4951530

                                                                           
Query: 241     gtaccacatcgcttaggtaaagaaagcagctgagtttatatatggttagagacgaagtag 300
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951531 gtaccacagcgcttaggtaaagaaagcagctgagtttatatatggttagagacgaagtag 4951590

                                                                           
Query: 301     tgattgtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggc 360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951591 tgattgtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggc 4951650

                                                                           
Query: 361     ccctgcgcaaggatgacacgcataaatcgagaaatggtccaaannnnnnnnggcaaaaat 420
               |||||||||||||||||||||||||||||||||||||||||||        |||||||||
Sbjct: 4951651 ccctgcgcaaggatgacacgcataaatcgagaaatggtccaaattttttttggcaaaaat 4951710

                                                                           
Query: 421     tttcagattttttcttcatctgtagatttctgggnnnnnnnnnccgtttcggtgaatcat 480
               ||||||||||||||||||||||||||||||||||         |||||||| ||||||||
Sbjct: 4951711 tttcagattttttcttcatctgtagatttctgggtttttttttccgtttcg-tgaatcat 4951769

                                                                           
Query: 481     aagtgaagttttggatgcaaatctgcgcgaaaaaagttggacctgcaatgagcttattta 540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951770 aagtgaagttttggatgcaaatctgcgcgaaaaaagttggacctgcaatgagcttattta 4951829

                                                                           
Query: 541     gatagctaagacaaagtgattggtccgttgtttcagttctgattgtcagagagtttgttt 600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951830 gatagctaagacaaagtgattggtccgttgtttcagttctgattgtcagagagtttgttt 4951889

                                                                           
Query: 601     cgagacggcgacaccaatgcgttttgttaaccagatttcgggtaagaaatgtatcgagag 660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951890 cgagacggcgacaccaatgcgttttgttaaccagatttcgggtaagaaatgtatcgagag 4951949

                                                                           
Query: 661     tttgtttcgagacggctacatcattttcttatgaagggtgaaattagatagaccaaagat 720
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4951950 tttgtttcgagacggctacatcattttcttatgaagggtgaaattagatagaccaaagat 4952009

                                                                           
Query: 721     tgaaacacaacatttctttcacaaaaatataataaacttgatagcatttaggatcagcta 780
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4952010 tgaaacacaacatttctttcacaaaaatataataaacttgatagcatttaggatcagcta 4952069

                             
Query: 781     ctctcactaatcag 794
               ||||||||||||||
Sbjct: 4952070 ctctcactaatcag 4952083


U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|16517|emb|X52528.1|ATSNU626 Arabidopsis thaliana
U6-26 snRNA gene
         (914 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698537|ref|NC_003074.4|  Arabidopsis thaliana chromosom...  1598  0.0
>gi|30698537|ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 1598 bits (806), Expect = 0.0
 Identities = 876/910 (96%)
 Strand = Plus / Plus

                                                                           
Query: 5       ttcgttgaacaacggaaactcgacttgccttccgcacaatacatcatttcttcttagcnn 64
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  
Sbjct: 4560667 ttcgttgaacaacggaaactcgacttgccttccgcacaatacatcatttcttcttagctt 4560726

                                                                           
Query: 65      nnnnncttcttcttcgttcatacagnnnnnnnnngtttatcagcttacattttcttgaac 124
                    ||||||||||||||||||||         ||||||||||||||||||||||||||
Sbjct: 4560727 tttttcttcttcttcgttcatacagtttttttttgtttatcagcttacattttcttgaac 4560786

                                                                           
Query: 125     cgtagctttcgttttcttctttttaactttccattcggagtttttgtatcttgtttcata 184
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4560787 cgtagctttcgttttcttctttttaactttccattcggagtttttgtatcttgtttcata 4560846

                                                                           
Query: 185     gtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaac 244
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4560847 gtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaac 4560906

                                                                           
Query: 245     atcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaaga 304
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4560907 atcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaaga 4560966

                                                                           
Query: 305     gaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagt 364
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4560967 gaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagt 4561026

                                                                           
Query: 365     tgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatat 424
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561027 tgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatat 4561086

                                                                           
Query: 425     acagctagagtcgaagtagtgattgtcccttcggggacatccgataaaattggaacgata 484
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 4561087 acagctagagtcgaagtagtgattgtcccttaggggacatccgataaaattggaacgata 4561146

                                                                           
Query: 485     cagagaagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtcca 544
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561147 cagagaagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtcca 4561206

                                                                           
Query: 545     aannnnnnnngcaaaattttccagatcgatttcttcttcctctgttcttcggcgttcaat 604
               ||        ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561207 aattttttttgcaaaattttccagatcgatttcttcttcctctgttcttcggcgttcaat 4561266

                                                                           
Query: 605     ttctgggtttttctcttcgttttctgtaactgaaacctaaaatttgacctnnnnnnnntc 664
               ||||||| ||||||||||||||||||||||||||||||||||||||||||        ||
Sbjct: 4561267 ttctggggttttctcttcgttttctgtaactgaaacctaaaatttgacctaaaaaaaatc 4561326

                                                                           
Query: 665     tcaaataatatgattcagtggttttgtacttttcagttagttgagttttgcagttccgat 724
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561327 tcaaataatatgattcagtggttttgtacttttcagttagttgagttttgcagttccgat 4561386

                                                                           
Query: 725     gagataaaccaataactttgcttagatctaattcattccgttacacctctgatggagatg 784
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561387 gagataaaccaataactttgcttagatctaattcattccgttacacctctgatggagatg 4561446

                                                                           
Query: 785     gaaggttcttaataatgatgccattttttgggtaataattttgaattagaatcaagggta 844
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561447 gaaggttcttaataatgatgccattttttgggtaataattttgaattagaatcaagggta 4561506

                                                                           
Query: 845     taagattcataattaacatcacttaagcaaagttcgtaatatacgaccacaggatataat 904
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4561507 taagattcataattaacatcacttaagcaaagttcgtaatatacgaccacaggatataat 4561566

                         
Query: 905     ttttgaattc 914
               ||||||||||
Sbjct: 4561567 ttttgaattc 4561576

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

BLASTN 2.1.2 [Oct-19-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|16518|emb|X52529.1|ATSNU629 Arabidopsis thaliana
U6-29 snRNA gene
         (855 letters)

Database: /DATA/GENOME_NEW/Arath/ATGall.fsa
           7 sequences; 119,769,761 total letters

Searching......done
                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|30698605|ref|NC_003076.4|  Arabidopsis thaliana chromosom...  1283  0.0
>gi|30698605|ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 1283 bits (647), Expect = 0.0
 Identities = 741/773 (95%), Gaps = 5/773 (0%)
 Strand = Plus / Plus

                                                                            
Query: 1        aaatatcagagatctcttacagttagtttcgttcttaatccaaactactgcagcctgaca 60
                |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18804297 aaatatcaaagatctcttacagttagtttcgttcttaatccaaactactgcagcctgaca 18804356

                                                                            
Query: 61       gacaaatgaggatgcaaacaattttaaagtttatctaacgctagctgttttgtttcttct 120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18804357 gacaaatgaggatgcaaacaattttaaagtttatctaacgctagctgttttgtttcttct 18804416

                                                                            
Query: 121      ctctggtgcaccaacgacggcgttttctcaatcataaagaggcttgttttacttaaggcc 180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18804417 ctctggtgcaccaacgacggcgttttctcaatcataaagaggcttgttttacttaaggcc 18804476

                                                                            
Query: 181      aataatgttgatggatcgaaagaagagggcttttaataaacgagcccgtttaagctgtaa 240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18804477 aataatgttgatggatcgaaagaagagggcttttaataaacgagcccgtttaagctgtaa 18804536

                                                                            
Query: 241      acgatgtcaaaaacatcccacatcgttcagttgaaaatagaagctctgtttatatattgg 300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18804537 acgatgtcaaaaacatcccacatcgttcagttgaaaatagaagctctgtttatatattgg 18804596

                                                                            
Query: 301      tagagtcgactaagagattgtcccttcggggacatccgataaaattggaacgatacagag 360
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 18804597 tagagtcgactaagagattgtcccttcggggacatctgataaaattggaacgatacagag 18804656

                                                                            
Query: 361      aagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtccaaannn 420
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 18804657 aagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtccaaattt 18804716

                                                                            
Query: 421      nnnnggatagaatttcccagcttttttgcgtgtttcagctctcatgatccttggccaatg 480
                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18804717 ttttggatagaatttcccagcttttttgcgtgtttcagctctcatgatccttggccaatg 18804776

                                                                            
Query: 481      ggtgtagtaaattttctgcacattcattggatggaaaagaatggttttagctttagggaa 540
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 18804777 ggtgtagtaaattttctgcacattcattggatggaaaataatggttttagctttagggaa 18804836

                                                                            
Query: 541      taagaaaagtgtat---aaggggatttttgtacaatcacatttgaattaggtctttgaag 597
                ||||||||||||||   |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 18804837 taagaaaagtgtataggaaggggatttttgtacaatcacatttgaattaggtctttgaaa 18804896

                                                                            
Query: 598      tgacatggaatgaggacatatgatgaagctctgtcccttccaagaagtaagccggtgttc 657
                ||||| ||||||||||||||||||||||||||||||| ||||||||||  ||| ||||||
Sbjct: 18804897 tgacagggaatgaggacatatgatgaagctctgtcccatccaagaagttggccagtgttc 18804956

                                                                            
Query: 658      ttgtctcagattttcgtttggccctgacataaacagagtcataacc--ttactaggaggg 715
                |||||||||||| | |||||||||| ||||||||||  ||||||||  ||    ||||||
Sbjct: 18804957 ttgtctcagattgtggtttggccctcacataaacagcttcataaccttttgggtggaggg 18805016

                                                                     
Query: 716      ttaacttgattttgcagcaaagaagaggcttttccattatgtattcggttgct 768
                ||||||||||||||||||||||||||||||||||| ||||||||| |||||||
Sbjct: 18805017 ttaacttgattttgcagcaaagaagaggcttttcctttatgtattaggttgct 18805069

U1 U2.2 U2.3 U2.4 U2.5 U2.6 U2.7 U2.9
U4.1 U4.2 U4.3 U5.1 U6.1 U6.26 U6.29 Top

 




Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!